A circular RNA transcription vector and its preparation method and application

Abstract

The present invention belongs to the field of bioengineering technology, and discloses a circular RNA transcription vector and its preparation method and application. The circular RNA transcription vector of the present invention comprises the following structural elements: an external 5' homology arm, a ribozyme, an internal 5' homology arm, a 5' spacer sequence, an IRES, a multiple cloning site or a coding region, a 3' spacer sequence, an internal 3' homology arm, a ribozyme, and an external 3' homology arm. The present invention avoids the generation of a variety of cyclization byproducts caused by temperature fluctuations during in vitro transcription by optimizing the internal 3' homology arm and the internal 5' homology arm sequence of the circular RNA transcription vector, thereby ensuring the singleness, stability and efficient expression of the produced circular RNA product and reducing production costs. It is of great significance to the development of the in vitro preparation process of circular RNA and the further application of circular RNA.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a circular RNA transcription vector and a preparation method and application thereof. Background Art

[0002] Circular RNA is widely present in organisms and plays an important and special biological function such as protein sponge, miRNA sponge, protein scaffold, transcriptional regulation, etc. With the application and promotion of linear mRNA in vaccines and other aspects, circular RNA that does not require cap structure modification has gradually attracted people's attention. There are three main ways to produce circular RNA in vitro: the first is to use compounds such as hydrogen bromide (BrCN) to promote linear RNA to form 3'-5' phosphate bonds, but its purification cost is high and the yield is low. It can only be used for RNA of 70nt-80nt, which is difficult to be promoted in actual production. The second is the enzyme connection method, which can catalyze double-stranded RNA or single-stranded RNA into a ring through T4 RNA ligase. Its cyclization efficiency is higher than that of the chemical method, but the size of RNA that can form a ring is limited to 250nt. The third is to use ribozymes to self-cleave and splice into a ring in vitro, such as the PIE system (Permuted-Intron-Exon, PIE). The nucleases used are mainly type I self-splicing introns or type II self-splicing introns. Type I self-splicing intron self-splicing requires GTP and Mg 2+ The participation of GTP is not required in the process of type II self-splicing intron circularization. The adenylate 2'-OH in its own internal sequence can act as a nucleophilic group to attack the phosphodiester bond at the 5' end of the intron, resulting in a translipidation reaction.

[0003] In the prior art, the circular RNA in vitro transcription vector disclosed by RA Wesselhoeft et al. is currently a widely used in vitro transcription vector, which has the advantages of high in vitro cyclization efficiency, good protein translation efficiency, and not easy to degrade. However, this vector, such as CVB3-GLuc-pAC (Full), also has limitations in actual use. In the in vitro transcription reaction (In Vitro Transcription, IVT), this vector is easily affected by temperature fluctuations, resulting in the generation of multiple splicing sites, and these splicing site byproducts do not have vector expression activity, resulting in a series of disadvantages such as decreased circular RNA expression efficiency, difficulty in removing byproducts downstream, and increased production costs. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a circular RNA transcription vector and a preparation method and application thereof.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] In the first aspect, the present invention provides a circular RNA transcription vector comprising the following structural elements: an external 5' homology arm, a ribozyme, an internal 5' homology arm, a 5' spacer sequence, an IRES, a multiple cloning site or coding region, a 3' spacer sequence, an internal 3' homology arm, a ribozyme, and an external 3' homology arm.

[0007] The invention optimizes the internal 3' homology arm and internal 5' homology arm sequences of the circular RNA transcription vector, thereby avoiding the generation of various cyclization byproducts caused by temperature fluctuations during in vitro transcription, ensuring the singleness, stability and efficient expression of the produced circular RNA product, and reducing production costs.

[0008] As a preferred embodiment of the circular RNA transcription vector of the present invention, the external 5' homology arm is shown as SEQ ID No.1; the external 3' homology arm is shown as SEQ ID No.2.

[0009] As a preferred embodiment of the circular RNA transcription vector of the present invention, the internal 5' homology arm or the internal 3' homology arm is a homology sequence that does not contain a self-cleaving ribozyme site or does not participate in a ribozyme cleavage reaction.

[0010] As a preferred embodiment of the circular RNA transcription vector described in the present invention, the ribozyme is any one of a type I self-cleaving intron ribozyme or a type II self-cleaving intron ribozyme.

[0011] As a preferred embodiment of the circular RNA transcription vector of the present invention, its nucleotide sequence is any one of SEQ ID No.3-SEQ ID No.9.

[0012] In a second aspect, the present invention provides a method for preparing the circular RNA transcription vector, comprising the following steps:

[0013] The template of the vector is linearized and then subjected to in vitro transcription reaction, followed by circularization catalysis reaction, followed by RNase-R enzyme digestion reaction, and purification to obtain the product.

[0014] In a third aspect, the present invention provides an engineered cell obtained by transfection of the circular RNA transcription vector.

[0015] As a preferred embodiment of the engineered cells of the present invention, the cells are HEK293.

[0016] In a fourth aspect, the present invention applies the circular RNA transcription vector and the engineered cell in genetic engineering and / or protein production.

[0017] As a preferred embodiment of the application of the present invention, the genetic engineering includes preparing circular RNA expression molecules.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The invention analyzes the shear site characteristics of circular RNA products produced by the IVT reaction of the transcription vector at different temperatures by a reverse transcription method, and optimizes the internal 3' homology arm and the internal 5' homology arm sequences of the circular RNA transcription vector by a point mutation method, so that the obtained transcription vector retains the high expression characteristics and is not affected by the IVT temperature, overcomes the defects of multiple self-splicing splicing sites of the original vector that are affected by the in vitro transcription temperature, ensures the singleness and stability of the RNA products of the later stage, provides a new method for reducing the product expression efficiency and production cost, and has important significance for the development of the in vitro preparation process of circular RNA and the further application of circular RNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Designed for circular RNA in vitro transcription vector.

[0021] Figure 2 This is the PCR analysis of CVB3-GLuc-pAC circular RNA by temperature gradient reverse transcription amplification.

[0022] Figure 3 Reverse transcription amplification, PCR and sequencing analysis of CVB3-GLuc-pAC.

[0023] Figure 4 This is the agarose electrophoresis diagram of the CVB3-Gluc-pAC-P1 reverse transcription PCR amplification product.

[0024] Figure 5 Verification of the expression efficiency of CVB3-Gluc-pAC-P1.

[0025] Fig. 6A This is the electrophoresis diagram of CVB3-GLuc-pAC-P11 reverse transcription amplification;

[0026] Figure 6B This is the electrophoresis diagram of reverse transcription amplification of CVB3-GLuc-pAC-P13 and CVB3-GLuc-pAC-P12;

[0027] Figure 6C This is the electrophoresis diagram of reverse transcription amplification of CVB3-GLuc-pAC-P15 and CVB3-GLuc-pAC-P14.

[0028] Figure 7 Verification of the expression efficiency of CVB3-Gluc-pAC-P12. DETAILED DESCRIPTION

[0029] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0030] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0031] Example 1: Verification of circular RNA in vitro transcription vector CVB3-GLuc-pAC (Full) shearing and splicing into circular sites at different in vitro transcription temperature gradients

[0032] In this example, the circular RNA in vitro transcription vector CVB3-GLuc-pAC (Full) (RA Wesselhoeft, PS Kowalski, DG Anderson. Engineering circular RNA for potent and stable translation in eukaryotic cells [J]. Nat Commun, 2018, 9 (1): 2629.) was subjected to different in vitro transcription temperature gradients to shear and splice into circular sites for verification.

[0033] The specific operation steps are as follows: First, construct the vector according to the sequence provided by CVB3-GLuc-pAC (Full), and add the BamHI+T7 promoter sequence: GGATCCTAATACGACTCACTATA at the beginning of the sequence to facilitate in vitro transcription. At the same time, add the EcoR I:gaattc restriction site at the end of the sequence to facilitate vector restriction. Use DNAWorks (v3.2.4) (https: / / hpcwebapps.cit.nih.gov / dnaworks / ) to design primers and pass The synthetic sequence was amplified by Max DNA Polymerase (Takarabio), the backbone vector EA021 was digested with endonucleases FastDigestTM EcoRI and FastDigestTM BamHI (ThermoFisher), and homologous recombination ligation reaction was performed using ClonExpressMultiS One Step Cloning Kit (Nanjing Novozymes). The clones were transformed into Escherichia coli DH5ɑ and spread on ampicillin-resistant culture dishes. After 16 hours, colonies were picked for detection and the positive clones were sent to a sequencing company (Suzhou Genewise) for sequencing (SEQ ID No. 3). The plasmid with the correct sequencing results was named CVB3-GLuc-pAC.

[0034] The constructed plasmid CVB3-GLuc-pAC was subjected to FastDigestTM EcoRI digestion reaction, and the product was recovered by HiPure Gel Pure DNA Mini kit (Magen). In vitro transcription was performed using T7 High Yield RNA Transcription Kit (Vayzme): 8 different IVT reaction temperatures were set at 40°C, 39.6°C, 39°C, 38.1°C, 37°C, 36°C, 35.4°C, and 35°C for IVT reaction.

[0035] The IVT reaction system is shown in Table 1:

[0036] Table 1 IVT reaction system

[0037] Components volume 10×Reaction Buffer 2μl ATP Solution 2μl GTP Solution 2μl UTP Solution 2μl CTP Solution 2μl DNA template (linearized CVB3-GLuc-pAC) 0.5 μg T7 RNA Polymerase Mix 2μl RNase-free ddH2O Up to 20μl

[0038] Place in a three-slot independent gradient gene amplification instrument (Bio-GENER) and incubate for 2h-3h, add 1μL of DNase I, place in the original position and incubate for 15min to digest the transcribed DNA template. Perform lithium chloride precipitation to collect the product.

[0039] Using primers CHECK-cirRNA-F / CHECK-cirRNA-R and reverse transcriptase kit Reverse transcription was performed using Reverse Transcriptase (TransGen Biotech). The primers are listed in Table 2.

[0040] Table 2 Reverse transcription primer sequences

[0041] Primer name Sequence (5'-3') use CHECK-cirRNA-F GCGACCTTTGCCAGCAAGATCC Reverse transcription and PCR amplification CHECK-cirRNA-R CTTTCTCCTTCAACCGCGTGAGC Reverse transcription and PCR amplification

[0042] The reverse transcription reaction system is shown in Table 3:

[0043] Table 3 Reverse transcription reaction system

[0044]

[0045] Mix gently, incubate at 42℃ for 30min, and inactivate at 85℃ for 5s. After the reaction, take 1μL cDNA as template, use CHECK-cirRNA-F / CHECK-cirRNA-R as primers, and The synthetic sequence was amplified by Max DNA Polymerase (Takarabio), and the size of the PCR product was observed by agarose electrophoresis.

[0046] The results are as follows Figure 2As shown in the figure, it can be seen that when the reaction temperature of IVT is 40℃, 39.6℃, and 35℃, the reverse transcription PCR product is a single band, indicating that the circularized RNA has only one splicing site and only one circular RNA product. When the temperature is 39℃, 38.1℃, 37℃, 36℃, and 35.4℃, the reverse transcription PCR product has two bands. This indicates that the circularized RNA has two splicing sites A1 and A2, and there are two circular RNA products B1 and B2.

[0047] The products were recovered by gel recovery, and the larger band was named C1 and the smaller band was named C2, and sequencing analysis was performed. Figure 3 As shown, the sequencing results show that the C1 band sequence carries the internal 3' homology arm + E1 + E2 + internal 5' homology arm sequence (E1 and E2 are ribozyme exon sequences, see Figure 1 ), while the C2 band sequence lacks the internal 3' homology arm + E1 + E2 + internal 5' homology arm sequence. The internal 5' homology arm sequence is CACGCCGGAAACGTAATAGCCG (SEQ ID No.1), and the internal 3' homology arm sequence is CGGCTATTATACGTTACCGGCG (SEQ ID No.2). The C1 band is formed by normal splicing site A1 splicing and splicing, and the corresponding cyclization product is B1 (Liu CX, Guo SK, Nan F, et al. RNA circles with minimized immunogenicity as potent PKR inhibitors-ScienceDirect[J].2021). The C2 band is caused by splicing and splicing of abnormal splicing site A2, and the corresponding cyclization product is B2, but there is no relevant report on this abnormal splicing site.

[0048] Example 2: Verification of expression efficiency of different cyclization products

[0049] In order to better verify the effect of different cyclization products caused by different IVT reaction temperatures on expression efficiency. The mutation design of the A1 site was performed in the above CVB3-GLuc-pAC expression vector, the purpose of which was to silence the A1 site and prevent the shearing and splicing reaction. The mutant vector was named CVB3-GLuc-pAC-P1 (SEQ ID No. 4). CVB3-GLuc-pAC-P1 was linearized using FastDigestTM EcoRI, and an IVT reaction, reverse transcription reaction and amplification reaction were performed (the operating steps were the same as in Example 1), with primers CHECK-cirRNA-F / CHECK-cirRNA-R.

[0050] The results are as follows Figure 4As shown, agarose electrophoresis analysis of the reverse transcription amplification products showed that the CVB3-GLuc-pAC-P1 reverse transcription amplification product was smaller than the CVB3-GLuc-pAC reverse transcription amplification product. Analysis of the sequencing results showed that the CVB3-GLuc-pAC-P1 reverse transcription amplification product was consistent with the C2 sequence and lacked the internal 3' homology arm + E1 + E2 + internal 5' homology arm sequence.

[0051] 0.5ug of circular RNA products digested with RNase R (Epicenter) were respectively taken for HEK293 cell transfection and gluciferase assay experiments. (Mirus): RNA=1μL: 0.5μg.

[0052] The results are as follows Figure 5 As shown in the figure, it can be seen that the circularized RNA product of CVB3-GLuc-pAC-P1 has almost no expression activity, indicating that removing the internal 3' homology arm + E1 + E2 + internal 5' homology arm sequence reduces the expression of the CVB3-GLuc-pAC vector.

[0053] Example 3: Optimization design of CVB3-GLuc-pAC vector

[0054] As can be seen from Examples 1 and 2, the CVB3-GLuc-pAC vector has two splicing sites A1 and A2, wherein the splicing of A1 forms a circularized product B1 with expression activity, while the splicing of A2 forms a circularized product B2 with almost no expression activity. According to RNAfold web server (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi), the secondary structure of the circular RNA vector and the mutation of the intron splicing flanking sequence were analyzed. The splicing site A2 of the CVB3-GLuc-pAC vector was mutated to generate an expression vector that is not affected by the IVT temperature. The vectors CVB3-GLuc-pAC-P11 (SEQ ID No. 5), CVB3-GLuc-pAC-P12 (SEQ ID No. 6), CVB3-GLuc-pAC-P13 (SEQ ID No. 7), CCVB3-GLuc-pAC-P14 (SEQ ID No. 8), and CVB3-GLuc-pAC-P15 (SEQ ID No. 9) were designed to perform IVT reactions at different temperature gradients, and reverse transcription and amplification reactions were performed for verification.

[0055] The results are as follows Fig. 6A , Figure 6B , Figure 6CAs shown in the figure, the CVB3-GLuc-pAC-P12 vector was subjected to IVT reaction at different temperatures, and its reverse transcription amplification PCR product was only one, indicating that the vector has only one splicing site and is not easily affected by the IVT temperature. It is a relatively stable in vitro transcription vector. An appropriate amount of circularized RNA product was taken for HEK293 cell transfection experiment. The results are shown in the figure. Figure 7 As shown, CVB3-GLuc-pAC-P12 has a higher expression efficiency than the original vector CVB3-GLuc-pAC, indicating that this point optimization does not affect its expression efficiency.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A circular RNA transcription vector, characterized in that: The invention comprises the following structural elements: external 5' homology arm, ribozyme, internal 5' homology arm, 5' spacer sequence, IRES, multiple cloning site or coding region, 3' spacer sequence, internal 3' homology arm, ribozyme, external 3' homology arm; The internal 5' homology arm is shown as SEQ ID No. 1; the internal 3' homology arm is shown as SEQ ID No. 2; The nucleotide sequence of the circular RNA transcription vector is shown in SEQ ID No.

6.

2. The method for preparing the circular RNA transcription vector according to claim 1, characterized in that: The following steps are involved: The template of the vector is linearized and then subjected to in vitro transcription reaction, followed by circularization catalysis reaction, followed by RNase-R enzyme digestion reaction, and purification to obtain the product.

3. An engineered cell, characterized in that: Obtained by transfection of the circular RNA transcription vector according to claim 1.

4. The engineered cell according to claim 3, characterized in that The cells are HEK293.

5. Use of the circular RNA transcription vector according to claim 1 and the engineered cell according to claim 3 or 4 in genetic engineering and / or protein production.

6. The use according to claim 5, characterized in that: The genetic engineering includes preparing circular RNA expression molecules.

Images