Rice OsPPDK gene mutants and their application in improving rice storage material content and distribution

Abstract

The present invention discloses a rice OsPPDK gene mutant and its application in improving the content and distribution of storage substances in rice. The rice OsPPDK gene mutant is obtained by inserting base C into the second exon region of the coding region of the rice cytoplasmic PPDK gene (CyOsPPDK, LOC_Os05g33570). The mutant is named CyOsPPDK+C. It has been verified that the gene mutant causes rice floury endosperm and changes the content and distribution of storage substances in rice grains, playing an important role in the genetic improvement of rice quality.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a rice OsPPDK gene mutant and its application in improving the content and distribution of rice storage substances. Background Art

[0002] The primary storage substances in the rice seed endosperm are starch and protein. Starch accounts for the majority and determines rice quality and yield, while protein, which accounts for approximately 10%, influences the rice's flavor and nutritional value. Therefore, in-depth analysis of the regulatory mechanisms governing starch and protein synthesis and accumulation, as well as the identification of related genes, is crucial for improving rice quality.

[0003] Rice floury mutants are ideal genetic material for studying endosperm development and quality regulation networks. These mutants typically exhibit an opaque endosperm due to abnormalities in the synthesis and accumulation of starch or storage proteins. Currently, important genes cloned from floury endosperm mutants are involved in various aspects of cellular metabolism:

[0004] (1) Genes involved in starch synthesis, such as FLO8, OsAGPL2, OsAGPS2, OsBT1, OsBEIIb, FLO5, Pho, and FLO20-1;

[0005] (2) genes involved in amyloplast development, such as SSG4, SSG6, FLO6, OsGBP, FLO7, FLO11, FLO15, FLO16, FSE1, and FLO9;

[0006] (3) storage protein transport-related genes, such as PDIL1-1 and GPA1-GPA6;

[0007] (4) genes related to aleurone development, such as OsROS1;

[0008] (5) Genes related to glucose metabolism, such as PFPβ and GIF1;

[0009] (6) Genes related to carbon and nitrogen metabolism, such as FLO4, OsPK2, and FLO12;

[0010] (7) Transcription factors, such as RISBZ1, RSR1, NF-YB1, NF-YC12, and bHLH144;

[0011] (8) Genes involved in mitochondrial function, such as FLO13, OGR1, FLO10, OsNPPR1, FLO18, and FLO22.

[0012] Among them, FLO4 encodes a C4 type ketoacid phosphate dikinase (PPDK). PPDK in plants can be divided into chloroplast PPDK (chPPDK) and cytoplasmic PPDK (cyPPDK). chPPDK is mainly distributed in chloroplasts and expressed in the photosynthetic tissues (such as leaves) of C4 plants, while cyPPDK is mainly distributed in the cytoplasm and expressed in non-photosynthetic tissues such as seeds and roots of plants. In rice, the content of PPDK protein in grains is relatively high compared with other organs such as roots, leaves, and stems. Studies have shown that FLO4 regulates carbon and nitrogen metabolism in the endosperm, thereby affecting starch synthesis. Summary of the Invention

[0013] The purpose of this section is to summarize some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the abstract and title of this application to avoid obscuring the purpose of this section, the abstract and the title of the invention, and such simplifications or omissions should not be used to limit the scope of the present invention.

[0014] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0015] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a rice OsPPDK gene mutant.

[0016] To solve the above technical problems, the present invention provides the following technical solution: the mutant is obtained by base insertion in the second exon of the coding region of the OsPPDK gene (LOC_Os05g33570), and the base is C.

[0017] The nucleotide sequence of the mutant is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2.

[0018] Another object of the present invention is to provide a gene encoding a rice OsPPDK gene mutant.

[0019] Another object of the present invention is to provide a recombinant plasmid comprising a gene encoding a rice OsPPDK gene mutant.

[0020] Another object of the present invention is to provide a host cell comprising the recombinant plasmid.

[0021] Another object of the present invention is to provide an application of a rice OsPPDK gene mutant, comprising:

[0022] The application of the gene mutant in regulating the content of rice storage substances also includes:

[0023] The application of the gene mutant in regulating the gelatinization characteristics and amylopectin structure of rice also includes:

[0024] The gene mutant is used in regulating the expression of rice endosperm storage protein synthesis genes and starch metabolism genes.

[0025] Another object of the present invention is to provide a method for preparing transgenic rice, comprising causing the OsPPDK gene of a recipient rice to undergo the mutation as described in claim 1, causing the endosperm to exhibit a floury phenotype and simultaneously causing changes in the content and distribution of storage substances in the rice grains, thereby obtaining the transgenic rice.

[0026] Beneficial effects of the present invention:

[0027] The present invention discloses a rice OsPPDK gene mutant and its application in improving the content and distribution of storage substances in rice. The rice OsPPDK gene mutant is obtained by inserting base C into the second exon region of the coding region of the rice cytoplasmic PPDK gene (CyOsPPDK, LOC_Os05g33570). The mutant is named CyOsPPDK+C. It has been verified that the gene mutant causes rice floury endosperm and changes the content and distribution of storage substances in rice grains, playing an important role in the genetic improvement of rice quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort. Among them:

[0029] Figure 1 This is a scanning electron microscope image of a cross section of a grain of the OsPPDK gene mutant CyOsPPDK+C in Example 2 of the present invention.

[0030] Figure 2 This is the determination of storage substance content in the OsPPDK gene mutant CyOsPPDK+C and the control parent Sasanishiki rice in Example 3 of the present invention.

[0031] Figure 3 This is the determination of the gelatinization characteristics of the OsPPDK gene mutant CyOsPPDK+C and the control parent Sasanishiki rice in Example 4 of the present invention.

[0032] Figure 4 This is an analysis of the amylopectin structure of the OsPPDK gene mutant CyOsPPDK+C and the control parent Sasanishiki rice in Example 4 of the present invention.

[0033] Figure 5 This is an expression analysis of endosperm storage protein synthesis genes and starch metabolism genes in the OsPPDK gene mutant CyOsPPDK+C of Example 5 of the present invention and the control parent Sasanishiki rice. DETAILED DESCRIPTION

[0034] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0035] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0036] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive of other embodiments.

[0037] Unless otherwise specified, the technical means used in the specific embodiments of the present invention are conventional means well known to those skilled in the art, and the raw materials used are commonly commercially available in the art.

[0038] Example 1 Obtaining Rice OsPPDK Gene Mutants

[0039] The OsPPDK editing target was designed using the website http: / / skl.scau.edu.cn / . The target nucleotide sequence was AGGGAAGGGGGCGAACTTGGcgg (the last three bases are the PAM site). The OsPPDK knockout vector KO-PPDK was constructed according to the method provided in the paper (Yuming Lu et al. Genome-wide targeted mutagenesis in rice using CRISPR / Cas9 system, Molecular Plant, 2017, 10, 1242-1245).

[0040] KO-PPDK was transformed into callus induced from immature embryos of wild-type Sasanishiki by Agrobacterium-mediated method, and positive transgenic plants were obtained by hygromycin selection.

[0041] Leaf DNA was extracted from the positive transgenic plants obtained, and the target segment was amplified with primers CXF:AACCCAATACGA TCAGCAGG and CXR:GCCGCAGAATCGTGAATTTG, and first-generation sequencing was performed to analyze the editing form of the mutant. It was verified that a base insertion occurred in the second exon of the coding region, and the mutant CyOsPPDK+C was finally obtained, in which base C was inserted.

[0042] The nucleotide sequence of the mutant CyOsPPDK+C is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No. 2.

[0043]

[0044] Example 2 Analysis of phenotypic and agronomic traits of mutants

[0045] The positive transgenic plant obtained in Example 1 was named the wcr mutant. It was observed that its mature seeds were powdery and opaque compared to the wild type after the lemma was removed. When a blade was used to cross-cut the seeds, it was found that the opaque part was mainly the internal endosperm.

[0046] The cross sections of mature grains of wcr mutant and wild type were observed using scanning electron microscopy. Figure 1 As shown, it was found that the starch granules in the inner and outer endosperm of the wild type were arranged tightly and evenly, and the outer endosperm of the wcr mutant was similar to the wild type, but the starch granules in the inner endosperm were loosely arranged, with larger gaps between granules, and more single-grain starch granules, indicating that the starch structure of the endosperm of the wcr mutant was changed.

[0047] Example 3 Analysis of storage substance content in mature grains of wcr mutants

[0048] Since the endosperm development of the wcr mutant grains is abnormal and there are differences in the starch granule structure of the inner and outer endosperm, the physical and chemical properties of the wcr mutant and wild-type brown rice and polished rice were further determined based on the method provided in the paper (Yihao Yang; et al. Rapid improvement of rice eating and cooking quality through gene editing toward glutelin as target, Journal of Integrative Plant Biology, 2022, 64(10): 1860-1865).

[0049] The results are as follows Figure 2As shown, compared with the wild type, there was no statistical difference in the total starch and amylose contents in the mutant's brown rice flour, while the total starch and amylose contents in the polished rice were significantly reduced; the results of component protein content determination showed that the contents of the four component proteins in the wcr mutant's brown rice flour were significantly decreased, while in the polished rice, the albumin content was significantly increased, and the contents of other component proteins did not change.

[0050] Example 4 Analysis of Gelatinization Characteristics and Amylopectin Structure of wcr Mutants

[0051] The gelatinization properties of grain starch were detected using urea solutions of different concentrations according to the method provided in the reference paper (Pan Pengyi, Zhu Jianping, Wang Yunlong, et al. Phenotypic analysis and gene cloning of rice floury endosperm mutant ws. Chinese Journal of Rice Science, 2016, 30(5):447-457).

[0052] The results are as follows Figure 3 The results showed that the wcr mutant was less soluble in urea than the wild type. A significant difference began to emerge at a urea concentration of 1 mol / L, becoming extremely significant at 3 mol / L. The mutant no longer swelled at 8 mol / L. Urea swelling experiments also revealed altered amylopectin structure in the wcr mutant.

[0053] The chain length distribution of amylopectin was determined by referring to the method provided in the paper (Long Zhang, et al. A novel mutation of OsPPDKB, encoding pyruvate orthophosphate dikinase, affects metabolism and structure of starch in the rice endosperm, International Journal of Molecular Sciences, 2018, 19, 2268).

[0054] The results are as follows Figure 4 As shown, the results showed that compared with the wild type, the content of chain length with degree of polymerization (DP) of 6-35 in the brown rice flour of the wcr mutant was reduced, while the content of chain length with degree of polymerization greater than 36 was increased; the overall change of wcr refined rice flour was smaller than that of the wild type, with a variation range of -0.2 to 0.2.

[0055] Example 5 Analysis of rice storage substance related gene expression

[0056] Since the content and distribution of storage materials (starch and protein) in the wcr mutant were changed, in order to explore the rice storage material regulatory network involved in wcr, the expression levels of 35 rice protein synthesis genes and 18 starch metabolism genes in the wild type and mutant were further detected by RT-qPCR technology based on the methods and primers provided by the paper (Yihao Yang; et al. Knocking Out OsAAP11 to Improve Rice Grain Quality Using CRISPR / Cas9 System, International Journal of Molecular Sciences, 2023, 24(18): 14360).

[0057] The results are as follows Figure 5 As shown in the results, the expression levels of most rice protein synthesis genes in the mutants were significantly decreased, and the decrease was large. At the same time, the genes involved in rice starch metabolism in the mutants were also downregulated to varying degrees.

[0058] The results of Examples 2 to 5 indicate that rice OsPPDKb is involved in the regulatory network governing the content and distribution of rice storage substances. By constructing transgenic materials related to this gene, such as transgenic knockout materials, new rice germplasms with reduced amylose content and component protein content were prepared. Furthermore, the rice OsPPDK gene mutants provided by the present invention impart a floury phenotype to the endosperm and alter the content and distribution of storage substances in the rice grain, playing an important role in the genetic improvement of rice quality.

[0059] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for preparing transgenic rice, characterized by: Transgenic rice is obtained by mutating the OsPPDK gene of the recipient rice; The mutation is obtained by a base insertion in the second exon of the LOC_Os05g33570 coding region of the OsPPDK gene, wherein the base is C. The nucleotide sequence of the mutated OsPPDK gene is shown in SEQ ID No. 1, and the amino acid sequence is shown in SEQ ID No.

2.

2. The preparation method according to claim 1, wherein: The mutation causes the endosperm to exhibit a floury phenotype and simultaneously causes changes in the content and distribution of storage substances in rice grains.

Images