SNPs molecular markers related to growth traits of Japanese flounder, detection references and their applications

Abstract

The present invention relates to SNPs molecular markers, detection references and applications related to growth traits of Japanese flounder, and belongs to the technical field of molecular biological breeding. The SNP site is located at position 6962247 of chromosome 8 of Japanese flounder, and the polymorphism is T / G, wherein the site mutates to G for slow-growing individuals, and does not mutate to T for fast-growing individuals. The present invention also provides a primer pair for detecting the site and its application in breeding of growth traits of Japanese flounder. It provides scientific methods and theoretical support for breeding of new varieties (lines) of high-quality Japanese flounder in the future.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological breeding, and specifically discloses SNPs molecular markers related to growth traits of Japanese flounder, detection references and applications thereof. Background Art

[0002] The Japanese flounder (Paralichthys olivaceus) belongs to the order Pleuronectiformes, family Bothidae, genus Paralichthys, with a laterally flattened body and an oblong shape. The Japanese flounder has the characteristics of fast growth, tender meat, easy digestion, high protein, low fat, and low calories. It is an important marine aquaculture fish. At present, a series of studies on the Japanese flounder have been reported at home and abroad, mainly including growth, reproduction, breeding, diseases, nutrition, genetic breeding and biological characteristics. However, with the long-term artificial breeding of Japanese flounder and the continuous expansion of breeding scale, a series of problems have arisen, such as the slow growth rate and decreased fertility of Japanese flounder. These problems have affected the development of the Japanese flounder aquaculture industry. Therefore, screening growth-related genes is the key to solving the slow growth of Japanese flounder, which has important theoretical significance and practical application value for the development of Japanese flounder aquaculture.

[0003] Most of the research methods on the growth of Japanese flounder are based on traditional methods. Traditional breeding methods have made certain contributions to the cultivation of high-quality Japanese flounder. In the past 10 years, more than 450 Japanese flounder families have been established and the families resistant to Edwardsiella tarda have been screened. The Japanese flounder "Flatfish No. 2" was bred. This variety not only has the genetic background of the three major regional populations of China, Japan and South Korea and the population resistant to Vibrio anguillarum, but also has the advantages of good color, fast growth rate, and resistance to ascites caused by Edwardsiella tarda. However, the growth traits of animals are quantitative traits, which are controlled by the micro-effects of multiple genes and are greatly affected by the environment. The accuracy and efficiency of traditional breeding methods are low, and there are long cycles and many uncertainties. It is difficult to efficiently breed high-quality varieties through traditional breeding methods. With the rapid development of modern molecular biology technology, molecular marker-assisted selection (MAS) provides ideas for the improvement of quantitative traits. MAS uses genetic markers closely linked to the target traits to quickly and accurately analyze the genetic composition of individuals at the molecular level, thereby realizing direct selection of genotypes and conducting molecular breeding. Accurate selection is achieved, thereby accelerating the breeding process. However, MAS has certain limitations. Since quantitative traits are controlled by many micro-effect genes / QTLs, they are greatly affected by the environment, and the QTL mapping results of quantitative traits controlled by many micro-effect genes cannot be effectively applied to breeding populations. Due to the complexity of the flounder genome and the limited availability of gene banks, the application of traditional and molecular breeding methods in the growth traits of flounder has been hindered to a certain extent. Therefore, it is urgent to find a new method that can efficiently select and improve the growth of flounder. Summary of the invention

[0004] In view of the existing technical problems, the present invention provides SNPs molecular markers related to growth traits of Japanese flounder, detection references and applications thereof.

[0005] One of the technical solutions of the present invention is to provide a SNP site related to the growth traits of Japanese flounder, the SNP site is located at position 6962247 of chromosome 8 of Japanese flounder (the reference genome is NCBI'ASM2471397v2'), the polymorphism is T / G, wherein the mutation of the site to G indicates slow growth of the individual, and the non-mutation to T indicates fast growth of the individual.

[0006] The second technical solution of the present invention is to provide the application of the SNP site in screening fast-growing individuals of Japanese flounder, wherein the application method is to extract DNA from the sample and select individuals containing the SNP site through sequencing.

[0007] The third technical solution of the present invention is to provide the application of the gene containing the SNP site in screening fast-growing individuals of Japanese flounder, and the application method is to extract DNA from the sample and select individuals containing the SNP site through sequencing.

[0008] The fourth technical solution of the present invention is to provide the application of the SNP site or the gene containing the site in the growth shape breeding of Japanese flounder.

[0009] A fifth technical solution of the present invention provides a primer pair for amplifying the SNP site, the primer pair comprising a forward primer and a reverse primer, the forward primer is: 5'-CTCATGCTACGAAGAAGTGTGAT-3', and the reverse primer is: 5'-TTTGGTGGCAAGTGTTTCAGA-3'.

[0010] The sixth technical solution of the present invention is to provide the application of the primer pair of the SNP site in the screening of growth traits of Japanese flounder. The primer pair is used to amplify the sample DNA, and when the 53rd position of the amplified product from the 5' end is G, it is determined to be a slow-growing Japanese flounder; when the 53rd position of the amplified product from the 5' end is T, it is determined to be a fast-growing individual.

[0011] The seventh technical solution of the present invention is to provide the application of the primer pair of the SNP site in the breeding of growth traits of Japanese flounder.

[0012] The beneficial effects of the present invention compared with the prior art are:

[0013] The invention provides a growth trait-related SNPs molecular marker for Japanese flounder, wherein the SNP site is located at position 6962247 of chromosome 8, and the polymorphism is T / G, wherein a mutation of the site to G indicates a small-individual Japanese flounder, i.e., a slow-growing individual, and a non-mutated T indicates a large-individual Japanese flounder, i.e., a fast-growing individual, and thus a scientific method and theoretical support are provided for the future breeding of high-quality new varieties (lines) of Japanese flounder. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a DNA gel detection diagram;

[0015] Figure 2 is the SNP density map;

[0016] Figure 3 Manhattan plot of genome-wide association analysis of body weight;

[0017] Figure 4 Manhattan plot of the full-length and whole-gene association analysis results;

[0018] Figure 5 This is the QQ plot result of body weight;

[0019] Figure 6 This is the full-length QQ graph result. DETAILED DESCRIPTION

[0020] The technical solution of the present invention is further explained below by way of embodiments, but the protection scope of the present invention is not limited in any form by the embodiments.

[0021] Example 1

[0022] Materials and Methods

[0023] 1.1 Experimental Materials

[0024] 1.1.1 Experimental animals

[0025] The large and small individuals of the flounder used in the experiment were randomly selected from a one-year-old flounder population as experimental samples for whole genome resequencing.

[0026] 1.1.2 Sample collection and processing

[0027] The total length, body length, weight and body width of the flounder were measured, and the tail fin was preserved in anhydrous ethanol for the extraction of genomic DNA.

[0028] 1.2 Experimental methods

[0029] 1.2.1 Extraction and detection of genomic DNA

[0030] The genomic DNA was extracted by phenol-chloroform extraction method according to the conventional extraction steps. The extracted genomic DNA was tested for integrity, purity and concentration. Those that met the requirements were retained, and those that did not meet the requirements were eliminated or re-extracted and re-tested.

[0031] 1.2.2 Sequencing data quality control and comparison with reference genome

[0032] GBS simplified genome sequencing technology and Illumina HiSeq sequencing platform were used to perform double-end PE150 sequencing on the flounder described in step 3; NCBI'ASM2471397v2' genome was used as a reference for sequence alignment, and SAMtools software was used to detect population variation and obtain a VCF file storing SNP genotyping data; Plink and VCFtools software were used to filter genotypes according to the standards of sample detection rate>0.95, SNP detection rate>0.90, minimum allele frequency≥0.05, Hardy-Weinberg equilibrium>0.0001, missing rate and heterozygosity rate<20%, and glimpse software was used to fill in genotypes in the haplotype library;

[0033] 1.3 Data processing and statistical analysis

[0034] 1.3.1 Descriptive statistical analysis of growth traits

[0035] Descriptive statistical analysis of growth traits was obtained by analysis-descriptive statistical analysis in IBM SPss Statistics 25 software, and the growth traits analyzed included: weight, body width, total length, and body length;

[0036] The results of the analysis were the number of samples, mean, variance, standard deviation and coefficient of variation. Based on the recorded phenotypic data, correlation analysis was performed and it was found that the two traits of total length and weight were the most correlated, which were used as the phenotypic data for the whole genome selection analysis of growth traits of Japanese flounder;

[0037] 1.3.2 Genome-wide association analysis

[0038] After the sequencing data was quality controlled and genotype filled, the mixed linear model (MLM) of GEMMA was used to conduct genome-wide association analysis on the growth traits of Japanese flounder, and SNPs related to the growth traits of Japanese flounder were mined:

[0039] Y=Xα+Zβ+Wμ+e

[0040] In the formula, y is the phenotypic trait to be studied; Xα is the fixed effect, which is other factors affecting the phenotypic trait, mainly referring to the population structure; Zβ is the SNP marker effect; Wμ is the random effect, and e represents the residual.

[0041] 1.3.3 Population stratification

[0042] Population stratification refers to the difference in allele frequencies between populations caused by non-random mating among individuals, which has a great impact on genome-wide association studies and can lead to false positive results. Therefore, when conducting association analysis, a Q-Q plot (Quantile-Quantile Plot) is drawn for the growth traits of Japanese flounder to determine whether there are biases and population stratification phenomena in the association analysis.

[0043] 2. Result analysis

[0044] 2.1 Genomic DNA detection results

[0045] The genomic DNA extracted from all samples needs to be detected for its quality by agarose gel electrophoresis. It is required that the sample loading wells are clean and free of contamination, the main band is clear, and there is no trailing. In addition, the purity detection of DNA is required

[0046] 1.6 < OD260 / OD280 < 2.0, 1.8 < OD260 / OD230 < 2.1. The qualified sample DNA is sent for testing (some DNA detection diagrams are as Figure 1 shown).

[0047] 2.2 Sequencing data quality control and phenotype quality control

[0048] Quality control is carried out according to the following standards: sample detection rate > 0.95, SNP detection rate > 0.90, minimum allele frequency ≥ 0.05, Hardy-Weinberg equilibrium > 0.0001, and genotype filtering is carried out with a missing rate and heterozygosity rate < 20%.

[0049] 2.3 SNP detection result statistics

[0050] The number of SNPs after quality control and their distribution on chromosomes, the results are as Figure 2 .

[0051] 2.4 Descriptive statistical analysis of growth traits

[0052] Table 1. Phenotypic statistics of the growth traits of one-year-old Japanese flounder

[0053]

[0054] The descriptive statistical analysis of growth traits is shown in Table 1. The average weight of Japanese flounder individuals is 450.95 g, the average total length is 33.7 cm, the coefficient of variation of weight is the largest at 42.67%, and the correlation between traits shows that weight and total length are the most correlated, as shown in Table 2.

[0055] Table 2. Correlation coefficients between the growth traits of Japanese flounder

[0056] Characteristics Body length (BL) / cm Total length (TL) / cm Body width (BH) / cm Body weight (BW) / g Body length (BL) / cm 1 Total length (TL) / cm 0.946* 1 Body width (BH) / cm 0.873** 0.908* 1 Body weight (BW) / g 0.891** 0.936** 0.934** 1

[0057] 2.5 Results of genome-wide association analysis

[0058] The present invention uses the mixed linear model (MLM) of GEMMA to perform genome-wide association analysis on the growth traits of Japanese flounder, and performs genome-wide association analysis on the weight and total length of Japanese flounder. The Manhattan plot of the genome-wide association analysis of weight is shown in Figure 3 The Manhattan plot of body weight shows that the SNP sites are mainly located on chromosomes Chr8, Chr14, Chr18, and Chr20. The Manhattan plot of the full length is shown in Figure 4 . The full-length Manhattan plot shows that the SNP sites are mainly located on chromosomes Chr8, Chr18, and Chr20. In the Manhattan plot, the ordinate is the negative logarithm of the p-value (-log10(p)), the abscissa is the chromosome, and one point represents a SNP site; the dotted line is the negative logarithm of 1 / SNP number, and the points above the dotted line indicate that the corresponding SNP marker is significantly associated with the growth trait. The highest red point on chromosome 8 corresponds to the 6962247 SNP, which is detected in both traits. Using -log10(p) ≥ 7.3 as the screening criterion, a SNP marker significantly associated with the growth trait was obtained at position 6962247 of chromosome 8, and the polymorphism is T / G. The detailed information is shown in Table 3.

[0059] Table 3 Information on SNPs significantly associated with growth traits of Japanese flounder

[0060]

[0061] 2.6 Group stratification assessment results

[0062] All the traits studied have significant SNPs sites, and their QQ plots are shown in Figure 5 , Figure 6 As shown, the horizontal axis represents the expected value and the vertical axis represents the observed value. The thin line in the figure represents the 45° line, which is the predicted threshold. The gray area is the 95% confidence interval of the scattered points on the figure. The farther the SNP is from the solid line, the better the association strength. Figure 5 Figure 6 It can be seen that most of the sites in the lower left corner of the figure are on the diagonal line, indicating that the model selection is reasonable, and the sites in the upper right corner that exceed the diagonal line and the confidence interval have a high significance with the target trait. In summary, there is no population stratification phenomenon in the experimental population.

[0063] 2.7 Application of SNP markers significantly associated with growth traits in Japanese flounder

[0064] The SNP marker closely linked to the growth traits of Japanese flounder is at position 6962247 of chromosome 8, and the polymorphism is T / G. It is named 8:6962247, which is a fragment obtained by PCR amplification using the genomic DNA of the material to be identified as a template and the 8:6962247 primer.

[0065] 8: The nucleotide sequence of 6962247 is as follows (SEQ ID NO.1):

[0066] CTCATGCTACGAAGAAGTGTGATAAGTGTTCATGTAAACTCATCTTTTATTT T AAAAAAGTGGATTTAATTGAATTCCAATGCGCTTTTTTCCACAGGGTGGTTTACAAACTTCTGGCCTCAAAAAGTGAAGGAATTCGAGTGCAGGCACTCAAAGTGATGGGCTACTTTCTGAAACACTTGCCACCAAAGTAAGTACAATGT.

[0067] The amplification primers were: forward primer (SEQ ID NO. 2): 5'-CTCATGCTACGAAGAAGTGTGAT-3',

[0068] Reverse primer (SEQ ID NO. 3): 5'-TTTGGTGGCAAGTGTTTCAGA-3'.

[0069] Example 2 The specific steps of using the above-mentioned SNP molecular markers to assist in determining the size of individual flounder are as follows:

[0070] 1. Use the phenol-chloroform method to extract the genomic DNA of the material to be identified.

[0071] 1) Take the muscle tissue of soybean-sized flounder and put it into a 1.5 mL centrifuge tube.

[0072] 2) Add 550 μl TNES lysis buffer and 6 μl proteinase K, incubate in a water bath at 56°C for half an hour, grind into a homogenate, and place in a water bath at 56°C overnight until the lysate becomes clear.

[0073] 3) Add 300 μL of chloroform:isoamyl alcohol and phenol solution with a volume ratio of 24:1, mix by inversion for 20 minutes, and centrifuge at 12000 rpm for 20 minutes.

[0074] 4) Take the supernatant to another centrifuge tube and repeat step 3)

[0075] 5) Transfer the supernatant solution to another empty centrifuge tube and extract once with 600 μl of chloroform:isoamyl alcohol solution with a volume ratio of 24:1.

[0076] 6) Add 2 volumes of -20°C precooled isopropanol and 50 μl of saturated sodium acetate and place in a -20°C refrigerator for 40-60 min. Centrifuge at 12,000 rpm for 10 min and remove the supernatant.

[0077] 6) Wash once with 70% ethanol and once with anhydrous ethanol. After drying, dissolve with sterile water to obtain genomic template DNA, and store the genomic template DNA in a -20°C refrigerator for later use.

[0078] 7) Use 0.1% agarose to detect the concentration of DNA and dilute to the working concentration for PCR amplification.

[0079] 2. Use SNP marker primers to perform PCR amplification to obtain the amplified product.

[0080] PCR amplification system: The total volume is 25 μL, including 1 μL of 10-50 ng genomic template DNA, 12.5 μL qPCR Mix, 1 μL of each 10 pmol primer and 9.5 μL ddH2O.

[0081] PCR amplification conditions: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s; 32 cycles; final extension at 72°C for 10 min.

[0082] 3. Determine the individual size of flounder based on the sequence comparison results.

[0083] The amplified products were sequenced and analyzed. The average weight of the flounder with G at the 53rd position from the 5' end was significantly lower than that of the flounder with T at the same position, indicating that at the same age, the individuals with G at the position grew slower than those with T at the same position.

[0084] 4. Conclusion

[0085] 4.1 Growth phenotype of flounder

[0086] The experimental samples of the present invention are randomly selected large and small individuals of flounder. The correlation analysis of growth traits such as weight, body length, body width and total length shows that the weight and total length of flounder have the highest correlation with growth. The growth-related traits of flounder are subjected to genome-wide association analysis with weight and total length as representative phenotypes, and growth-related SNP molecular markers are mined from the whole genome.

[0087] 4.2 Significantly associated SNP molecular markers

[0088] The SNP molecular marker most significantly associated with body weight and full length detected in the present invention is located at position 6962247 of chromosome 8, and the polymorphism is T / G.

[0089] Based on the above embodiments, the present invention discloses a method for screening SNPs molecular markers related to growth traits of Japanese flounder and provides a SNP molecular marker site significantly associated with the size of Japanese flounder. One-year-old large and small Japanese flounder samples were randomly selected as experimental subjects for whole-genome association analysis, and their weight, full length and other growth-related phenotypic traits were measured. Genomic DNA was extracted from tail fin tissue, and the integrity, purity and concentration of the extracted genomic DNA were tested for resequencing. By performing whole-genome association analysis on their weight and full-length traits most related to weight, SNPs molecular markers related to growth traits of Japanese flounder were obtained, providing theoretical and practical support for the future breeding of new varieties (lines) of high-quality Japanese flounder.

Claims

1. The application of SNP molecular markers in screening fast-growing individuals of Japanese flounder is characterized by: The sequence of the SNP molecular marker is shown in SEQ ID NO.

1. There is a T / G mutation at position 53 of the SNP molecular marker. The application is to extract DNA from the sample and select individuals containing T at the position through sequencing.

2. Use of the primer pair for amplifying the SNP molecular marker of claim 1 in screening fast-growing individuals of Japanese flounder, characterized in that: The primer pair includes a forward primer and a reverse primer, the forward primer is: 5'-CTCATGCTACGAAGAAGTGTGAT-3', and the reverse primer is: 5'-TTTGGTGGCAAGTGTTTCAGA-3'; the application is to use the primer pair to amplify sample DNA and select individuals whose 53rd position from the 5' end of the amplified product is T.

Images