InDel molecular marker co-segregated with balsam pear peel color and application thereof

Abstract

The application belongs to the technical field of vegetable molecular breeding, and particularly relates to an InDel molecular marker co-segregated with the pericarp color of Momordica charantia and application thereof. The InDel molecular marker co-segregated with the pericarp color of Momordica charantia corresponds to an ATTAATAA insertion / deletion at 16,346,713 bp on chromosome 10 of the Momordica charantia genome, and the polymorphism of the site base affects the pericarp color of Momordica charantia. The application further provides primers FC-71 for identifying the above-mentioned InDel molecular marker, which can be used for molecular marker assisted selection breeding of the pericarp color of Momordica charantia, improves the genetic improvement efficiency of the pericarp color of Momordica charantia commodity fruits, shortens the breeding period, reduces the breeding cost, and has a wide application prospect in the breeding practice of the fruit color of Momordica charantia.

Description

Technical Field

[0001] The invention belongs to the technical field of vegetable molecular breeding, and particularly relates to an InDel molecular marker co-separated with bitter melon peel color and an application thereof. Background Art

[0002] Bitter melon (Momordica charantia L., 2n=2x=22) is an annual climbing vegetable crop of the genus Momordica in the Cucurbitaceae family. It prefers warmth and tolerates cold weather and is widely cultivated in my country. Bitter melon is highly nutritious, containing not only abundant minerals, amino acids, and vitamins, but also possessing significant health benefits and medicinal value. Bitter melon cultivation in China has a long history, resulting in a wide variety of varieties and types. Generally speaking, green-skinned bitter melons are more commonly cultivated in South China, while white-skinned bitter melons are more commonly cultivated in the Yangtze River Basin and Taiwan Province. Therefore, bitter melon peel color is a key appearance quality trait that influences consumer choice and is of particular interest to breeders.

[0003] Currently, genetic improvement of bitter melon peel color is primarily achieved through conventional hybridization. First, parents are selected for artificial sexual hybridization. Then, individuals with the target fruit color are selected from the segregating population of hybrid offspring. Finally, through multiple generations of self-pollination, genetically stable varieties with the target fruit color trait are obtained. However, this conventional hybridization method for bitter melon fruit color breeding has limitations, including complex selection procedures, long breeding cycles, high breeding costs, and low genetic improvement efficiency.

[0004] Marker-assisted selection (MAS) is an important and efficient technology for genetic improvement of crop traits. However, molecular markers for assisted selection of bitter melon peel color have not been reported to date. Developing molecular markers that co-segregate with bitter melon peel color could allow for identification of peel color during early stages of bitter melon growth and development, such as the seedling stage. This could improve the efficiency of fruit color selection and reduce breeding costs. Summary of the Invention

[0005] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide an InDel molecular marker that is co-separated with the color of bitter melon peel.

[0006] Another object of the present invention is to provide an application of the above-mentioned InDel molecular marker co-separated with the bitter melon peel color.

[0007] Another object of the present invention is to provide a method for identifying the color of bitter melon peel.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] An InDel molecular marker co-segregates with bitter melon peel color, the locus of which corresponds to the ATTAATAA insertion / deletion at 16,346,713 bp on chromosome 10 of the bitter melon reference genome, Momordica charantia cv. Dali-11_v1.0. The polymorphism of the bases at this locus affects the bitter melon peel color.

[0010] The nucleotide sequence of the InDel molecular marker co-segregated with the bitter melon peel color is shown below, wherein M in the sequence represents an ATTAATAA insertion or deletion:

[0011] AAACTTGGTTTCCTTACCCAAAAAAAAAAGAAAAAAGAAAAAAAACCATAACTTGATATATAAACAAAGTGATTAAATAATGAACCTTTTTATTATATATATATATATATATATATATATAT M (ATTAATAA / delATTAATAA)TTAACTAAAGATAGAAGTAAGAAGTCAAATTTGATTAGGCTACGTATCTAATATGTGGCCAATAAAGCAATTCAAGACTTTTCAAAAACCAAC

[0012] Application of the InDel molecular marker in identifying bitter melon peel color traits and / or bitter melon molecular breeding;

[0013] A primer for identifying the above-mentioned InDel molecular marker includes primers FC-71-F and FC-71-R, the nucleotide sequences of which are shown below:

[0014] FC-71-F: 5'-AAACTTGGTTTCCTTACCCAAAAA-3';

[0015] FC-71-R: 5'-GTTGGTTTTTGAAAAGTCTTGAATTGC-3';

[0016] A kit for identifying the above-mentioned InDel molecular marker, comprising the above-mentioned primers;

[0017] The kit preferably further comprises dNTPs, reaction buffer and Taq enzyme;

[0018] Application of the primers or kit in identifying the color traits of bitter melon peel;

[0019] Application of the primers or kit in molecular breeding of bitter melon;

[0020] A method for identifying the color of bitter melon peel comprises the following steps:

[0021] (1) extracting DNA from the bitter melon to be tested;

[0022] (2) using the momordica charantia DNA to be tested extracted in step (1) as a template and the above primers or the primers in the above kit as amplification primers, performing PCR amplification and performing polyacrylamide gel electrophoresis;

[0023] (3) Based on the electrophoresis results, determine the genotype and the color of the bitter melon peel;

[0024] The PCR amplification system is preferably: 50-100 ng of genomic DNA template, 10 μM primers, 200 μM dNTPs, 1× PCR reaction buffer and 1 U Taq enzyme;

[0025] The reaction procedure of the PCR amplification is preferably:

[0026] Pre-denaturation at 94°C for 3 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s; and finally extension at 72°C for 5 min.

[0027] The method for determining the genotype and the color of the bitter melon peel is as follows:

[0028] The electrophoretic band pattern is the same as that of the bitter melon inbred line 'K44', and the commercial fruit color is white; the electrophoretic band pattern is the same as that of the bitter melon inbred line 'K8-201', and the commercial fruit color is green;

[0029] The present invention has the following advantages and effects compared to the prior art:

[0030] (1) The present invention uses the bitter melon inbred line 'K44' with white peel color as the female parent and the bitter melon inbred line 'K8-201' with green peel color as the male parent to construct a preliminary positioning population of 268 strains and a fine positioning large population of 2476 strains. Then, molecular marker development, linkage analysis and fine positioning of gene loci in the preliminary positioning interval are carried out. Finally, an InDel molecular marker that co-segregates with the bitter melon peel color trait is determined and developed. The molecular marker is located at 16,346,713 bp on chromosome 10 of the bitter melon genome and is an ATTAATAA insertion / deletion. The polymorphism of the base at this site affects the bitter melon peel color.

[0031] (2) The present invention provides a primer (FC-71) for identifying the above-mentioned molecular marker, a kit containing the primer, and a method for identifying the color of bitter melon peel. The primer, kit or method can be used to effectively, quickly and at low cost identify the color traits of bitter melon peel, and a molecular marker-assisted selection breeding technology for rapidly improving the color traits of bitter melon peel is established.

[0032] (3) The present invention can be used for molecular marker-assisted selection breeding of bitter melon peel color. The color of green and ripe fruits can be identified based on the genotype of bitter melon seedlings, helping breeders to quickly screen out ideal plants with the required fruit color, thereby improving the efficiency of genetic improvement of the peel color of commercial bitter melon fruits, reducing the workload and cost of field selection, and greatly shortening the breeding period. It has broad application prospects in the practice of bitter melon fruit color breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the BSA-seq analysis result of bitter melon peel color based on ΔSNP-Index, where the red line represents the threshold line with a confidence level of 0.95, and the blue line represents the threshold line with a confidence level of 0.99.

[0034] Figure 2 The figures are the results of fine mapping of bitter melon peel color genes, where: (a): Based on the local molecular marker linkage genetic map, the gene controlling the white color of bitter melon peel was preliminarily located between FC-39 and FC-8; (b): Using a large F2 population (n=2476), the gene controlling the white color of bitter melon peel was finely located between FC-70 and FC-37. The numbers below indicate the number of exchange strains, and the red markers indicate newly developed markers during the fine mapping process; (d): The genotyping results and phenotypic data of 14 recombinant strains (r1~r14) screened by fine mapping. P1, F1 and P2 represent 'K44', 'K44'×'K8-201' and 'K8-201', respectively. White, black and oblique stripes represent the genotypes of the mapped segments. W, E and G represent the phenotypes of white, light green and green peel, respectively.

[0035] Figure 3 This is the genotyping result of FC-71 polymorphic molecular marker on 50 natural populations of bitter melon. DETAILED DESCRIPTION

[0036] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0037] Example 1

[0038] 1. Test materials and obtaining identification groups or plants

[0039] (1) Primary positioning population: The bitter melon inbred line 'K44', whose commercial fruit peel color is white, was used as the female parent, and the bitter melon inbred line 'K8-201', whose commercial fruit peel color is green, was used as the male parent. Through conventional hybridization, an F2 segregating population (n=268 plants) was constructed as the F2 primary positioning segregating population for genetic analysis of peel color and primary gene positioning research.

[0040] (3) The seeds of the initial location and separation group were soaked and germinated, and then grown in plug trays. The specific method was as follows: the seeds were soaked and germinated, and then germinated in a constant temperature box at 30℃. When the seeds began to turn white, they were sown in 50-hole plug trays. When the seedlings grew 4-5 true leaves, they were transplanted into the field and managed with conventional fertilizer and water.

[0041] 2. Fruit Color Phenotype Investigation

[0042] When the bitter melons reached commercial fruit size 15-20 days after pollination, the fruit skin color of each individual plant of the parents and the F2 primary segregation population was investigated. The investigation was conducted three times in total, with two people investigating simultaneously each time according to the same standard.

[0043] 3. DNA Extraction

[0044] (1) 0.1 g of fresh green bitter melon leaves were placed in a 2 mL centrifuge tube, quickly frozen with liquid nitrogen, and placed in a grinder at 65 Hz. Grind for 20 s and remove from the grinder.

[0045] (2) Add 800 μL of CTAB solution (20 mM EDTA, 100 mM Tris-HCl, 1.4 M NaCl, 2% CTAB, 2% PVP, all percentages are by mass) to the centrifuge tube, mix quickly, and place in a water bath at 65°C for 25 min, inverting 3-5 times to mix thoroughly.

[0046] (3) After the water bath is complete, add an equal volume of chloroform in a fume hood and mix by inversion for 5 minutes;

[0047] (4) Place in a centrifuge and centrifuge at 12000 rpm for 8 min;

[0048] (5) Take the supernatant and transfer it to a 1.5 mL centrifuge tube. Then add an equal volume of isopropanol and shake gently.

[0049] (6) After standing at 4°C for 30 min, centrifuge at 12,000 rpm for 8 min;

[0050] (7) Discard the supernatant, wash the precipitate twice with 75% ethanol solution, and remove the residual solution by aspiration;

[0051] (8) Dry at 35°C, let cool, and then add 50 μL of sterile water to dissolve the DNA precipitate;

[0052] (9) After the DNA precipitate is completely dissolved, store it at -20°C until ready for use.

[0053] 4. DNA pool construction and sequencing

[0054] Based on the aforementioned survey results on the peel color of commercial fruit from the F2 primary segregating population of bitter melon, DNA from 15 bitter melon plants with white peel was mixed in equal amounts to form a white peel gene pool, and DNA from 24 bitter melon plants with green peel was mixed to form a green peel gene pool. The two progeny gene pools, along with DNA from the two parents, totaling four samples, were sequenced and constructed.

[0055] 5. Preliminary localization and analysis of the bitter melon peel color gene

[0056] (1) The raw data generated by sequencing were filtered using the Soapnuke software developed by BGI to remove linker contamination and low-quality reads to obtain high-quality clean data.

[0057] (2) The clean data obtained in step (1) was aligned to the reference genome (Momordica charantia cv. Dali-11_v1.0) using the short sequence alignment software BWA (Version: 0.1.17-r1188).

[0058] (3) Based on step (2), the UnifiedGenotyper function of GATK (GATK3.4) software was used to detect SNP variations in the population and filter the obtained high-quality SNP sites.

[0059] (3) Based on the high-quality SNP sites obtained in step (2), the depth of the alleles in the offspring pool-offspring pool is calculated, and the SNP-index parameter and the ΔSNP-index value are further calculated using a sliding window, where the sliding window size is 200 Kb and the sliding step size is 100 Kb.

[0060] The preliminary analysis of the bitter melon peel color gene revealed that there is a region at the end of chromosome 10 that is significantly associated with the bitter melon peel color trait (confidence level = 0.99). The physical location of this region is 14,832,103-18,063,079 bp, and the physical length is approximately 5.03 Mb ( Figure 1 ).

[0061] 6. Molecular marker development and linkage analysis in the initial mapping interval

[0062] Based on the whole-genome resequencing results of the parents 'K44' and 'K8-201', 22 pairs of polymorphic InDel markers were developed within the associated region (14,832,103-18,063,079 bp) obtained in step 5 (Table 1). These 22 pairs of polymorphic markers were used to genotype 268 individual strains from the F2 primary segregating population using the following method:

[0063] (1) PCR amplification

[0064] PCR amplification was performed using the genomic DNA of 268 individual strains of the F2 primary mapping isolation population as a template and the primers listed in Table 1 as amplification primers. The specific PCR amplification reaction system (10 μL) was: 50-100 ng of genomic DNA template, 10 μM primers, 200 μM dNTPs, 1× PCR reaction buffer and 1 U of Taq enzyme; the specific PCR amplification reaction procedure was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; finally, extension at 72°C for 5 min and storage at 16°C.

[0065] (2) Polyacrylamide gel electrophoresis

[0066] After PCR amplification, the PCR products were detected and analyzed using 6% polyacrylamide gel electrophoresis. The specific method is as follows:

[0067] ① Reagent preparation: Weigh 500 g of urea, 250 g of acrylamide, 43.2 g of Tris, 22 g of H₃BO₃, 13 g of methylenebisacrylamide, and 2.976 g of EDTA·Na₂, add purified water, stir to dissolve, and dilute to 4 L to obtain PAGE collagen solution. Weigh 108 g of Tris, 55 g of H₃BO₃, and 7.44 g of EDTA·Na₂, add purified water, stir to dissolve, and dilute to 1 L to obtain 5× TBE solution.

[0068] ② Preparation of gel: Weigh 1g agar powder, dissolve it in 100mL water by microwave heating, pour it into the lower end of the electrophoresis glass plate, and wait for cooling and solidification; measure 50mL PAGE collagen solution, add 880μL ammonium persulfate solution (mass fraction 10%) and 14μL TEMED, shake it gently and quickly pour it into the electrophoresis glass plate with the lower end sealed, and quickly insert the sample grid; after the collagen solution solidifies, gently pull out the sample grid and immediately rinse the residual gel in the sample well with tap water; place the assembled electrophoresis glass plate into the electrophoresis tank and add 0.5× TBE running buffer and set aside.

[0069] ③ Electrophoresis: Add 2 μL of 6× Loading Buffer to 10 μL of PCR product, mix thoroughly, and then use a microinjector to dispense 2 μL into the sample wells. Adjust the electrophoresis voltage to 300 V and run the electrophoresis. Adjust the electrophoresis time based on the size of the PCR product.

[0070] ④ Washing the gel: After electrophoresis is completed, peel the polyacrylamide gel from the electrophoresis glass plate, place it in a 0.1% AgNO3 solution by mass, and shake it gently on a shaker for 5 minutes; pour out the AgNO3 solution and immediately rinse twice with pure water; then add silver staining solution (1.5% NaOH, 0.2% Na2B4O7·10H2O and 0.5% HCHO solution, all percentages are by mass) and shake it gently on a shaker until the PCR product bands are clearly visible (about 4-6 minutes); finally, pour out the silver staining solution, add a large amount of tap water to terminate the color development reaction, take pictures, and record the molecular marker band patterns.

[0071] Based on the initial positioning of the molecular markers in the interval, linkage analysis found that the two markers FC-37 and FC-38 were co-segregated with the peel color phenotype. Therefore, the commercial fruit peel color gene locus can be further located between markers FC-39 and FC-8, with a physical distance of approximately 170.36 kb ( Figure 2 ).

[0072] Table 1 Polymorphic primer sequences used for the initial localization of the bitter melon peel white gene

[0073]

[0074] Example 2 Fine Mapping of Peel Color Gene Loci in Bitter Melon Commercial Fruit

[0075] 1. Test materials and obtaining identification groups or plants

[0076] (1) Large population for fine positioning: The bitter melon inbred line 'K44' with white fruit skin color as the female parent and the bitter melon inbred line 'K8-201' with green fruit skin color as the male parent were used to expand the population through conventional hybridization to construct an F2 large population containing 2476 individual plants as the large population for fine positioning of the fruit skin color gene.

[0077] (2) Precisely locate a large group of seeds and germinate them by soaking and then growing them in plug trays. The specific method is as follows: soak the seeds for germination and then germinate them in a constant temperature box at 30°C. When the seeds begin to turn white, they are sown in 50-hole plug trays. When the seedlings grow 1-2 true leaves, samples are collected for DNA extraction.

[0078] 2. DNA Extraction

[0079] In order not to affect the later colonization, the modified CTAB method is used to extract DNA, which is more time-saving and labor-saving. The specific method is as follows:

[0080] (1) Cut a small leaf piece with scissors and place it in a 96-well convex PCR plate. Place two small steel balls in each well and cover the plate.

[0081] (2) Add 80 μL of CTAB solution and crush with a sample crusher at 60 Hz for 120 s;

[0082] (3) Heat in a 65°C water bath for 20 min, then add an equal volume of chloroform and shake thoroughly by inverting.

[0083] (4) Place in a centrifuge and centrifuge at 5000 rpm for 10 min;

[0084] (5) Place 50 μL of supernatant on a new PCR plate and add an equal volume of isopropanol;

[0085] (6) Shake gently and place in a -20℃ refrigerator for 20 minutes;

[0086] (7) Place in a centrifuge and centrifuge at 5000 rpm for 10 min;

[0087] (8) Pour off the supernatant and remove the remaining supernatant by aspiration; wash twice with 75% ethanol solution;

[0088] (9) Place in a fume hood to air dry, add 50 μL of nuclease-free water, and use it for PCR amplification after the DNA is completely dissolved.

[0089] 3. Fine-mapping population recombinant screening

[0090] (1) Genotyping of 2,476 F2 strains from a large, finely mapped population was performed using markers (FC-39 and FC-8) on both sides of the co-segregating interval (refer to Example 1 for specific PCR amplification and polyacrylamide gel electrophoresis steps). A total of 14 recombinant strains that underwent crossover events in the candidate interval were screened.

[0091] (2) The recombinants obtained by screening were planted in the Qilin North Teaching Base of South China Agricultural University, and the fruit skin color of the recombinant strains was investigated during the commercial fruit size period.

[0092] 4. Fine mapping of bitter melon peel color genes

[0093] (1) Based on the results of parental resequencing, eight pairs of polymorphic molecular markers (FC-69, FC-61, FC-63, FC-70, FC-71, FC-67, FC-54, and FC-62) were developed in the initial positioning interval, and the recombinants were genotyped using the above polymorphic molecular markers (for specific PCR amplification and polyacrylamide gel electrophoresis steps, please refer to Example 1).

[0094] Combined with the peel color phenotype of the recombinant strains during the commercial fruiting period, the gene controlling the peel color of bitter melon was finely mapped between the FC-70 and FC-37 markers, with a physical distance of 69.6 kb. Among them, the marker FC-71 did not exchange with the peel color phenotype in 14 recombinants and co-segregated with the peel color ( Figure 2 ).

[0095] (2) The product of the amplification of the polymorphic molecular marker FC-71 was subjected to Sanger sequencing, wherein the amplified sequence of FC-71 is shown below, wherein an InDel molecular marker with an insertion / absence of 8 bases (ATTAATAA) exists at the physical position 16,346,713 bp (Momordica charantia cv.Dali-11_v1.0), and the molecular marker is co-separated with the bitter melon peel color.

[0096] AAACTTGGTTTCCTTACCCAAAAAAAAAAGAAAAAAGAAAAAAAACCATAACTTGATATATAAACAAAGTGATTAAATAATGAACCTTTTTATTATATATATATATATATATATATATATAT ATTAATAA TTAACTAAAGATAGAAGTAAGAAGTCAAATTTGATTAGGCTACGTATCTAATATGTGGCCAATAAAGCAATTCAAGACTTTTCAAAAACCAAC

[0097] Table 2 Polymorphic primer sequences used for fine mapping of bitter melon peel color genes

[0098]

[0099] Note: FC-69 is CAPS-labeled, and the enzyme used is HinP1 I; FC-67 is dCAPS-labeled, and the enzyme used is NlaI V; FC-70 is dCAPS-labeled, and the enzyme used is Alu I.

[0100] Example 3: Verification of the accuracy of FC-71-assisted screening of fruit peel color

[0101] The polymorphic molecular marker FC-71 in Example 2 was used to genotype the natural population (Table 3), and genotypic and phenotypic statistical analysis was performed based on the phenotype of each individual plant and the genotype and phenotype of the bitter melon inbred lines 'K44' and 'K8-201'.

[0102] The results are shown in Table 3. As can be seen from Table 3, the accuracy of the polymorphic molecular marker FC-71 in the population was 100%, that is, the electrophoretic band pattern of the FC-71 molecular marker was the same as that of the bitter melon inbred line 'K44', which was "Short", and the commercial fruit color was white; the electrophoretic band pattern was the same as that of the bitter melon inbred line 'K8-201', which was "Long", and the commercial fruit color was green ( Figure 3 , Table 3). Therefore, the molecular markers developed in this patent can be used to identify the peel color of bitter melon plants at the seedling stage.

[0103] Table 3 Phenotypes of 50 natural populations of bitter melon and genotypes based on molecular marker FC-71

[0104]

[0105]

[0106] Note: Short, genotype with white fruit; Long, genotype with green fruit.

[0107] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting InDel molecular markers co-segregating with bitter melon peel color in identifying bitter melon peel color traits or in bitter melon peel color molecular breeding, characterized in that: The nucleotide sequence of the InDel molecular marker co-segregated with the bitter melon peel color is shown in SEQ ID NO. 1, wherein M in the sequence is an ATTAATAA insertion or deletion.

2. Use of primers for detecting InDel molecular markers co-segregating with bitter melon peel color in identifying bitter melon peel color traits or in bitter melon peel color molecular breeding, characterized in that: The nucleotide sequence of the InDel molecular marker co-segregated with the bitter melon peel color is shown in SEQ ID NO. 1, wherein M in the sequence is an ATTAATAA insertion or deletion; The primers include primers FC-71-F and FC-71-R, and their nucleotide sequences are shown below: FC-71-F: 5'-AAACTTGGTTTCCTTACCCAAAAA-3'; FC-71-R: 5'-GTTGGTTTTTGAAAAGTCTTGAATTGC-3'.

3. Use of a kit for detecting InDel molecular markers co-segregating with bitter melon peel color in identifying bitter melon peel color traits or in bitter melon peel color molecular breeding, characterized in that: The nucleotide sequence of the InDel molecular marker co-segregated with the bitter melon peel color is shown in SEQ ID NO. 1, wherein M in the sequence is an ATTAATAA insertion or deletion; The kit comprises the primer according to claim 2.

4. The use according to claim 3, characterized in that The kit also contains dNTPs, reaction buffer and Taq enzyme.

5. A method for identifying the color of bitter melon peel, characterized in that The following steps are included: (1) Extract DNA from bitter melon to be tested; (2) Using the bitter melon DNA to be tested extracted in step (1) as a template and the primers described in claim 2 or the primers in the kit described in claim 3 as amplification primers, PCR amplification and polyacrylamide gel electrophoresis are performed; (3) Based on the electrophoresis results, determine the genotype and the color of the bitter melon peel.

6. The method for identifying the color of bitter melon peel according to claim 5, wherein: The reaction procedure of the PCR amplification is: Pre-denaturation at 94°C for 3 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s; and finally extension at 72°C for 5 min.

7. The method for identifying the color of bitter melon peel according to claim 5, wherein: The method for determining the genotype and the color of the bitter melon peel is as follows: The electrophoretic band pattern is the same as that of the bitter melon inbred line 'K44', and the commercial fruit color is white; the electrophoretic band pattern is the same as that of the bitter melon inbred line 'K8-201', and the commercial fruit color is green.

Images