A method for obtaining mouse totipotent stem cells

Abstract

The present invention discloses a method for obtaining mouse pluripotent stem cells, comprising: constructing a vector plasmid for knocking out the Pdzk1 gene; obtaining mouse embryonic stem cells for knocking out the Pdzk1 gene; proving the pluripotency of the stem cells through chimera experiments; and proving the pluripotency of the cells through establishing three stem cell lines of different lineages after self-assembling blastocysts in vitro. The present invention knocks out the Pdzk1 gene in embryonic stem cells, and proves the pluripotency through chimera experiments and in vitro blastocyst-like line building experiments, so as to better promote the research on early embryonic development of mammals.

Description

Technical Field

[0001] The present invention relates to the field of life science technology, and in particular to a method for obtaining mouse pluripotent stem cells. Background Art

[0002] Under natural conditions, mouse embryonic stem cells (ESCs) derived from the inner cell mass (ICM) only have the ability to differentiate into cells of the intraembryonic lineage, and cannot differentiate or develop into cells of the trophoblast (TE) lineage. At present, although a variety of totipotent cell lines have been established, their totipotency varies and there is great heterogeneity. Therefore, it is urgent to develop a new method to quickly obtain totipotent stem cells with good differentiation potential and good uniformity, and to prove them using recognized standards to promote research in the field of early embryonic development. Summary of the invention

[0003] In view of the above situation, in order to overcome the defects of the prior art, the present invention provides a method for obtaining mouse totipotent stem cells, by knocking out the Pdzk1 gene in embryonic stem cells, so that mouse embryonic stem cells acquire totipotency, and verify their totipotency through chimera experiments and blastocyst-like line establishment experiments, so as to better promote the research on early embryonic development of mammals.

[0004] To achieve the above object, the present invention provides the following technical solutions:

[0005] A method for obtaining mouse totipotent stem cells comprises the following steps:

[0006] Step 1: construct a plasmid for knocking out the Pdzk1 gene;

[0007] Step 2: Obtain embryonic stem cells with Pdzk1 gene knockout;

[0008] Step 3: Use chimera experiments and / or in vitro blastocyst-like line establishment experiments to determine the pluripotent embryonic stem cells with the Pdzk1 gene knockout, thereby obtaining mouse pluripotent stem cells.

[0009] Preferably, the Pdzk1 gene in step 1 is a mouse Pdzk1 gene, and the embryonic stem cells are mouse embryonic stem cells.

[0010] Preferably, the step 1 comprises the following steps:

[0011] According to the CRISPOR website, the sgRNA sequence for mouse Pdzk1 knockout was designed and synthesized. After annealing, the sgRNA was connected to the PX458 plasmid recovered by BbsI digestion and transformed. After culture, the competent cells with successful transformation were screened.

[0012] Preferably, the sgRNA sequence for knocking out the mouse Pdzk1 gene is as follows:

[0013] sg1:CCTCCTCAATCACCCGGATC;

[0014] sg2: AATGATAAGAAACCGGGCCC.

[0015] Preferably, the genotype identification primer sequence in step 2 is as follows:

[0016] F: CAGGGCTTCATGCTTCAACTAG;

[0017] R: CAGGGATTCTCAAGTATGCTCCTC.

[0018] Preferably, in the chimeric experiment, 10 Pdzk1 knockout mouse embryonic stem cells are injected into each 4-cell embryo (derived from fertilized eggs).

[0019] Preferably, the in vitro blastocyst-like lineage establishment experiment establishes three lineage-specific stem cell lines, including embryonic stem cells, trophoblast stem cells and primitive endoderm stem cells, which serve as the criterion for judging totipotent stem cells;

[0020] The Pdzk1 knockout embryonic stem cells were seeded into ultra-low adhesion 96-well plates (Corning, 7007) at 300-500 cells per well. After 5 days, blastocyst-like structures were enriched around the aggregated cell clusters. These blastocyst-like structures were then transferred to another well using a mouth pipette under a stereomicroscope, where they further self-assembled to form self-assembled blastocysts.

[0021] The self-assembled blastocysts were seeded on feeder cells and cultured in the corresponding culture medium of embryonic stem cells, trophoblast stem cells and primitive endoderm stem cells, and they could all be detected in immunofluorescence identification.

[0022] Preferably, the embryonic stem cell culture medium formula is: 73% knockout DMEM, supplemented with 2mM Glutamax, 1% 100×NEAA, 15% fetal bovine serum, 1mM sodium pyruvate, 0.11mM β-mercaptoethanol, 1% 100× double antibody, 1000U / mL LIF, 3μM CHIR99021 and 0.2μM PD0325901.

[0023] Trophoblast stem cell culture medium: 70% trophoblast stem cell basal culture medium, 30% conditioned medium, 25ng / ml FGF-4, 1μg / ml Heparin, wherein the trophoblast stem cell basal culture medium comprises: 77% RPMI1640, 20% fetal bovine serum, 2mM Glutamax, 0.11mM β-mercaptoethanol, 1mM sodium pyruvate, 1ml 100× double antibody; the conditioned medium comprises: trophoblast stem cell basal culture medium of feeder cells cultured for 2 days.

[0024] Primitive endoderm stem cell culture medium: 84% RPMI1640, 15% fetal bovine serum, 0.11 mM β-mercaptoethanol, 1% 100× double antibody.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention knocks out the Pdzk1 gene in mouse embryonic stem cells to make embryonic stem cells omnipotent, and proves their omnipotence through chimera experiments and experiments such as establishing a cell line covering three lineages after in vitro self-assembly of blastocysts, so as to better promote the research on early embryonic development of mammals. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0028] Figure 1 construct schematics for plasmids;

[0029] Figure 2 The genotype identification diagram and sequencing results of Pdzk1 knockout subclones;

[0030] Figure 3 White light images of Pdzk1 knockout cells, scale bar 100 μm;

[0031] Figure 4 This is an immunofluorescence identification image of E3.5 chimeric blastocysts formed by Pdzk1 knockout cells, the scale bar is 50 μm;

[0032] Figure 5 White light and fluorescent images of E12.5 chimeric embryos formed by Pdzk1 knockout cells, scale bar is 50 μm;

[0033] Figure 6 This is a white light picture of the self-assembled blastocyst formed by Pdzk1 knockout cells, the scale bar is 100 μm;

[0034] Figure 7White light images of embryonic stem cells, trophoblast stem cells, and primitive endoderm stem cells established by self-assembled blastocysts formed by Pdzk1 knockout cells. The scale bar is 100 μm.

[0035] Figure 8 Immunofluorescence identification images of embryonic stem cells, trophoblast stem cells and primitive endoderm stem cells established by self-assembled blastocysts formed by Pdzk1 knockout cells. The scale bar is 50μm. DETAILED DESCRIPTION

[0036] In the following, only some exemplary embodiments are briefly described. As those skilled in the art will appreciate, the described embodiments may be modified in various ways without departing from the spirit or scope of the present invention. Therefore, the drawings and descriptions are considered to be exemplary and non-restrictive in nature.

[0037] The technical solution of the present invention will be clearly and completely described below in conjunction with the accompanying drawings.

[0038] Materials and methods:

[0039] Construction of Pdzk1 gene knockout plasmid: Two sgRNA sequences for mouse Pdzk1 knockout were designed and synthesized on the CRISPOR website, named sg1 and sg2 respectively; each sgRNA needs to synthesize two complementary single-stranded DNAs, and after annealing, sg1 (obtained by annealing sg1-1 and sg1-2, the two are connected into double strands) and sg2 (obtained by annealing sg2-1 and sg2-2) were respectively reacted with PX458 plasmid recovered by BbsI digestion using T4 ligase at 16°C for 1h to obtain ligation products, which were transformed into 100 μl competent cells, spread on LBA plates, and cultured overnight at 37°C; the next day, single colonies with appropriate size and clear boundaries were picked for sequencing verification.

[0040] The primer information used in this process is as follows:

[0041] Pdzk1 sg1-1:

[0042] CACCGCCTCCTCAATCACCCGGATC

[0043] Pdzk1 sg1-2:

[0044] AAACGATCCGGGTGATTGAGGAGGC

[0045] Pdzk1 sg2-1:

[0046] CACCGAATGATAAGAAACCGGGCCC

[0047] Pdzk1 sg2-2:

[0048] AAACGGGCCCGGTTTCTTATCATTC

[0049] Transfect the Pdzk1 knockout plasmid into mouse embryonic stem cells and perform flow cytometry sorting: Transfect wild-type mouse embryonic stem cells that are growing well: 1x10 6 Each embryonic stem cell was electroporated with 4 μg of Pdzk1 knockout plasmid, using a NEON (Invitrogen) electroporator and electroporation conditions of 1400 V, 3 pulses, and 10 ms. Two days later, the transfected cells were digested and filtered through a 400-mesh cell sieve and sorted using a Beckman MoFlo Astrios EQ ultra-high-speed flow sorter, and subclones of GFP-positive cells were picked for genotyping and sequencing.

[0050] The primer information used in this process is as follows:

[0051] F:CAGGGCTTCATGCTTCAACTAG

[0052] R:CAGGGATTCTCAAGTATGCTCCTC

[0053] Mouse embryonic stem cells with Pdzk1 gene knockout were marked with GFP fluorescent protein gene and injected into chimeras: sexually mature ICR female mice were superovulated and mated with male mice. The female mice with thrombosis on the second day were used to obtain fertilized eggs in the 4-cell embryonic period; 10 embryonic stem cells with Pdzk1 gene knockout were injected into each embryo to form a reconstructed embryo; the reconstructed embryos were identified by immunofluorescence staining when they developed to the blastocyst stage; at the same time, some of the reconstructed embryos were transplanted back into pseudopregnant female mice, and the chimeric fetuses, placentas and yolk sacs were dissected out when they developed to E12.5 (gestational day 12.5), and the distribution of GFP fluorescence was observed.

[0054] Placing embryonic stem cells with Pdzk1 knockout in self-assembling blastocyst culture medium can form a large number of polymers with blastocyst-like structures. Subsequently, the formed blastocyst-like structures are placed in embryonic stem cell culture medium, trophoblast stem cell culture medium and primitive endoderm stem cell culture medium for lineage culture, and embryonic stem cells, trophoblast stem cells and primitive endoderm stem cells can be established respectively. Figure 7 ) and were identified by immunofluorescence staining ( Figure 8 ).

[0055] Every 100 ml embryonic stem cell culture medium: 73 ml knockout DMEM (Gibco, 10829018), added with 2 mM Glutamax (Gibco, 35050061), 1 ml 100×NEAA (Gibco, 11140050), 15 ml fetal bovine serum (HYclone, SH30406.05), 1 mM sodium pyruvate (Sigma, P4562), 0.11 mM β-mercaptoethanol (Sigma, 21985023), 1 ml 100× double antibody (Gibco, 15140122), 1000 U / mL LIF (Sigma, ESG1107), 3 μM CHIR99021 (MCE, HY-10182) and 0.2 μM PD0325901 (MCE, HY-10254).

[0056] Every 100 ml of trophoblast stem cell culture medium: 70 ml of trophoblast stem cell basal culture medium, 30 ml of conditioned medium, 25 ng / ml FGF-4 (MCE, HY-P7014), 1 μg / ml Heparin (MCE, HY-17567A), wherein the trophoblast stem cell basal culture medium comprises: 77% RPMI1640 (Gibco, 61870036), 20% fetal bovine serum (HYclone, SH30406.05), 2 mM Glutamax (Gibco, 35050061), 0.11 mM β-mercaptoethanol (Sigma, 21985023), 1 mM sodium pyruvate (Sigma, P4562), 1 ml 100× double-antibody double-antibody (Gibco, 15140122); the conditioned medium comprises: the trophoblast stem cell basal culture medium of feeder cells cultured for 2 days.

[0057] Each 100 ml of primitive endoderm stem cell culture medium: 84% RPMI1640 (Gibco, 61870036), 15% fetal bovine serum (HYclone, SH30406.05), 0.11 mM β-mercaptoethanol (Sigma, 21985023), 1% 100× double antibody (Gibco, 15140122).

[0058] The principle of plasmid construction is as follows Figure 1 Shown: Two sgRNAs were designed at exons 1 and 2 of the Pdzk1 gene to improve gene knockout efficiency.

[0059] Cell identification: Extract genomic DNA from the sorted cells and perform genotype identification PCR and sequencing using patented primers. Figure 2The genotype identification diagram of the Pdzk1 knockout subclone and the sequencing results of the Pdzk1 knockout cell line are shown in Figure 2. Figure 2 In the figure, WT is wild type, 1#, 2#, and 3# represent three different subclone cells randomly selected. It can be seen from the figure that the three randomly selected cells can express well with a high success rate. Figure 3 This is a white light image of Pdzk1 knockout embryonic stem cells. The sgRNA sequence selected in this example can be expressed more accurately.

[0060] The experimental process is:

[0061] 1) Superovulation: 8-week-old ICR female mice were superovulated by intraperitoneal injection of 5 IU of PMSG at 5 pm (lighting time is 8 am to 8 pm), and 5 IU of hCG was injected again 48 hours later. They were housed together with sexually mature and healthy male mice. The vaginal plug was checked the next morning (0.5 dpc), and the female mice with vaginal plug were selected for collection of fertilized eggs.

[0062] 2) Collection of fertilized eggs: Collect 2-cells at 1.5 dpc. Prepare clean scissors and forceps. Kill the mouse by cervical dislocation, cut open the mouse abdomen, open the abdominal cavity, find the uterus, clamp the upper part of the uterine horn with forceps and pull it out of the body, and remove the oviduct with small scissors. Place the separated oviduct in a clean 35 mm culture dish. Use a sterile syringe to flush out the 2-cell embryos in the preheated M2 operating solution. Use a mouth pipette to transfer the collected 2-cell embryos to KSOM culture medium for further culture.

[0063] 3) In vitro culture of fertilized eggs: One day before culturing fertilized eggs, KSOM was used to prepare culture droplets and incubate at 37°C, 5% CO 2 The culture medium was balanced in the incubator. The 2-cell embryos were cultured until the next day to obtain 4-cells for the production of chimeric embryos.

[0064] 4) Preparation of chimeric embryos: 10 PDZK1 knockout mouse embryonic stem cells were injected into each 4-cell embryo to obtain reconstructed embryos. A portion of the reconstructed embryos were cultured in vitro to the E3.5 blastocyst stage for immunofluorescence staining. Figure 4 This is an immunofluorescence identification image of E3.5 chimeric blastocysts formed by Pdzk1 knockout cells. It can be seen from the figure that chimeras can be detected at the fetal, yolk sac and placental levels. Another part was transplanted into the oviduct of a 0.5-day pseudopregnant mouse, and the transplanted mouse was continued to be raised until E12.5 days, and the fetus, placenta and yolk sac of E12.5 days were observed. Figure 5 White light and fluorescent images of E12.5 chimeric embryos formed by Pdzk1 knockout cells. Figure 5 It can be seen that the E12.5 chimera in this example can be detected at the fetal, yolk sac and placenta levels.

[0065] 5) Pdzk1 knockout subclones form self-assembled blastocysts: Pdzk1 knockout embryonic stem cells were seeded into ultra-low adhesion 96-well plates (Corning, 7007) at 300-500 cells per well. After 5 days, blastocyst-like structures were enriched around the aggregated cell clusters. These blastocyst-like structures were then transferred to another well using a mouth pipette under a stereomicroscope. They further self-assembled to form self-assembled blastocysts ( Figure 6 ).

[0066] Every 50 ml of self-assembling blastocyst culture medium: 25% TSC basal culture medium, 25% N2B27 basal culture medium, 50% KSOM culture medium, 2μM Y-27632 (MSE, HY-10071), 12.5ng / ml FGF4 (PeproTech, 10031), 0.5ng / ml heparin sodium (Millipore, 375095), 3μM CHIR99021 (MCE, HY-10182), 5ng / ml BMP4 (PeproTech, 123005ET), 0.5μM A83-01 (MCE, HY-10432).

[0067] 6) Establishment of three-lineage stem cell lines by self-assembling blastocysts:

[0068] Embryonic stem cell line (iBESC): Self-assembled blastocysts are seeded on feeder cells and cultured in embryonic stem cell culture medium. After 4-5 days, they are digested with 0.05% Trypsin-EDTA (Gibco, 25300062) and transferred to new feeders. Embryonic stem cell clones can be observed after 3 days of continuous culture. Figure 7 ) and immunofluorescence identification ( Figure 8 ).

[0069] Trophoblast stem cell line (iBTSC): self-assembled blastocysts are seeded on feeders and cultured in trophoblast stem cell culture medium. After 4-5 days, they are digested with 0.05% Trypsin-EDTA and transferred to new feeders. After 7 days of culture, trophoblast stem cell clones can be observed ( Figure 7 ) and immunofluorescence identification ( Figure 8 ).

[0070] Primitive endoderm stem cell line: self-assembled blastocysts are seeded on feeders and cultured in primitive endoderm stem cell culture medium. After 4-5 days, they are digested with 0.05% Trypsin-EDTA and transferred to new feeders. After one week of culture, primitive endoderm stem cells can be observed. Figure 7 ) and immunofluorescence identification ( Figure 8 ).from Figure 7 and Figure 8 It can be seen that in vitro self-assembly can express the corresponding lineage, indicating its omnipotence effect.

[0071] The chimera experiment and the establishment of three different lineages of stem cell lines after in vitro self-assembly of blastocysts prove that the stem cells have omnipotence. The present invention knocks out the Pdzk1 gene in embryonic stem cells and proves their omnipotence through chimera experiments and in vitro blastocyst-like line building experiments.

[0072] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for obtaining mouse totipotent stem cells, characterized in that: The steps include: Step 1: construct a plasmid for knocking out the Pdzk1 gene; Step 2: Obtain embryonic stem cells with Pdzk1 gene knockout; Step 3: Using chimera experiments and / or in vitro blastocyst-like line establishment experiments to determine the pluripotent embryonic stem cells with the Pdzk1 gene knockout, thereby obtaining mouse pluripotent stem cells; The Pdzk1 gene in step 1 is the mouse Pdzk1 gene, and the sgRNA sequence for knocking out the mouse Pdzk1 gene is: sg1:CCTCCTCAATCACCCGGATC; sg2: AATGATAAGAAACCGGGCCC.

2. The method for obtaining mouse pluripotent stem cells according to claim 1, characterized in that: The embryonic stem cells are mouse embryonic stem cells.

3. The method for obtaining mouse pluripotent stem cells according to claim 1, characterized in that: The process of performing chimera experiment in step 3 is: 1) Superovulation: 8-week-old ICR female mice were superovulated by intraperitoneal injection of 5 IU of PMSG at 5 pm, and 5 IU of hCG was injected again 48 hours later. The female mice were housed together with sexually mature and strong male mice. The vaginal plug was checked the next morning, and the female mice with vaginal plug were selected for collection of fertilized eggs. 2) Collection of fertilized eggs: Collect 2-cells at 1.5 dpc, prepare clean scissors and forceps, kill mice by cervical dislocation, cut open the abdomen of the mice, open the abdominal cavity, find the uterus, clamp the upper part of the uterine horn with forceps and pull it out of the body, and remove the oviduct with small scissors; place the separated oviduct in a clean 35 mm culture dish; flush out the 2-cell embryos with a sterile syringe in the preheated M2 operating solution; transfer the collected 2-cell embryos to KSOM culture medium with a mouth pipette for further culture; 3) In vitro culture of fertilized eggs: one day before culturing fertilized eggs, culture droplets were prepared with KSOM and the culture medium was balanced in a 37°C, 5% CO2 incubator; 2-cell embryos were cultured until the next day to obtain 4-cells for the preparation of chimeric embryos; 4) Preparation of chimeric embryos: 10 PDZK1 knockout mouse embryonic stem cells were injected into each 4-cell embryo to obtain reconstructed embryos. One part of the reconstructed embryos was cultured in vitro to the E3.5 blastocyst stage for immunofluorescence staining, and the other part was transplanted into the oviduct of 0.5-day pseudopregnant female mice. The transplanted female mice were continued to be raised until E12.5 days, and the fetus, placenta and yolk sac of E12.5 days were observed; The reconstructed embryos were fluorescently detected at the fetal, yolk sac, and placental levels.

4. The method for obtaining mouse pluripotent stem cells according to claim 1, characterized in that: In vitro blastocyst-like cell establishment experiments established three lineage-specific stem cell lines, including embryonic stem cells, trophoblast stem cells, and primitive endoderm stem cells, which serve as the criteria for judging totipotent stem cells; The Pdzk1 knockout embryonic stem cells were seeded into ultra-low adhesion 96-well plates at 300-500 cells per well; after 5 days, blastocyst-like structures were enriched around the aggregated cell clusters, and then these blastocyst-like structures were transferred to another well using a mouth pipette under a stereomicroscope, and further self-assembled to form self-assembled blastocysts; The self-assembled blastocysts were seeded on feeder cells and cultured in the corresponding culture medium of embryonic stem cells, trophoblast stem cells and primitive endoderm stem cells, and they could all be detected in immunofluorescence identification.

5. A mouse totipotent stem cell obtained by the method according to any one of claims 1 to 4.

Images