A polynucleotide targeting the PML-RARG fusion gene and its applications

By designing multinucleotide probes targeting the PML-RARG fusion gene and using a CRISPR/CAS system, the problem of the inability to detect and treat acute promyelocytic leukemia caused by the PML-RARG fusion gene in existing technologies has been solved, enabling precise diagnosis and treatment.

CN117965726BActive Publication Date: 2025-12-02ZHONGNAN HOSPITAL OF WUHAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311855490.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-29
Publication Date
2025-12-02
Estimated Expiration
2043-12-29

AI Technical Summary

Technical Problem

Current technologies are unable to effectively detect and treat acute promyelocytic leukemia caused by the rare PML-RARG fusion gene, and there is a lack of targeted drugs and gene editing tools.

Method used

We designed a multinucleotide probe targeting the PML-RARG fusion gene, combined with a fluorescent reporter group and a fluorescent quencher group, for digital PCR detection, and developed a CRISPR/CAS system for gene editing.

Benefits of technology

It enables precise detection and treatment of the PML-RARG fusion gene, provides targeted treatment options, and improves the sensitivity and specificity of diagnosis and treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117965726B_ABST
    Figure CN117965726B_ABST
Patent Text Reader

Abstract

This invention relates to a polynucleotide targeting the PML-RARG fusion gene and its applications. The PML-RARG fusion gene is formed by the fusion of exon 6 of the PML gene and exon 4 of the RARG gene. The polynucleotide contains a first sequence configured to hybridize with genomic DNA near the break junction of the PML-RARG fusion gene, the first sequence being GGAGGCAGCGGTGGAGA. This invention provides a polynucleotide targeting a novel subtype of the PML-RARG fusion gene. Based on this polynucleotide, new acute promyelocytic leukemia (APML) detection compositions and gene editing tools can be developed, providing further support for research on the pathogenesis of this subtype of AML and drug development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of hematological diseases and gene testing. More specifically, this invention provides a polynucleotide targeting the PML-RARG fusion gene and its application. Background Technology

[0002] Acute promyelocytic leukemia (APL) is a specific type of acute myeloid leukemia characterized by specific chromosomal translocations in leukemic cells. The most common genetic marker in APL is the PML-RARA fusion gene, resulting from the fusion of the PML gene on chromosome 15 and the RARA gene on chromosome 17. However, besides the PML-RARA fusion, other rare fusion variants exist, such as the PML-RARG fusion gene. The reported PML-RARG fusion gene is caused by the fusion of the PML gene on chromosome 15 and the RARG gene on chromosome 12. The breakpoint in the PML gene is located in an intron region adjacent to exon 3, while the breakpoint in the RARG gene is located in an intron region adjacent to exon 1 or 2.

[0003] Existing literature reports that over 98% of APL patients possess the classic PML-RARA fusion gene. APL patients with the PML-RARA fusion gene achieve high remission and cure rates with conventional targeted therapy combining retinoic acid and arsenic. However, other variants of APL, including PML-RARG, may be resistant to retinoic acid combined with arsenic. Therefore, detection of these rare variants is crucial for accurate diagnosis and treatment selection in leukemia. Summary of the Invention

[0004] The applicant discovered that, in addition to the reported fusion variants, the PML-RARG fusion gene also has other subtypes: such as Figure 1 As shown, the breakpoint of the PML-RARG fusion gene subtype discovered in this invention is located in the intron region to the right of exon 6 of the PML gene and the intron region to the left of exon 4 of the RARG gene. However, PML-RARG fusion genes containing this subtype cannot be detected using previously reported probes for PML-RARG fusion genes, leading to difficulties in patient follow-up and treatment, and a lack of targeted drugs and gene editing tools. Based on these technical problems, this invention provides a polynucleotide targeting the PML-RARG fusion gene and its application.

[0005] The technical solution provided by this invention is as follows:

[0006] In a first aspect, the present invention provides a polynucleotide targeting a PML-RARG fusion gene, wherein the PML-RARG fusion gene is formed by the fusion of exon 6 of the PML gene and exon 4 of the RARG gene; the polynucleotide comprises a first sequence configured to hybridize with genomic DNA near the break junction of the PML-RARG fusion gene, the first sequence being GGAGGCAGCGGTGGAGA (SEQ ID NO:1).

[0007] Secondly, the present invention provides the use of the above-mentioned polynucleotide targeting the PML-RARG fusion gene in the preparation of a composition for detecting the PML-RARG fusion gene.

[0008] Thirdly, the present invention provides a composition for detecting the above-mentioned PML-RARG fusion gene, comprising the above-mentioned polynucleotide targeting the PML-RARG fusion gene as a probe.

[0009] In some embodiments provided by the present invention, the composition further includes primer pairs for amplifying the PML-RARG fusion gene:

[0010] The forward primer is: GAGCCCCGTCATAGGAAGTG (SEQ ID NO:2);

[0011] The reverse primer is: GCAGCCTTCACAAGAGCTGAC (SEQ ID NO:3).

[0012] In some embodiments provided by the present invention, the polynucleotide is connected to a fluorescent reporter group and a fluorescent quencher group at both ends.

[0013] In some preferred embodiments provided by this invention, the fluorescent reporter group is 5'-FAM(FITC), dT-FAM(FITC), 3'-FAM(FITC), 5'-TET, 3'-TET, 5'-JOE, 5'-HEX, dT-HEX, 3'-HEX, 5'-VIC, 5'-TAMRA, dT-TAMRA, 3'-TAMRA, 3'-Cy3, 5'-Cy3, 5'-Quasar 570, 3'-Quasar 570, 5'-ROX, dT-ROX, 3'-ROX, 5'-Cy5, 3'-Cy5, 5'-Quasar 670, dT-Quasar 670, 3'-Quasar One of 670, 5'-SIMA, 5', and 3'Cy5.5; the fluorescence quenching group is one of 3'-Dabcyl, dT-Dabcyl, 5'-Dabcyl, 5'BHQ1, dT-BHQ1, 3'-BHQ-1, 5'-BHQ2, dT-BHQ2, 3'-BHQ-2, 3'-BHQ3, 3'eclipse, and 3'-MGB.

[0014] In some preferred embodiments provided by the present invention, the polynucleotide is connected to FAM and MGBNFQ at both ends, respectively.

[0015] In some embodiments provided by the present invention, the composition further includes an internal reference gene and its forward and reverse primers.

[0016] In some preferred embodiments provided by the present invention, the internal reference gene is the ABL gene;

[0017] The forward primer for the ABL gene is:

[0018] GTGGAGATAACACTCTAAGCATAACTAAAGGT(SEQ ID NO:4);

[0019] The reverse primer for the ABL gene is:

[0020] TGATGTAGTTGCTTGGGACCCA (SEQ ID NO: 5).

[0021] Fourthly, the present invention provides a kit comprising the above-described composition for detecting the PML-RARG fusion gene.

[0022] In some embodiments provided by the present invention, the kit further includes reagents for ddPCR detection.

[0023] In some embodiments provided by the present invention, the reagents for ddPCR detection include at least one of a dNTP mixture, a hot-start Taq enzyme, an RNase inhibitor, a reverse transcription primer, and a reverse transcriptase.

[0024] Fifthly, the present invention provides the use of the PML-RARG fusion gene in the preparation of gene editing tools for editing the PML-RARG fusion gene, wherein the PML-RARG fusion gene is formed by fusing exon 6 of the PML gene and exon 4 of the RARG gene.

[0025] In some embodiments provided by this invention, the gene editing tool is a CRISPR / CAS system.

[0026] Sixthly, the present invention provides the use of the PML-RARG fusion gene in the preparation of a medicament for treating acute promyelocytic leukemia, wherein the PML-RARG fusion gene is formed by fusing exon 6 of the PML gene and exon 4 of the RARG gene; the PML-RARG fusion gene contains

[0027] AACAGCAACCACGTGGCCAGTGGCGCCGGGGAGGCAGCGG TGGAGACACAGAGCACCAGCTCAGAGGAGATGGT (SEQ ID NO: 10).

[0028] Compared with the prior art, the present invention has the following advantages:

[0029] This invention discovers a novel PML-RARG fusion gene subtype, based on which a polynucleotide that can target the PML-RARG fusion gene is designed. Using this polynucleotide, a disease diagnostic reagent for acute promyelocytic leukemia is developed to facilitate precise treatment of patients with acute promyelocytic leukemia. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 A simplified schematic diagram of the PML-RARG gene fusion; the chromosome translocation diagram shows that the break junction on chromosome 15 is located in the PML region at 15q24.1, and the break junction on chromosome 12 is located in the RARG gene region at 12q13.13; RNA sequencing analysis revealed a novel fusion between PML exon 6 and RARG exon 4.

[0032] Figure 2 Reverse transcription polymerase chain reaction (RT-PCR) of bone marrow cDNA confirmed the PML-RARG fusion transcript. Partial nucleotide sequences around the break junction are shown; RT-PCR amplification of PML-RARG using bone marrow cDNA yielded a 217 bp band, showing partial nucleotide sequences around the genomic breakpoint. The ABL internal control was amplified as a 126 bp band by RT-PCR.

[0033] Figure 3 : Schematic diagram of ddPCR results for detecting PML-RARG fusion gene sample RNA template in this invention; positive droplet clusters are in the "ch1+ch2-" interval.

[0034] Figure 4 This diagram illustrates the negative control results in the ddPCR kit for detecting the PML-RARG fusion gene of this invention. The droplet clusters of the negative control are located within the "ch1-ch2-" interval.

[0035] Figure 5 This diagram illustrates the positive control results in the ddPCR kit for detecting the PML-RARG fusion gene of this invention. The droplet clusters of the positive control are located in four intervals.

[0036] Figure 6 Location of the fracture connection point on SEQ ID NO:7 and the origin of each segment. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0038] definition

[0039] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms in molecular biology can be found in common molecular biology textbooks.

[0040] Unless the context clearly indicates otherwise, the singular terms “a,” “an,” and “the” include plural referents. Similarly, unless the context clearly indicates otherwise, the word “or” is intended to include “and.” The term “multiple” is used synonymously with the phrase “more than one,” meaning two or more. It should also be understood that all base or amino acid sizes given for nucleic acids or polypeptides, as well as all molecular weight or molecular mass values, are approximate and provided for descriptive purposes. The term “comprising” means “including.” Although similar or equivalent methods and materials to those described herein may be used in implementing or testing this disclosure, suitable methods and materials are described below.

[0041] "Binding" refers to the union between two substances or molecules, such as the hybridization of one nucleic acid molecule (e.g., the binding region) with another (or itself) (e.g., the target nucleic acid molecule). A nucleic acid molecule is bound or stably bound to a target nucleic acid molecule if a sufficient amount of the nucleic acid molecule forms base pairs with or hybridizes with it to allow the binding to be detected. A nucleic acid molecule is "complementary" to another nucleic acid molecule if the two nucleic acid molecules share a sufficient number of complementary nucleic acids, thus forming a stable double or triple strand when their strands bind to each other (hybridize), e.g., by forming Watson-Crick, Hoogsteen, or inverse Hoogsteen base pairs. Stable binding occurs when the nucleic acid molecule remains detectably bound to a target nucleic acid sequence (e.g., a genomic target nucleic acid sequence) under the desired conditions. Complementarity is the degree to which bases in a nucleic acid molecule (e.g., a target nucleic acid probe) pair with bases in a second nucleic acid molecule (e.g., a genomic target nucleic acid sequence). Complementarity is conveniently described as a percentage, which is the proportion of nucleotides that form base pairs between the two molecules or within a specific region or domain of the two molecules. In this invention, "sufficient complementarity" means that there are a sufficient number of base pairs between a nucleic acid molecule or a region thereof and a target nucleic acid sequence (e.g., a genomic target nucleic acid sequence) to achieve detectable binding.

[0042] A nucleic acid “segment” is a sub-region or sub-sequence of a target nucleic acid molecule. Nucleic acid segments can be derived from the target nucleic acid molecule, either hypothetically or actually, in a variety of ways. For example, a segment of a target nucleic acid molecule (such as a genomic target nucleic acid molecule) can be obtained by digestion with one or more restriction enzymes to generate a nucleic acid segment as a restriction fragment. Nucleic acid segments can also be generated by amplification from the target nucleic acid molecule, by hybridization (e.g., subtraction hybridization), by artificial synthesis, or by any other procedure that generates one or more nucleic acids corresponding in sequence to the target nucleic acid molecule. A specific example of a nucleic acid segment is a binding region.

[0043] A "probe" or "nucleic acid probe" is a nucleic acid molecule or set of nucleic acid molecules capable of hybridizing with a target nucleic acid molecule (e.g., a genomic target nucleic acid molecule) and detectable directly or indirectly upon hybridization with the target. Thus, a probe allows for the detection and, in some embodiments, the quantification of the target nucleic acid molecule. In specific embodiments, a probe comprises multiple nucleic acid molecules containing binding regions derived from the target nucleic acid molecule and thus capable of specifically hybridizing with at least a portion of the target nucleic acid molecule. A probe may be referred to as a "labeled nucleic acid probe," indicating that the probe is directly or indirectly coupled to a detectable module or "label" that makes the probe detectable.

[0044] "Nucleic acid" is a single-stranded or double-stranded deoxyribonucleotide or ribonucleotide polymer, and unless otherwise limited, encompasses analogs of naturally occurring nucleotides that hybridize with nucleic acids in a manner similar to that of naturally occurring nucleotides. The term "nucleotide" includes, but is not limited to, monomers containing a base linked to a sugar (such as ribose, deoxyribose, or a synthetic analog thereof) (such as pyrimidine, purine, or a synthetic analog thereof) or a base linked to an amino acid (such as in peptide nucleic acids (PNA)). A nucleotide is a monomer within a polynucleotide. A nucleotide sequence refers to the base sequence within a polynucleotide.

[0045] A “sample” is a biological specimen obtained from a subject containing genomic DNA, RNA (including mRNA), proteins, and combinations thereof. Examples include, but are not limited to, chromosome preparations, peripheral blood, urine, saliva, tissue biopsies, surgical specimens, bone marrow, amniocentesis samples, and autopsy materials. In one example, the sample includes genomic DNA or RNA. In some examples, the sample is a cytogenetic preparation, for example, which may be placed on a microscope slide. In specific examples, the sample is used directly or, prior to use, is processed by, for example, fixation (e.g., using formalin).

[0046] A “target nucleic acid sequence or molecule” is a defined region or specific sequence of a nucleic acid molecule, such as a genome (e.g., a gene or region of mammalian genomic DNA containing a gene of interest) or an RNA sequence. In an example where the target nucleic acid sequence is a target genomic sequence, such a target can be defined by its location on a chromosome (e.g., in a normal cell), for example, by reference to its specific location on a chromosome according to cellular genetic naming; by reference to its location on a genetic map; by reference to a hypothetical or assembled contiguous group; by its specific sequence or function; by its gene or protein name; or by any other unique means of identifying it from other genetic sequences in the genome. In some examples, the target nucleic acid sequence is a mammalian or viral genomic sequence. In other examples, the target nucleic acid sequence is an RNA sequence.

[0047] In some cases, changes in the target nucleic acid sequence (e.g., genomic nucleic acid sequence) are “associated” with a disease or condition; that is, detection of the target nucleic acid sequence can be used to infer the state of a sample in relation to a disease or condition. For example, the target nucleic acid sequence may exist in two (or more) distinguishable forms, such that the first form is associated with the absence of a disease or condition, while the second (or different) form is associated with the presence of that disease or condition. The two different forms can be qualitatively distinguishable (e.g., through polynucleotide polymorphism), and / or the two different forms can be quantitatively distinguishable (e.g., through the copy number of the target nucleic acid sequence present in the cell). Invention Details

[0049] This invention utilizes transcriptome sequencing on samples from patients with acute promyelocytic leukemia to discover a rare fusion variant—the PML-RARG fusion gene. Comparison with previously reported PML-RARG fusion genes reveals that the breakpoint in the PML gene is located in intron 3, and the breakpoint in the RARG gene is located in intron 1 or 2. In contrast, the PML-RARG fusion gene discovered in this invention has a breakpoint in intron 6 for the PML gene and a breakpoint in the RARG gene to the left of intron 4. Specifically, the PML-RARG fusion gene discovered in this invention contains the sequence: GGAGCCCCGTCATAGGAAGTGAGGTCTTCCTGCCCAACAGCAAC CACGTGGCCAGTGGCGCCGGGGAGGCAG|CGGTGGAGACACAGA GCACCAGCTCAGAGGAGATGGTGCCCAGCTCGCCCTCGCCCCCTCCGCCTCCGCCTCCCCCCTCGG (SEQ ID NO: 7).

[0050] like Figure 6 As shown, the | in SEQ ID NO:7 indicates the break connection point; the underlined segment below originates from exon 6 of the PML gene; the segment below with a wavy line originates from exon 4 of the RARG gene; the segment below with a repeated sign originates from exon 4 of the RARG gene; and the bolded segment originates from exon 5 of the PML gene.

[0051] The present invention provides a polynucleotide targeting the PML-RARG fusion gene, comprising a first sequence configured to hybridize with genomic DNA near the break junction, the first sequence being GGAGGCAGCGGTGGAGA (SEQ ID NO:1); the PML-RARG fusion gene is formed by the fusion of exon 6 of the PML gene and exon 4 of the RARG gene.

[0052] The present invention also provides the use of the above-described polynucleotide targeting the PML-RARG fusion gene in the preparation of compositions for detecting the PML-RARG fusion gene.

[0053] In an exemplary embodiment, the present invention provides a composition for detecting the above-mentioned PML-RARG fusion gene, comprising the above-mentioned polynucleotide targeting the PML-RARG fusion gene as a probe. This composition targets genomic DNA near the breakpoint of the PML-RARG fusion gene as a nucleic acid sequence, enabling accurate detection of the presence of the PML-RARG fusion gene, thereby facilitating targeted treatment or early intervention.

[0054] In an exemplary embodiment, the composition further includes a primer pair for amplifying the PML-RARG fusion gene:

[0055] The forward primer is: GAGCCCCGTCATAGGAAGTG (SEQ ID NO:2);

[0056] The reverse primer is: GCAGCCTTCACAAGAGCTGAC (SEQ ID NO:3).

[0057] In exemplary embodiments, the polynucleotide is connected to a fluorescent reporter group and a fluorescent quencher group at both ends. In some embodiments, the fluorescent reporter group is 5'-FAM(FITC), dT-FAM(FITC), 3'-FAM(FITC), 5'-TET, 3'-TET, 5'-JOE, 5'-HEX, dT-HEX, 3'-HEX, 5'-VIC, 5'-TAMRA, dT-TAMRA, 3'-TAMRA, 3'-Cy3, 5'-Cy3, 5'-Quasar 570, 3'-Quasar 570, 5'-ROX, dT-ROX, 3'-ROX, 5'-Cy5, 3'-Cy5, 5'-Quasar 670, dT-Quasar 670, 3'-Quasar One of 670, 5'-SIMA, 5', and 3'Cy5.5; the fluorescence quenching group is one of 3'-Dabcyl, dT-Dabcyl, 5'-Dabcyl, 5'BHQ1, dT-BHQ1, 3'-BHQ-1, 5'-BHQ2, dT-BHQ2, 3'-BHQ-2, 3'-BHQ3, 3'eclipse, and 3'-MGB.

[0058] In some preferred embodiments, the polynucleotide is connected to FAM and MGBNFQ at both ends, respectively.

[0059] In some embodiments, the composition further includes an internal reference gene and its forward and reverse primers. In some preferred embodiments, the internal reference gene is the ABL gene;

[0060] The forward primer for the ABL gene is:

[0061] GTGGAGATAACACTCTAAGCATAACTAAAGGT(SEQ ID NO:4);

[0062] The reverse primer for the ABL gene is:

[0063] TGATGTAGTTGCTTGGGACCCA (SEQ ID NO: 5).

[0064] The present invention also provides a kit comprising the above-described composition for detecting the PML-RARG fusion gene. This kit can be used for detection techniques such as fluorescence in situ hybridization (FISH), reverse transcription polymerase chain reaction (RT-PCR), and digital PCR (ddPCR).

[0065] Traditional methods for detecting fusion genes, such as fluorescence in situ hybridization (FISH) and reverse transcription polymerase chain reaction (RT-PCR), while widely used in clinical practice, have limitations in sensitivity and specificity. These methods are ineffective for detecting low-abundance or atypical fusion genes, which is precisely the challenge faced by PML-RARG fusion gene detection. Digital PCR (ddPCR) technology is an emerging molecular biology technique that offers higher sensitivity and accuracy. Unlike traditional quantitative PCR (qPCR), ddPCR achieves single-molecule quantification by dividing the sample into thousands to tens of thousands of microreaction units. This technology shows significant advantages in detecting low-abundance targets, complex gene rearrangements, and subtle differences in gene expression. In some embodiments, the kit provided by this invention is used for digital PCR detection. The kit also includes reagents for ddPCR detection, including at least one of a mixture of four dNTPs, a hot-start Taq enzyme, an RNase inhibitor, a reverse transcription primer, and a reverse transcriptase.

[0066] There is currently no effective treatment for acute promyelocytic leukemia caused by the PML-RARG fusion gene. Those skilled in the art can use gene editing technology to construct the PML-RARG fusion gene and related organisms to study the pathogenesis of acute promyelocytic leukemia associated with the PML-RARG fusion gene. Based on this, the present invention provides the use of the aforementioned PML-RARG fusion gene in the preparation of gene editing tools for editing the PML-RARG fusion gene.

[0067] In some embodiments, the gene editing tool is a CRISPR / CAS system, which includes a first gRNA and a first CAS protein, a second gRNA and a second CAS protein; the first gRNA targets the 6th intron region of the PML gene, and the first CAS protein cleaves the break junction; the second gRNA targets the 4th intron region of the RARG gene, and the second CAS protein cleaves the break junction.

[0068] Currently, there are no drugs for acute promyelocytic leukemia caused by the PML-RARG fusion gene. Those skilled in the art can develop drugs by performing molecular amplification, protein transcription, and animal model construction using the PML-RARG fusion gene discovered according to this invention. Based on this, this invention provides the use of the PML-RARG fusion gene in the preparation of drugs for the treatment of acute promyelocytic leukemia.

[0069] The technical solution of the present invention will be described in detail below through specific embodiments:

[0070] Example 1

[0071] 1. Probe Design:

[0072] To ensure highly specific detection of the PML-RARG fusion gene, this invention uses genomic DNA near the breakpoint of the PML-RARG fusion gene as the target nucleic acid sequence (e.g., ...). Figure 6 As shown, a first sequence (SEQ ID NO:1) that is complementary to the target nucleic acid sequence was designed, and a fluorescent reporter group and a fluorescent quencher group were connected to both ends of the first sequence to form a probe for real-time monitoring of the amplification reaction during ddPCR.

[0073] The length of the probe's polynucleotide (i.e., the first sequence) should follow probe design principles: ideally between 18-27 bp, with a Tm value between 68-72℃, preferably 70℃. This ensures the probe's Tm value is 10℃ higher than the primer's Tm value, guaranteeing that the probe binds to the target nucleic acid sequence before the primer during annealing. Therefore, the probe is best composed of GC-rich, conserved fragments to ensure a high Tm value.

[0074] Specifically, the first sequence contains 17 bases: GGAGGCAG|CGGTGGAGA (SEQ ID NO:1), with FAM and MGBNFQ connected at both ends, and | indicating the location of the break connection point.

[0075] The present invention also designed an internal reference ABL gene probe, the nucleotide sequence of which is a nucleotide sequence containing 20 bases: CATTTTTGGTTTGGGCTTCA (SEQ ID NO:6), with VIC and MGBNFQ connected at both ends respectively.

[0076] 2. Primer Design:

[0077] The number of bases in a primer cannot exceed 150, and primer design principles must be met.

[0078] 2.1 Design of forward primers

[0079] Forward primer design targeting the PML gene breakpoint will target the sequence of exon 6, approximately GGAGCCCCGTCATAGGAAGTGAGGTCTTCCTGCCCAACAGCAAC CACGTGGCCAGTGGCGCCGGGGAGGCAG- (SEQ ID NO: 8, - is the breakpoint) as the template sequence for forward primer design. The target nucleic acid sequence of the forward primer will be no more than 100 bases away from the breakpoint.

[0080] The sequence of the forward primer is: GAGCCCCGTCATAGGAAGTG (SEQ ID NO:2) (PML exon6F).

[0081] 2.2 Design of reverse primers

[0082] The reverse primer design targeting the breakpoint of the RARG gene targets the sequence of exon 4, which is approximately -CGGTGGAGACACAGAGCACCAGCTCAGAGGAGATGGTGCCCAG CTCGCCCTCGCCCCCTCCGCCTCCTCGG (SEQ ID NO: 9, - is the breakpoint).

[0083] The reverse primer sequence is: GCAGCCCTTCACAAGAGCTGAC (SEQ ID NO:3)(RARG exon4R).

[0084] 2.3 Design of forward and reverse primers for the internal reference gene ABL:

[0085] ABL F: GTGGAGATAACACTCTAAGCATAACTAAAGGT (SEQ ID NO: 4);

[0086] ABL R: TGATGTAGTTGCTTGGGACCCA (SEQ ID NO: 5).

[0087] 3. Reagent Kit Design

[0088] The kit contains the primers and probes mentioned above, as well as an RT reaction solution for ddPCR detection. The RT reaction solution contains a mixture of dNTPs, a hot-start Taq enzyme, an RNase inhibitor, reverse transcription primers, and reverse transcriptase.

[0089] Example 2

[0090] The following examples describe a method for detecting the PML-RARG fusion gene using digital PCR technology.

[0091] 1 Sample Processing

[0092] After performing nucleic acid extraction (concentration maintained at 75–125 ng / μL), take the corresponding RT reaction solution from the kit designed in section 3.1, thaw and mix at room temperature, then centrifuge at 2000 rpm for 10 seconds. Prepare the PCR premix for each test as follows: 2.5 μL RT-MIX + 1 μL RT-enzyme + 1.5 μL RT-primer. Aliquot the prepared reverse transcription premix into 5 μL tubes. Add 5 μL of template to each tube for reverse transcription. It is recommended to perform the experiment immediately after nucleic acid extraction; otherwise, store below -20℃. The reverse transcription program is: 55℃, 15 min; 4℃, forever.

[0093] 2. Preparation of amplification reagents

[0094] PCR premix preparation: Take the corresponding reaction solution from the kit, thaw and mix at room temperature, centrifuge at 2000 rpm for 10 s, and prepare the PCR premix for each test as follows: 5 μL ddPCR-PML-RARG reaction solution + 10 μL ddPCR MIX3. Aliquot the prepared PCR premix into each PCR tube in a volume of 15 μL.

[0095] Sample addition: Add 5 μL of template to each PCR tube containing the above PCR premix. The total volume of each reaction system is 20 μL. Tightly cap the PCR tube, centrifuge at 2000 rpm for 10 s, vortex to mix, centrifuge again for 10 s, and then prepare microdroplets.

[0096] Note: Before opening the tube containing cDNA, you need to vortex it to mix it well and centrifuge it briefly. Open the tube cap carefully, especially when using a tube stack. Please handle it with care to avoid splashing liquid into other tubes due to excessive force when opening the cap.

[0097] 3. Preparation of microdroplets

[0098] Add eight 20 μL reaction mixtures to the eight wells in the middle row of the droplet generator cartridge. Note: Samples must be added to the middle row of the droplet generator cartridge (DG8 cartridge) first (if there are fewer than eight samples, add 20 μL / L ddPCR Buffer Control (purchased from Bio-Rad Laboratories, USA) to the empty wells). Avoid generating air bubbles when adding samples.

[0099] Add 70 μL of droplet generating oil to each of the eight wells at the bottom of the droplet generating card, cover with the gasket, and gently and steadily place the droplet generating card into the droplet generator to start generating droplets. Pay attention to the indicator light status on the instrument. It usually takes less than 2 minutes to complete.

[0100] Droplets are generated in the top row of wells of the droplet generator card. Transfer the generated droplets (approximately 35–45 μL) to a 96-well plate. Note: Aspirate the droplets (avoid touching the wall of the plate) and release the droplets slowly to prevent breakage. Cover the PCR plate with the heat-sealing film to prevent oil evaporation. Discard the used droplet generator card and rubber pad after each use.

[0101] 4 sealing films

[0102] After transferring the droplets into the 96-well plate, seal the plate using a preheated PX1 heat sealer. The recommended procedure is: 180℃ for 5 seconds, without reversing the direction for secondary sealing. After sealing, PCR should be performed within 30 minutes, or PCR should be performed within 4 hours in a 4℃ refrigerator.

[0103] 5PCR amplification

[0104] PCR amplification program: 95℃, 10min; (94℃, 15s; 58℃, 60s) 40 cycles; 98℃, 10min; 4℃, 5min. The reaction volume is 40μL. Note that the heating and cooling rate is ≤2℃ / s.

[0105] 6-droplet reading

[0106] Turn on your computer first, then turn on the Droplet Reader. Preheat it for at least 30 minutes before use.

[0107] Place the previously completed PCR 96-well plate into the plate holder and gently place it into the droplet reader;

[0108] Open the QuantaSoft software, set the sample information for the 96-well plate, and then you can run it.

[0109] Note: Select "ddPCR Supermix for probes" for the premix settings; select "FAM / VIC" for the dye settings.

[0110] 7 Results Analysis

[0111] 7.1 After the detection is complete, click "2D Amplitude" to view the clustering plots for Channel 1 and Channel 2. This plot allows for manual or automatic adjustment of the thresholds to assign positive and negative droplets to each detection channel.

[0112] 7.2 Click “Auto Analyze” to reset the threshold.

[0113] Manually specify the threshold: — Use the threshold crosshair to specify the classification region of the entire dot plot (optional only in heatmap mode); — Use the ellipse, rectangle, or lasso threshold adjustment tool to classify the dot plot region: Click the corresponding tool button, then click the region type in "Working cluster selector," and use the tool to select the corresponding region. The fluorescence threshold line setting should refer to the negative and positive controls: In 2D Amplitude, the fluorescence threshold line should be positioned so that the droplet clusters of the negative control are within the "ch1-ch2-" interval, and the four droplet clusters of the positive control are located within their respective intervals.

[0114] 8. Result Determination

[0115] Formula for calculating the proportion of fusion genes: Ch1 / (Ch1+Ch2).

[0116] If the proportion of fusion genes If at least 3 points fall within the “ch1+ch2-” region, the result is considered positive, and the ratio of the fusion gene to the internal reference gene is calculated according to the formula above.

[0117] If the above positive criteria are not met and the total droplet count is ≥8000: If the total copy number is <50, the sampling volume needs to be increased and the sample re-extracted for testing to avoid false negatives due to insufficient nucleic acid addition; If the total copy number is ≥50 and the fusion gene ratio is... Furthermore, if the sum of points falling within the "ch1+ch2-" region and the points falling within the "ch1+ch2+" region is 2 points, perform 3 replicates for retesting. If 2 or more wells meet the positive criteria, the result is considered positive, and the fusion gene ratio is calculated according to the formula. Conversely, if the sum is below the detection limit, and the total copy number is ≥50 with a fusion gene ratio of ≥50%, the result is considered positive. If the sum of the points in the "ch1+ch2-" region and the points in the "ch1+ch2+" region is less than or equal to 1, then the value is below the detection limit.

[0118] If the positive criteria are not met and the total number of droplets is less than 8000, the droplet generation in that reaction well is not ideal. Droplet generation should be repeated, and the result should be judged as described above.

[0119] 9. Quality Control and Validation

[0120] 9.1 The kit will include positive and negative controls to verify the accuracy of each experiment:

[0121] Determination of positive control validity: Ratio of fusion genes (fusion gene / fusion gene + internal reference gene) And the sum of points falling in the “ch1+ch2-” region and points falling in the “ch1+ch2+” region is ≥3.

[0122] Determination of the validity of a negative control: The sum of the points in the "ch1+ch2-" region and the points in the "ch1+ch2+" region is ≤ 1.

[0123] 9.2 Conduct additional validation experiments to ensure that the specificity and sensitivity of the primers and probes meet the clinical diagnostic criteria, can detect the PML-RARG fusion gene in nucleic acids extracted from samples such as bone marrow fluid and peripheral blood, and cannot detect other fusion genes.

[0124] According to the foregoing embodiments, the present invention provides a polynucleotide targeting the PML-RARG fusion gene and its application. Specifically, it provides a composition of primers and probes for detecting the rare PML-RARG fusion gene in acute promyelocytic leukemia (APL), as well as a digital PCR kit based on the above composition. This kit has significant application value in modern medical diagnosis, molecular biology research, and personalized medicine. In addition to clinical diagnosis, the kit can also be used to study the role of PML and RARG gene fusion in the pathogenesis of APL, providing a deeper understanding of the treatment of acute promyelocytic leukemia.

[0125] The above description is merely a specific embodiment of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features claimed herein.

Claims

1. A polynucleotide targeting the PML-RARG fusion gene, characterized in that: The PML-RARG fusion gene is formed by fusing exon 6 of the PML gene and exon 4 of the RARG gene; the polynucleotide is configured as a first sequence that hybridizes with genomic DNA near the break junction of the PML-RARG fusion gene, the first sequence being GGAGGCAGCGGTGGAGA, wherein the primer pair used to amplify the PML-RARG fusion gene is the forward primer GAGCCCCGTCATAGGAAGTG and the reverse primer GCAGCCCTTCACAAGAGCTGAC.

2. Use of the polynucleotide targeting the PML-RARG fusion gene as described in claim 1 in the preparation of a composition for detecting acute promyelocytic leukemia.

3. A composition for detecting acute promyelocytic leukemia, characterized in that: The probe contains the polynucleotide targeting the PML-RARG fusion gene as described in claim 1.

4. The composition for detecting acute promyelocytic leukemia according to claim 3, characterized in that: The composition also includes primer pairs for amplifying the PML-RARG fusion gene: The forward primer is: GAGCCCCGTCATAGGAAGTG; The reverse primer is: GCAGCCTTCACAAGAGCTGAC.

5. The composition for detecting acute promyelocytic leukemia according to claim 3, characterized in that: The polynucleotide is connected to a fluorescent reporter group and a fluorescent quencher group at both ends.

6. The composition for detecting acute promyelocytic leukemia according to claim 3, characterized in that: The composition also includes an internal reference gene and its forward and reverse primers.

7. A reagent kit, characterized in that: The composition comprising any one of claims 3 to 6 for detecting acute promyelocytic leukemia.

8. The reagent kit according to claim 7, characterized in that: The kit also includes reagents for ddPCR detection.

Citation Information

Patent Citations

  • Kit and method for quantitatively detecting PML-RARA fusion gene through digital PCR

    CN112626208A