Application of MED23 gene in inhibiting porcine epidemic diarrhea virus

Abstract

The present invention discloses the application of MED23 gene in inhibiting porcine epidemic diarrhea virus, belongs to the technical field of porcine viral disease prevention and treatment, and discloses the application of a preparation for knocking out MED23 gene in preparing a drug for inhibiting porcine epidemic diarrhea virus. The present invention provides a sgRNA sequence for knocking out MED23 gene, and constructs a Vero cell line of MED23 gene knockout mutant, the construction method is simple to operate, short cycle, and low cost; through fluorescent quantitative PCR and Western Blot experiments, it is found that MED23 gene knockout mutant can inhibit the replication efficiency of PEDV on host cells. The present invention shows that knocking out MED23 gene can inhibit PEDV, and is used to prevent and treat PEDV infection diseases, which is of great significance to disease control in the pig farming industry.

Description

Technical Field

[0001] The invention relates to the technical field of prevention and treatment of porcine viral diseases, and in particular to application of MED23 gene in inhibiting porcine epidemic diarrhea virus. Background Art

[0002] The Mediator complex (MED) is a large, important multi-subunit transcriptional coactivator that is highly conserved in eukaryotes. It mainly mediates the important steps of gene expression, including elongation, pre-mRNA processing, chromatin structure, termination, and epigenetic regulation, by mediating specific transcription factors in enhancers and RNA polymerase II bound to promoters. MED23 is located in the tail module of MED and plays an important role in various biological processes of cells. Researchers have found that MED23 is a key factor in adipogenesis, and knocking it out will inhibit adipogenesis; MED23 plays an important role in the coupling of UV-induced DNA repair and pigmentation. MED23 deficiency leads to enhanced nucleotide excision repair (NER) and reduced DNA damage after ultraviolet radiation; the presence of MED23 helps control T cell activation and prevent autoimmunity. MED23 is not only related to tumorigenesis, but also promotes osteoblast differentiation and bone development. It has also been proven that knocking it out can enhance neural development in early embryos of mice and zebrafish.

[0003] Porcine epidemic diarrhea (PED) is a viral diarrhea disease caused by porcine epidemic diarrhea virus (PEDV). It can occur in pigs of all ages. Its main characteristics are vomiting, acute watery diarrhea, severe anorexia, dehydration, etc. in infected pigs. Suckling piglets are prone to severe infection with a high mortality rate of up to 100%. Adult pigs are infected with mild symptoms and a low mortality rate. PEDV belongs to the Coronaviridae family and the genus Alphacoronavirus. It is a single-stranded positive-strand RNA virus with a genome size of about 28Kb and contains 7 open reading frames (ORFs), namely ORF1a, ORF1b, S, ORF3, E, M and N genes, which can encode four structural proteins, S, E, M and N. In vitro, many structural and non-structural proteins inhibit type I and type III interferon responses and play an important role in the process of virus infection of cells. By analyzing whether the S gene has base insertions and deletions, the currently prevalent PEDV is divided into three categories: classical strains (GⅠ group), variant strains (GⅡ group) and recombinant strains represented by S-INDEL. Before 2010, PEDV GⅠ type was the main epidemic strain. After that, the prevalence of GⅡ type strains increased year by year. At the same time, S-INDEL recombinant strains appeared. The new subgroups G2c and G2d strains may be produced by recombination between S-INDEL strains and G2a strains. Multiple genotypes and subtypes of PEDV have different pathogenicity and transmission capabilities, and variant strains are more infectious than classical strains. Therefore, it is particularly important to develop preparations that effectively inhibit porcine epidemic diarrhea virus infection. However, there is no research report on the association between MED23 and the infection process of PEDV in the prior art. Summary of the invention

[0004] The purpose of the present invention is to provide an application of the MED23 gene in inhibiting porcine epidemic diarrhea virus to solve the problems existing in the above-mentioned prior art. The present invention confirms that the MED23 gene can be used as a new target for anti-PEDV drugs. Knocking out the gene or developing related drugs targeting the target can reduce damage to cells and toxicity to mammals such as pigs, providing a new idea for the prevention and treatment of PEDV, which is of great significance to disease control in the pig industry.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides application of a preparation for knocking out MED23 gene in preparing a medicine for inhibiting porcine epidemic diarrhea virus.

[0007] Furthermore, the reference genome sequence accession number of the MED23 gene is NCBI Gene ID: 103240375.

[0008] Furthermore, the preparation contains sgRNA or a biological material containing sgRNA.

[0009] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.2.

[0010] Furthermore, the biological material comprises a recombinant vector, a recombinant cell or a recombinant bacterium.

[0011] Furthermore, by knocking out the MED23 gene, the replication ability of porcine epidemic diarrhea virus was reduced.

[0012] The present invention also provides a drug for preventing and treating porcine epidemic diarrhea, wherein the drug comprises a preparation with a MED23 gene knocked out; the reference genome sequence accession number of the MED23 gene is NCBI Gene ID: 103240375.

[0013] Furthermore, the preparation contains sgRNA or a biological material containing sgRNA.

[0014] Furthermore, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.2.

[0015] Furthermore, the drug also includes a pharmaceutically acceptable carrier.

[0016] The present invention discloses the following technical effects:

[0017] The present invention provides a sgRNA sequence for knocking out the MED23 gene, and constructs a Vero cell line of a MED23 gene knockout mutant. The construction method is simple to operate, short in cycle, and low in cost. Through fluorescent quantitative PCR and Western Blot experiments, it was found that the MED23 gene knockout mutant can inhibit the replication efficiency of PEDV on host cells. It shows that knocking out the MED23 gene can inhibit PEDV and is used to prevent and treat PEDV infection diseases.

[0018] The present invention reveals that the MED23 gene can be used as a new target for the development and application of antiviral drugs. Knocking out the gene or developing related drugs targeting the target can reduce damage to cells and toxicity to mammals such as pigs, providing new ideas for the prevention and treatment of PEDV, which is of great significance to disease control in the pig industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1This is the pSpCas9-2A-Puro(PX459)V2.0 vector map;

[0021] Figure 2 It is the sequencing map of PX459 (MED23-sgRNA) plasmid;

[0022] Figure 3 Peak graph and sequence alignment of the wild-type Vero cell and the MED23 mutant monoclonal cell line (MED23-KO1);

[0023] Figure 4 The figure shows the effect of wild-type Vero cell line and MED23 mutant monoclonal cell line (MED23-KO1) on the expression level of N protein mRNA related to PEDV replication;

[0024] Figure 5 This is a graph showing the effects of wild-type Vero cell line and MED23 mutant monoclonal cell line (MED23-KO1) on the expression of PEDV-N protein. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] The present invention designs sgRNA for the MED23 gene sequence and inserts it into the PX459 vector to construct a PX459-sgRNA-MED23 recombinant plasmid; the plasmid is transfected into Vero cells through liposomes, and puromycin is added to screen positive cells; the monoclonal cells are screened by limiting dilution method and genotype sequencing is performed to obtain a monoclonal cell line with MED23 gene knockout; finally, fluorescence quantitative PCR and Western Blot experiments are performed to verify that the MED23 knockout cell line has a certain inhibitory effect on the infection of porcine epidemic diarrhea virus. The specific research is as follows:

[0031] Example 1

[0032] 1. Construction of knockout vector

[0033] 1. Design and synthesize sgRNA

[0034] The MED23 (NCBI Gene ID: 103240375) gene sequence was found on the NCBI website. The appropriate exon region was selected according to different transcripts. The sgRNA design website was used to design the sgRNA. The queried exon sequences were imported respectively. The species African green monkey (Chlorocebus sabaeus), PAM sequence and desired gRNA length were selected as needed. The system automatically generated the sgRNA sequence and the sgRNA sequence with a high on-target score was selected for export. The target sequence is: 5'-ATTATGAGGATACCTCTCCC-3' (SEQ ID NO.1), and the sgRNA sequence for editing the DNA sequence is: 5'-ATTAUGAGGAUACCUCUCCC-3' (SEQ ID NO.2). "CACC" is added to the 5' end of the sense strand of the target sequence, and "AAAC" is added to the 5' end of the antisense strand. If the base after "CACC" of the sense strand oligonucleotide is not "G", then add the base "G" and add a base "C" to the 3' end of the antisense strand oligonucleotide, as shown below:

[0035] Forward OligoDNA (MED23-Oligo-F): 5'-CACCGATTATGAGGATACCTCTCCC-3' (SEQ IDNO.3);

[0036] Reverse OligoDNA (MED23-Oligo-R): 5'-AAACGGGAGAGGTATCCTCATAATC-3' (SEQ ID NO. 4).

[0037] 2. Construction of PX459 (MED23-sgRNA) plasmid

[0038] After the synthesized sgRNA powder is dissolved, it needs to be annealed to form sgRNA double strands. The annealing reaction system and conditions are as follows:

[0039] Table 1

[0040]

[0041] After mixing the prepared system, perform the reaction on a PCR instrument. The procedure is as follows: 37°C for 30 min, 95°C for 5 min, and 12°C for ∞. When the reaction is completed, the sgRNA double strand is obtained and can be stored at -20°C.

[0042] The annealed sgRNA double strands should be ligated to the linearized PX459 (i.e., pSpCas9-2A-Puro(PX459) V2.0, as Figure 1 ) to connect, the system is as follows:

[0043] Table 2

[0044]

[0045] After the required reagents are prepared according to the above system, they are centrifuged and mixed, and placed on a PCR instrument for reaction. The reaction procedure is shown in the table below:

[0046] Table 3

[0047]

[0048] The recombinant plasmid PX459 (MED23-sgRNA) was obtained by ligation.

[0049] 3. Transformation and screening of PX459 (MED23-sgRNA) positive clones

[0050] (1) Prepare an ice box, take out the competent cells DH5α from the -80℃ refrigerator, and place them on ice to thaw. Dispense the thawed competent cell suspension into 1.5ml centrifuge tubes, with 50μl in each tube.

[0051] (2) Pipette 5 μl of the recombinant plasmid obtained by ligation and add it to the competent cells. Mix by gently pipetting and incubate on ice for 30 min.

[0052] (3) Heat shock the mixed solution in a 42°C water bath for 90 seconds, then quickly place the tube on ice for 3-5 minutes.

[0053] (4) Pipette 500 μl of LB liquid culture medium (without antibiotics) into a centrifuge tube, pipette to mix, and place on a shaker at 37°C, 150 rpm, and culture for 45 min-1 h.

[0054] (5) Melt the LB solid culture medium in a microwave oven. When the temperature of the culture medium drops to about 50°C, add ampicillin at a ratio of 1:1000, mix well, and pour on a plate.

[0055] (6) Take out the cultured bacterial solution and dilute it 10 times using LB liquid medium. -1 , 10 -2 , 10 -3 100 μl of bacterial solution was spread on the screening plate containing AMP, and then placed upside down in a 37°C incubator for overnight culture for 12-16 hours.

[0056] (7) On the next day, pick a single colony from the plate and add it to LB liquid culture medium containing AMP. Incubate at 37°C with shaking at 200 rpm.

[0057] (8) Design primers, perform colony PCR verification on the picked single colonies, and send them to Beijing Qingke Biotechnology Co., Ltd. for sequencing using the U6 promoter. Figure 2 This is the sequencing map of PX459 (MED23-sgRNA) plasmid.

[0058] 2. Construction of MED23 gene-deficient cell lines

[0059] Vero cells were passaged into 6-well plates and cultured using Lipo8000 TMTransfection reagent was used for transfection, and PX459 (MED23-sgRNA) was transferred into the cells and cultured for 48 hours. After 48 hours, the cells were screened with complete medium containing 6μg / mL puromycin. Fresh complete medium containing puromycin was replaced every two days until the negative control cells died completely. The complete medium containing puromycin can be replaced with normal medium. After the cells recovered, they were cultured in 96-well plates by limiting dilution. The obtained monoclonal cells were transferred from the 96-well plates, expanded and cultured, and the genomic DNA of different monoclonal cells was extracted. Primers were designed for the DNA region containing sgRNA, and high-fidelity PCR was performed on the genomic DNA of the monoclonal cells. The PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The PCR primers are MED23-F: 5'-GAATGACTATAAGATTGCTCT-3', MED23-R: 5'-TTCCCTAAATGTACCTGAC-3'. Analysis of the sequencing results revealed that the target sequence of MED23 lacked a "C" base, resulting in a frameshift mutation and a non-functional protein, thus achieving the purpose of knocking out the gene ( Figure 3 ).

[0060] 1. qPCR Validation

[0061] After the wild-type Vero cell line and the mutant Vero cell line (MED23-KO1) were plated in a 12-well plate, the cells were inoculated with 0.1 MOI of PEDV virus (PEDVCH-GDHY-2011 strain (GenBank accession number: JX145339.1)). After 48 hours of infection, the supernatant was collected by repeated freezing and thawing three times, and the viral DNA was extracted using the Solebo Animal Cell / Tissue Genomic DNA Extraction Kit for SYBR Green qPCR. The primers are as follows:

[0062] Table 4 qPCR primers

[0063] Name Sequence(5'to3') PEDV-F GATACAAGGCTGTTAGAGAGATAATT PEDV-R AAGTTGATAACGGACTAGCCTTAT β-actin-F TCCACGAAACTACCTTCAACTC β-actin-R GTGATCTCCTTCTGCATCCTG

[0064] The results are as follows Figure 4 As shown, the results showed that compared with the control group, the mRNA expression level of PEDVN protein in the mutant Vero cell line (MED23-KO1) was significantly reduced, confirming that the amount of PEDV replication virus was significantly reduced.

[0065] 2. Western Blot Verification

[0066] After adding Western and IP cell lysates to 6-well plates of wild-type Vero cell lines and mutant Vero cell lines (MED23-KO1) infected with PEDV for 48 hours, the protein solution was collected, and the boiled samples were subjected to polyacrylamide gel electrophoresis and transferred to PVDF membranes. The samples were blocked with rapid blocking solution for 10 minutes and washed with TBST; the primary antibody was incubated at 4°C overnight and washed with TBST three times; the secondary antibody was incubated for 1 hour and washed with TBST three times; ELC chemiluminescent colorimetric solution was added, and then the gel imaging system was used for imaging.

[0067] The imaging results are as follows Figure 5 As shown, the results showed that the expression level of N protein (abbreviated as NP) in the mutant Vero cell line (MED23-KO1) was significantly reduced after PEDV infection.

[0068] The above results show that the method of the present invention successfully constructed a MED23 gene knockout Vero cell line and can effectively resist PEDV infection, which is of great significance for disease control in the pig industry.

[0069] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a preparation with MED23 gene knocked out in the preparation of an agent for inhibiting porcine epidemic diarrhea virus, characterized in that: The reference genome sequence accession number of the MED23 gene is NCBI Gene ID: 103240375; The preparation contains sgRNA; the nucleotide sequence of the sgRNA is shown in SEQ ID NO.

2.

2. An agent for inhibiting porcine epidemic diarrhea virus, characterized in that: The reagent comprises sgRNA; the nucleotide sequence of the sgRNA is shown in SEQ ID NO.2.

Images