Construction and application of biofilm dispersion regulation gene kinA knockout strain
By constructing the kinA knockout strain △kinA in Bacillus Vares FZB42, the problem of unknown role of kinA in biofilm dispersion in the prior art was solved, and the indole acetic acid (IAA) secretion ability and gene expression level of FZB42 were significantly improved.
Patent Information
- Application Number
- CN202311837322.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-28
- Publication Date
- 2025-03-14
- Estimated Expiration
- 2043-12-28
AI Technical Summary
There is no relevant literature report on the role of kinA in biofilm dispersion in the prior art, nor is there any relevant research on its generation of probiotic IAA.
A kinA knockout strain of the biofilm dispersed regulatory gene was constructed, and the kinA gene was identified by reverse PCR. The target fragment of the knockout kinA gene was obtained by overlapping PCR. The fragment was introduced into the wild-type FZB42 strain by chemical transformation to obtain the kinA knockout strain △kinA.
Compared with wild-type FZB42, the biofilm dispersion ability of the △kinA strain lacked its biofilm dispersion ability, and the level of secretion of indole acetic acid (IAA) was significantly improved, and the relative expression level of tryptophan synthesis gene trpB, trpC and indole acetic acid (IAA) synthesis gene ysnE significantly increased.
Smart Images
Figure CN118006654B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microbial genetic engineering, and more specifically, relates to a construction method and application of a knockout strain of a biofilm dispersion regulating gene kinA. Background Art
[0002] Bacillus velezensis FZB42 is a Gram-positive plant rhizosphere growth-promoting bacterium. It was isolated from the rhizosphere of German sugar beets in 1998 and sequenced as the first Bacillus amyloliquefaciens in 2007. FZB42 has been commercialized and colonizes plant roots in the form of biofilms and promotes plant growth. The development of bacterial biofilms is a complex cyclic process, including initial attachment, formation, maturation, and dispersion. In addition to forming biofilms to help colonization, FZB42 can also synthesize indoleacetic acid (IAA) to promote plant growth. FZB42 has broad application prospects as a plant rhizosphere growth-promoting bacterium, so analyzing its growth-promoting mechanism is of far-reaching significance.
[0003] The whole genome of FZB42 has been sequenced, which provides a premise for screening biofilm regulatory genes. Given that biofilm colonization of FZB42 is a key factor in its growth-promoting function, screening FZB42 biofilm regulatory genes will help to explore its growth-promoting value.
[0004] Bacillus forms spores to survive in nutrient-rich cultures. Over the years, the complex regulatory network that controls spore formation has been gradually elucidated. Five histidine kinases, namely kinA, KinB, KinC, KinD, and KinE, sense and transmit environmental signals, ultimately leading to the phosphorylation of Spo0A, a central transcriptional regulator of sporulation genes.
[0005] KinA is the main histidine kinase among the phosphatases that regulate sporulation. During starvation and stress, kinA is autophosphorylated and transfers its phosphate to Spo0A via Spo0F and Spo0B. KinA has three PAS domains for sensing the redox state of the cell, and its transcription is controlled by the steady-state sigma factor σH.
[0006] However, there is no relevant literature report on the role of kinA in biofilm dispersion, nor is there any research on its correlation with the production of the biopromoting substance IAA. Summary of the invention
[0007] In view of the above-mentioned problems existing in the prior art, the technical problem to be solved by the present invention is to provide a method for constructing a biofilm dispersion regulating gene kinA knockout strain, which is used to construct a biofilm dispersion regulating gene kinA knockout strain; another technical problem to be solved by the present invention is to provide an application of the biofilm dispersion regulating gene kinA knockout strain for screening excellent growth-promoting strains.
[0008] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:
[0009] The method for constructing a knockout strain of the biofilm dispersion regulating gene kinA comprises the following steps:
[0010] 1) Construction of a knockout fragment of the biofilm dispersion regulating gene kinA;
[0011] 2) transforming the constructed biofilm dispersion regulatory gene kinA knockout fragment into Bacillus varezii FZB42;
[0012] 3) Cultivate and screen to obtain a knockout strain of the biofilm dispersion regulating gene kinA;
[0013] The nucleotide sequence of the biofilm dispersion regulating gene kinA is shown in SEQ ID NO.1.
[0014] The nucleotide sequence of the knockout fragment of the biofilm dispersion regulating gene kinA is shown in SEQ ID NO.3.
[0015] The method for constructing the knockout fragment of the biofilm dispersion regulating gene kinA knockout fragment is as follows: based on the biofilm dispersion mutation library, the biofilm dispersion regulating gene kinA is identified by reverse PCR, and the target fragment of the kinA gene knockout is obtained by overlapping PCR, that is, the knockout fragment of the biofilm dispersion regulating gene kinA.
[0016] The reverse PCR primer sequences are as follows:
[0017] FBO752-F: 5'-GCTTGTAAATTCTATCATAATTG-3',
[0018] FBO753-R: 5'-AGGGAATCATTTGAAGGTTGG-3'.
[0019] The biofilm dispersion regulating gene kinA knockout strain constructed by any of the above-mentioned methods for constructing the biofilm dispersion regulating gene kinA knockout strain.
[0020] Application of the biofilm dispersion regulatory gene kinA knockout strain in promoting the secretion of indoleacetic acid by Bacillus varezii FZB42.
[0021] Application of the biofilm dispersion regulatory gene kinA knockout strain in promoting the expression of tryptophan synthesis genes trpB and trpC.
[0022] Application of the biofilm dispersion regulatory gene kinA knockout strain in promoting the expression of the indoleacetic acid synthesis gene ysnE.
[0023] Application of the biofilm dispersion regulatory gene kinA in inhibiting the secretion of indoleacetic acid by Bacillus varezii FZB42.
[0024] Application of the biofilm dispersion regulatory gene kinA in inhibiting the expression of tryptophan synthesis genes trpB, trpC and indoleacetic acid synthesis gene ysnE.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] 1) Based on the biofilm dispersion mutation library, the present invention identified the biofilm dispersion regulatory gene kinA by reverse PCR, obtained the target fragment of knocking out the kinA gene by overlapping PCR, and introduced the fragment into the wild-type FZB42 strain by chemical transformation to obtain the kinA knockout strain ΔkinA.
[0027] 2) Compared with the wild-type FZB42, the ΔkinA strain of the present invention lacks the ability to disperse biofilm.
[0028] 3) The level of indoleacetic acid (IAA) secreted by the ΔkinA strain of the present invention is significantly increased compared with the wild-type FZB42.
[0029] 4) Compared with the wild-type FZB42, the relative expression levels of the tryptophan biosynthesis genes trpB and trpC and the indoleacetic acid (IAA) biosynthesis gene ysnE in the ΔkinA strain of the present invention were significantly increased. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 This is the dispersion map of FZB42 and △kinA biofilm;
[0031] Figure 2 is the graph of FZB42 and ΔkinA IAA secretion levels;
[0032] Figure 3 The relative expression levels of FZB42 and △kinA trpB, trpC, and ysnE at 12 h of culture time. DETAILED DESCRIPTION
[0033] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified, the technical means used are conventional means well known to those skilled in the art.
[0034] The Bacillus varezii FZB42 of the present invention is stored in the Molecular Pathology Laboratory of the Forestry College of Nanjing Forestry University.
[0035] Main reagents: Taq I endonuclease, Premix Taq TM , high-fidelity enzymes were purchased from Takara; gel recovery kits were purchased from Vazyme; reverse transcription and qPCR kits were purchased from TIANGEN; 3-indoleacetic acid was purchased from Sangon; other reagents were of analytical grade.
[0036] LB medium: Tryptone 10g / L, Yeast extract 5g / L, Nacl 5g / L, solid culture medium needs to be supplemented with Agar 15g / L.
[0037] LBGM liquid medium: LB medium supplemented with 1 mL 100 mM MnSO4 / L and 10 mL glycerol / L.
[0038] Example 1
[0039] 1. Construction of FZB42 transposon library using Escherichia coli-Bacillus shuttle plasmid pMarA
[0040] The E. coli-Bacillus shuttle plasmid pMarA was transformed into FZB42 by electroporation, and the correctly verified transformant was named FBS239.
[0041] The FBS239 plates stored in a -80°C refrigerator were streaked and cultured in a 30°C constant temperature incubator overnight. A single colony was picked and inoculated into LB liquid medium (Kan, Em) and cultured at 30°C, 200 rpm for 12 h. The bacterial solution was diluted 10 5 ~10 7 Spread on Kan screening medium, place in oven at 50℃ for 12h, transfer to constant temperature incubator at 30℃ for 12h; pick out single colonies and streak inoculate on Kan and Em screening medium one by one. The colony that can grow on Kan screening medium but not on Em screening medium is a correct transposon, and 5000 transposons are selected to form FZB42 transposon mutation library.
[0042] 5000 transformants were inoculated into 96-well plates containing LBGM liquid culture medium and cultured at 30°C for 96 h. A mutant strain SL15 was screened based on the biofilm non-dispersion phenotype.
[0043] 2. Identification of the insertion position of the transposable sequence in the mutant SL15
[0044] The genomic DNA of the mutant strain SL15 was extracted by the CTAB method, and the genomic DNA of the mutant strain was digested with Taq I. After sufficient digestion, T4 DNA ligase was used for enzyme ligation. Reverse PCR primers were designed according to the transposition sequence TnYLB-1 (SEQ ID No. 2), and the primer sequences were as follows:
[0045] FBO752-F: 5'-GCTTGTAAATTCTATCATAATTG-3',
[0046] FBO753-R: 5'-AGGGAATCATTTGAAGGTTGG-3'.
[0047] The enzyme linkage product was used as a template, FBO752-F was used as the upstream primer, and FBO753-R was used as the downstream primer. According to the PCR reaction system (DNA of enzyme linkage 2 μL, Primer-F 1 μL, Primer-R 1 μL, Premix Taq TM 12.5μL, ddH2O up to 25μL) and PCR reaction program (95℃3min; 95℃15s, 50℃15s, 72℃3min, 30 cycles; 72℃5min), the sequencing results of PCR products were compared with the FZB42 genome map, and the biofilm dispersion regulating gene kinA (SEQID No.1) was identified.
[0048] 3. Construction of kinA gene knockout strain △kinA
[0049] 1) According to the FZB42 genome map, primers were designed as follows:
[0050] SLO21-F: 5'-GATCGGACAGTTTGATACGTATACGCC-3',
[0051] SLO22-R:
[0052] 5'-CATAGTATCGACGGAGCCGA-ATTACCTCGTCTTTGCTGTCGGC-3', SLO23-F:
[0053] 5'-GTACATCCGCAACTGTCCAT-TTCAATTGACACGATCGCCGT-3',
[0054] SLO24-R: 5'-TCACTGAATACATTGAGAGAAGGC-3'.
[0055] The CTAB method was used to extract FZB42 genomic DNA, which was used as a template. SLO21 and SLO23 were used as upstream primers, and SLO22 and SLO24 were used as downstream primers. The PCR reaction system (Genome DNA 2 μL, Primer-F 1 μL, Primer-R 1 μL, Max DNA Polymerase 25μL, ddH2O up to 50μL) and PCR reaction program (98℃10s; 98℃10s, 55℃15s, 72℃30s, 30 cycles, 72℃120s) were used to amplify fragments of about 1000bp upstream and downstream of kinA.
[0056] 2) Design primers according to the pMarA plasmid map as follows:
[0057] O4-Km-F: 5'-TCGGCTCCGTCGATACTATG-3',
[0058] O5-Km-R: 5'-ATGGACAGTTGCGGATGTAC-3'.
[0059] FBS239 DNA was extracted using the CTAB method and used as a template. O4-Km was used as the upstream primer and O5-Km was used as the downstream primer. The PCR reaction system (Genome DNA 2 μL, Primer-F 1 μL, Primer-R 1 μL, The Kan-resistant fragment was amplified using the following PCR reaction program (98°C for 10 s; 98°C for 10 s, 55°C for 15 s, 72°C for 30 s, 30 cycles, and 72°C for 120 s).
[0060] 3) Purify the three PCR products according to the instructions of the common DNA product purification kit (TIANGEN, DP204), measure the concentration in ng / μL by Nanodrop, convert it to pmol concentration, mix the three purified PCR products in a ratio of 1:1:1 as templates, without adding primers, and follow the PCR reaction system (template DNA 10μL, Max DNA Polymerase 25 μL, ddH2O up to 50 μL) PCR reaction program (98°C 10 s; 98°C 10 s, 55°C 15 s, 72°C 30 s, 12 cycles, 72°C 120 s) amplification.
[0061] The PCR product from the previous step was directly used as a template, and SLO1 was used as the upstream primer and SLO4 as the downstream primer to amplify the target fragment. Electrophoresis showed about 3000 bp, which was in line with expectations, and the target fragment for knocking out the kinA gene was obtained (SEQ ID No. 3).
[0062] 4) According to the instructions of the common agarose gel DNA recovery kit (TIANGEN, DP209), the target fragment was excised and recovered.
[0063] 5) The target fragment was transformed into wild-type FZB42 by chemical transformation to obtain kinA gene knockout transformants.
[0064] 6) Positive colony PCR detection
[0065] Pick a single colony of the transformant obtained in the previous step and place it in a centrifuge tube containing 30 μL ddH2O. Place it in a metal bath at 100°C for 10 minutes, then immediately place it in an ice bath for 2 minutes, centrifuge it at 12000 rpm for 1 minute, and take 1 μL of the supernatant as a template.
[0066] According to the FZB42 genome map, the primers were designed as follows:
[0067] kinA-F: 5'-TCAAATGGCTCAATATATTTCAGCC-3',
[0068] kinA-R: 5'-TTTATTGTTTCGGGAATGTAATATGAA-3'.
[0069] The 2×Taq enzyme system of Takara Company was used, kinA-F was used as the upstream primer, kinA-R was used as the downstream primer, and the bacterial solution was PCR amplified according to the reaction system (8.5μL ddH2O, 12.5μL 2×TaqMaster Mix, 1μL supernatant, 1μL kinA-F (10μM), 1μL kinA-R (10μM)) and the reaction program (95℃5min; 95℃30s, 50℃30s, 72℃60sec / kb, 30 cycles; 72℃5min). The amplified bacterial solution PCR was taken out for gel electrophoresis detection, and the bacterial solution with bands in the electrophoresis diagram that were similar in size to the target fragment and bright and clear, that is, the positive clone bacterial solution, was sampled and sent to the company for sequencing. The sequencing results were sequenced using BLAST (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) software, and the alignment was correct, indicating that the kinA gene knockout strain △kinA was successfully constructed.
[0070] Example 2
[0071] Under sterile conditions, single colonies of wild-type FZB42 and △kinA were picked and inoculated into LB liquid medium for pre-culture at 37°C and 200 rpm overnight. The pre-cultured bacterial solution was taken and adjusted to OD 600 =1, inoculated into 24-well plates at 1% (2 mL LBGM medium was added to each well), cultured at 25°C for 120 h, and the biofilm at the solid-air interface and the bottom solution were observed.
[0072] The results are as follows Figure 1 As shown, the biofilm on the FZB42 surface has dispersed, while the △kinA surface still maintains a robust biofilm. The bottom solution of FZB42 has become turbid while the bottom solution of △kinA is still clear, indicating that the loss of kinA causes defects in biofilm dispersion.
[0073] Example 3
[0074] Weigh pure 3-indoleacetic acid and dissolve it in ddH2O to prepare 0, 20, 40, 60, 80, and 100 mg / L indoleacetic acid (IAA) solutions. Take 1 mL of indoleacetic acid (IAA) solutions of different concentrations and add 1 mL of Salkowski reagent (accurately measure 25 mL of 70% HClO4, add it to 25 mL of distilled water, and add 1 mL of 0.5 M FeCl3 solution after cooling to room temperature), mix and react in the dark at 25°C for 30 min, and measure OD 530 The absorbance value at the point where the standard curve is drawn is taken as the horizontal axis and the absorbance value as the vertical axis.
[0075] Under sterile conditions, single colonies of wild-type FZB42 and △kinA were picked and inoculated into LB liquid medium for pre-culture at 37°C, 200 rpm overnight; the bacterial solution obtained from the pre-culture was taken and adjusted to OD 600 =1; inoculate 1% into new LB liquid medium, culture at 37°C, 200rpm for 12h-18h. Take 1mL of bacterial solution and add 1mL of Salkowski reagent, mix and react in the dark at 25°C for 30min, and measure the absorbance OD 530 , and the standard curve was used to calculate the concentration of indoleacetic acid (IAA).
[0076] The results are as follows Figure 2 As shown, the level of indoleacetic acid (IAA) secreted by ΔkinA was significantly increased compared with that of wild-type FZB42.
[0077] Example 4
[0078] 1. Extraction of Total RNA
[0079] The total RNA of wild-type FZB42 and △kinA was extracted by TRIZOL method, and the RNA was detected by 1% agarose gel electrophoresis, and the concentration was detected by Nanodrop. The extracted RNA was detected by electrophoresis and showed that the 5S, 16S, and 23S bands were clear and there was no degradation. The OD 260 / OD 280 ≈2, basically no protein contamination, FZB42 and △kinA and RNA concentrations are 1837ng / μL and 2096ng / μL, and the RNA purity and quality meet the experimental requirements.
[0080] 2. Reverse transcription and genomic DNA removal
[0081] According to the instruction manual of HiScript III All-in-one RT SuperMix Perfect for qPCR (R333-01), reverse transcription was performed to obtain cDNA.
[0082] 3. qPCR quantitative detection
[0083] The relative expression levels of tryptophan synthesis genes trpB, trpC and indoleacetic acid (IAA) synthesis gene ysnE in wild-type FZB42 and △kinA were determined by qPCR, and gyrA was selected as the internal reference gene.
[0084] The qPCR reaction system was prepared according to the instructions of the Talent Fluorescence Quantification Detection Kit (SYBR Green) (TIANGEN, FP209), and the qPCR reaction was performed using a two-step PCR reaction program (95°C for 3 min; 95°C for 5 s, 60°C for 15 s, 40 cycles). -ΔΔCT The results of the fluorescence quantitative PCR experiment were calculated by the method, and the data were analyzed using Prism. The primers designed according to the FZB42 genome map are as follows:
[0085] gyrA-F: TGCAGCGGTGTATCAATTCC,
[0086] gyrA-R:GGCCGTTTGTTTGTACAGGT.
[0087] trpB-F:TGCAGCGGTGTATCAATTCC,
[0088] trpB-R:CGGACAAGGTTGTTGCATGT.
[0089] trpC-F:CGGGTATCCGTGAGAACTGA,
[0090] trpC-R: GGCTGATTGCCGAAGTGAAA.
[0091] ysnE-F: TCAAGCATATGGCGGAGGAT,
[0092] ysnE-R:GCGGTGCCTTAAAGGAGCTA.
[0093] The results are as follows Figure 3 As shown, compared with the wild-type FZB42, the relative expression levels of tryptophan synthesis genes trpB, trpC and indoleacetic acid (IAA) synthesis gene ysnE in △kinA were significantly increased.
[0094] In summary, the deletion of the kinA gene of Bacillus varezii can enhance the indoleacetic acid (IAA) secretion ability of the FZB42 strain, which has important application value in improving the growth-promoting ability of FZB42.
Claims
1. Biofilm dispersion regulatory genes kinA The knockout strain promoted the growth of Bacillus varezii ( Bacillus velezens is) Application of FZB42 in secreting indoleacetic acid, the biofilm dispersion regulating gene kinA The method for constructing a knockout strain comprises the following steps: 1) Construction of biofilm dispersion regulatory genes kinA Knockout fragments; 2) Disperse the regulatory genes of the constructed biofilm kinA The knockout fragment was transformed into Bacillus varezii FZB42; 3) Cultivation and screening of biofilm dispersion regulatory genes kinA Knockout strains; Biofilm dispersion regulatory genes kinA The nucleotide sequence of the knockout fragment is shown in SEQ ID NO.3; Biofilm dispersion regulatory genes kinA The knockout fragment construction method is as follows: Based on the biofilm dispersion mutation library, the biofilm dispersion regulatory gene is identified by inverse PCR kinA, Knockout obtained by overlapping PCR kinA The target gene fragment, namely the biofilm dispersion regulating gene kinA knockout fragments; The reverse PCR primer sequences are as follows: FBO752-F: 5'-GCTTGTAAATTCTATCATAATTG-3', FBO753-R: 5'-AGGGAATCATTTGAAGGTTGG-3'. .
2. The knockout fragment of the biofilm dispersion regulatory gene kinA promotes the expression of tryptophan biosynthesis genes in Bacillus varezii FZB42 trpB , trpC In the application of expression, the nucleotide sequence of the knockout fragment of the biofilm dispersion regulating gene kinA is shown in SEQ ID NO.
3.
3. The knockout fragment of the biofilm dispersion regulating gene kinA promotes the indoleacetic acid biosynthesis gene in Bacillus varezii FZB42 ysn In the application of expression, the nucleotide sequence of the knockout fragment of the biofilm dispersion regulating gene kinA is shown in SEQ ID NO.3.