Application of anti-Mullerian hormone in the prediction, diagnosis and / or treatment of liver cancer

Abstract

The present invention belongs to the field of biomedicine and relates to the use of anti-Mullerian hormone (AMH) in the prediction, diagnosis, and / or treatment of liver cancer. Through experiments, the present invention discovered that AMH is a ferroptosis inhibitor that promotes the development of liver cancer. AMH can serve not only as a biomarker for predicting and / or detecting liver cancer but also as a potential new target for liver cancer treatment. AMH can also synergize with ferroptosis inducers to reduce the cell activity of liver cancer tissue, thereby achieving liver cancer treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology and relates to the application of anti-Mullerian hormone in predicting, diagnosing and / or treating liver cancer. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Chronic liver diseases (such as fatty liver, chronic hepatitis, cirrhosis, etc.) are closely related to the occurrence and development of liver cancer, but the disease process is still unclear. Although excessive liver cell death, necroinflammation and compensatory proliferation play an important role in the occurrence and development of liver cancer, there is still controversy on the type and mechanism of promoting inflammation and liver cancer cell death. Ferroptosis is an iron-dependent programmed cell death method. Under the action of divalent iron or esteroxygenase, it catalyzes the lipid peroxidation of highly expressed unsaturated fatty acids on the cell membrane and induces cell death. Ferroptosis is involved in the occurrence and development of many liver diseases. In the process of liver disease-liver cancer, the effects of ferroptosis on the progression of liver disease in normal cells and liver cancer cells are different, but the specific regulatory mechanism of ferroptosis in normal liver cells and liver cancer cells is still unclear. Summary of the Invention

[0004] The present invention infects p53 functional deficient liver organoids through CRISPR-Cas9 whole genome library, and sequences them under Erastin-induced ferroptosis screening conditions, thereby discovering and verifying a new ferroptosis inhibitor - the anti-Müllerian hormone gene. Anti-Müllerian hormone (AMH) is a glycoprotein composed of 560 amino acids and is a member of the transforming growth factor-β superfamily. AMH is secreted by male supporting cells and female granulosa cells, and regulates the function of male testicular interstitial cells and female follicular development by binding to its receptors. Since AMH levels are not affected by the physiological cycle, its content is relatively stable in mature individuals. AMH, mainly as a hormone related to female reproductive function, can reflect ovarian reserve capacity and is an important marker for diagnosing diseases such as ovarian granulosa cell carcinoma and polycystic ovary syndrome. The present invention further preliminarily found through TCGA database analysis and clinical liver cancer patient sample testing that AMH is significantly highly expressed in liver cancer patients. It can provide new targets for p53 target drug development and liver cancer treatment that resists ferroptosis. At the same time, the present invention also unexpectedly discovered that knocking down the expression of anti-Mullerian hormone gene in the liver can significantly increase the sensitivity of liver cancer cells to Erastin-induced ferroptosis, reduce the activity of liver cancer cells, and achieve the treatment of liver cancer.

[0005] Based on the above research results, the purpose of the present invention is to provide the use of anti-Mullerian hormone in the prediction, diagnosis and / or treatment of liver cancer.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] In a first aspect, a substance for detecting an anti-Mullerian hormone encoding gene or the level of anti-Mullerian hormone expressed is used in the preparation of a product for predicting and / or detecting the progression of liver cancer.

[0008] The product for predicting and / or detecting liver cancer progression can predict and / or detect liver cancer progression by detecting the anti-Mullerian hormone encoding gene or the level of anti-Mullerian hormone expression. Research has shown that anti-Mullerian hormone is significantly overexpressed in liver cancer patients, and therefore can be used as a biomarker for predicting and / or detecting liver cancer.

[0009] In some embodiments, the product for predicting and / or detecting liver cancer progression can detect the transcription of the anti-Mullerian hormone-encoding gene in a sample using high-throughput sequencing methods and / or quantitative PCR methods and / or probe hybridization methods. Specifically, methods include, but are not limited to, liquid phase hybridization, Northern hybridization, miRNA expression microarray, ribozyme protection analysis, RAKE method, and in situ hybridization to detect the transcription of the anti-Mullerian hormone-encoding gene in a sample.

[0010] In some embodiments, the product for predicting and / or detecting liver cancer progression is a substance that detects anti-Mullerian hormone (AMH) expression in a sample based on an immunoassay. Specifically, the method includes, but is not limited to, ELISA, colloidal gold test strips, protein chips, and single-cell microfluidics chips for detecting AMH expression in a sample.

[0011] In one or more embodiments, the sample is liver cancer tissue. More specifically, the liver cancer tissue is derived from a human or a mammal. The mammal includes mice, rats, guinea pigs, rabbits, dogs, pigs, orangutans, etc.

[0012] In some embodiments, the product for predicting and / or detecting the progression of liver cancer is a kit.

[0013] In the second aspect, a substance that inhibits the anti-Mullerian hormone encoding gene and its expression product or reduces the activity of anti-Mullerian hormone is used in the preparation of a product for treating liver cancer or inhibiting liver cancer resistance.

[0014] The product for treating liver cancer or inhibiting liver cancer drug resistance according to the present invention may be a drug or an experimental reagent, and the experimental reagent may be used for basic research.

[0015] In the present invention, the drug resistance of liver cancer is mainly manifested as resistance to ferroptosis, specifically resistance to ferroptosis inducers, including but not limited to Erastin, RSL3, etc.

[0016] In some embodiments, substances that inhibit the anti-Mullerian hormone encoding gene and its expression product or reduce the activity of anti-Mullerian hormone include, but are not limited to, RNA interference molecules or antisense oligonucleotides, small molecule inhibitors, siRNA (as shown in SEQ ID NO.3), shRNA, substances for implementing lentiviral infection or gene knockout, and specific antibodies against the anti-Mullerian hormone itself or its upstream and downstream molecules (such as anti-Mullerian hormone antibodies). Specifically, the siRNA is shown in SEQ ID NO.3. Specifically, the substance for implementing gene knockout is a primer set, and the primer sets are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0017] In a third aspect, a composition includes a substance that inhibits the anti-Mullerian hormone encoding gene and its expression product or reduces the activity of anti-Mullerian hormone, and a ferroptosis inducer.

[0018] In some embodiments, the ferroptosis inducer is Erastin.

[0019] In some embodiments, a pharmaceutically acceptable excipient and / or a pharmaceutically acceptable carrier is also included.

[0020] In one or more embodiments, the pharmaceutical excipients include, but are not limited to, binders, stabilizers, solubilizers, buffers, preservatives, and the like.

[0021] In one or more embodiments, the pharmaceutical carrier includes but is not limited to serum protein, lecithin, aluminum stearate, aluminum oxide, etc.

[0022] A fourth aspect is a use of the above composition in the preparation of a drug for treating liver cancer.

[0023] The beneficial effects of the present invention are:

[0024] The present invention reveals that anti-Mullerian hormone is a key gene for ferroptosis resistance in TP53KO liver organoids through whole-genome CRISPR screening; then, by detecting cell viability, cell death rate, expression of C11 oxidized ferroptosis marker 4-HNE, etc., the resistance effect of anti-Mullerian hormone in inducing ferroptosis is demonstrated; protein immunoblotting, immunohistochemistry and database analysis are used to illustrate that AMH promotes tumor occurrence; thus, it is discovered that anti-Mullerian hormone is an ferroptosis inhibitor that promotes the occurrence of liver cancer, which can not only be used as a biomarker for predicting and / or detecting liver cancer, but also as a potential new target for liver cancer treatment. It can also enhance the sensitivity of ferroptosis inducers and cooperate with them to reduce the cell activity of liver cancer tissue, thereby achieving the treatment of liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0026] Figure 1 This is the result diagram of the whole-genome CRISPR screening of key genes inhibiting ferroptosis in TP53KO organoids in an embodiment of the present invention; A is the screening strategy of the CRISPR whole-genome library; B is the verification of the ferroptosis induction efficiency and p53 knockout efficiency; C is the bright field image of the organoid after ferroptosis induction, D is the RRAscore distribution diagram of the screened genes in the T14 group organoids compared with the T0 group organoids, among which the RRAscore of AMH is the top 20, the horizontal axis is the readcounts of the gene, and the vertical axis is the corresponding RRAscore; Figure E is the specific value of the score.

[0027] Figure 2 : It is a result diagram of AMH inhibiting Erastin-induced ferroptosis in an embodiment of the present invention; A is a cell activity bar graph after AMH knockdown and Erastin induction, showing that the cell activity decreased after AMH knockdown and Erastin induction; B and C are cell survival rate and mortality rate bar graphs after AMH knockdown and Erastin induction, showing that the cell mortality rate increased and the survival rate decreased after AMH knockdown and Erastin induction; D is a cell fluorescence image before and after AMH knockout and Erastin induction, showing that after AMH knockout, the change in the oxidation state / reduction state of C11 showed an increase in the ratio; E and F are cell death fluorescence display and mortality rate statistical bar graphs before and after AMH knockout and Erastin induction, showing that after AMH knockout and Erastin induction, the cell mortality rate statistics showed an increase.

[0028] Figure 3Figure 1 is a result diagram of AMH promoting tumorigenesis in an embodiment of the present invention; A is a TCGA database analysis diagram, showing that the expression of AMH in human liver cancer is higher than that in the healthy group; B is a protein immunoblotting detection result diagram of AMH in clinical samples, showing that in paired tissue pairs, AMH is highly expressed in tumors; C is an immunohistochemistry diagram of AMH in clinical samples, showing that in paired tissue pairs, AMH is highly expressed in tumors; D is an analysis diagram of male and female liver cancer patients and different disease courses in the TCGA database, showing that the expression of AMH in male and female liver cancer is higher than that in the healthy group, and is even higher in samples with pathological grades 1-2. DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0030] Example

[0031] Experimental methods:

[0032] (1) CRISPR-Cas9 whole-genome library screening and analysis

[0033] Construct and expand WT and p53 KO liver organoids stably expressing Cas9, and prepare a total number of cells that can be expanded to a viral titer greater than 300 times (approximately (3-5) × 10 7 Organoids were infected with lentivirus containing the packaged CRISPR-PoolTMKOUT mouse genome-wide knockout library (20,611 genes, 6 gRNAs / gene). At T0, 1 / 2 of the cells were collected as a control group, and the other 1 / 2 of the cells were induced with 10 μM Erastin for 14-21 days. Organoids were collected at T14 and genomic DNA was extracted. PCR amplification of the sgRNA sequence was performed, and the amplified products were sequenced by Illumina Hiseq. The RRA algorithm of the MAGeCK bioinformatics software was used to enrich the significantly enriched and significantly reduced top genes as candidate new regulators of ferroptosis, and the effect of regulatory genes on ferroptosis was preliminarily verified.

[0034] (2) Construction of AMH low-expressing cell lines

[0035] p53 KO liver organoids were infected with siRNA or sgRNA to generate AMH knockdown cell lines. The sgRNA knockdown sequence (F): GAGTCATCCGCGTGAAACAG, as shown in SEQ ID NO. 1; the sgRNA knockdown sequence (R): CTGTTTCACGCGGATGACTC, as shown in SEQ ID NO. 2; and the siAMH sequence: CGCACCACGTGCCCAACAT, as shown in SEQ ID NO. 3. After Puro resistance screening, knockdown and overexpression efficiency were determined by Western blot.

[0036] (3) Detection of AMH-regulated ferroptosis indicators

[0037] AMH knockdown organoids were treated with the ferroptosis inducer Erastin or the ferroptosis inhibitor Fer1, with the DMSO-treated group serving as the control. After 48 hours of treatment, ferroptosis markers were assessed, including: a. ATP activity and organoid viability using CellTiter-Glo; b. SYTOX fluorescent staining to measure cell death and mortality; c. Detection of the ratio of oxidation and reduction rates in organoids using the fluorescent dye C11; and d. Changes in the ferroptosis intermediate 4-HNE.

[0038] (4) Analysis of AMH expression in clinical samples of liver cancer

[0039] Data from paired HCC and adjacent adjacent tumors, as well as HCC samples of varying grades, were downloaded from the TCGA database. AMH expression and downstream regulatory signaling pathways were analyzed, and correlation maps were constructed. RNA, protein, and pathological sections were collected from HCC surgical patients. qRT-PCR and Western blot analysis was performed on AMH expression in paired tumor and adjacent adjacent tumors, as well as HCC samples of varying grades.

[0040] Analysis and results:

[0041] This example reveals that AMH is a key gene that inhibits ferroptosis in TP53KO organoids through genome-wide CRISPR screening. Figure 1 On this basis, the detection of AMH-regulated ferroptosis indicators in this example found that the cell activity decreased after AMH knockdown and Erastin induction, as shown in Figure 2. Figure 2 As shown in A; after AMH knockdown and Erastin induction, the cell death rate increased and the survival rate decreased, as shown in Figure 2 B and Figure 2 As shown in C; after knocking out AMH, the changes in the oxidation state / reduction state of C11 showed an increase in the ratio, as shown in Figure 2 As shown in D; after AMH knockout and Erastin induction, the cell death rate statistics showed an increase, as shown in Figure 2 E and Figure 2 As shown in F. This indicates that AMH inhibits erastin-induced ferroptosis, and knocking down anti-Mullerian hormone gene expression in the liver can significantly increase the sensitivity of liver cancer cells to erastin-induced ferroptosis.

[0042] Analysis of the TCGA database showed that the expression of AMH in human HCC was higher than that in healthy controls. Figure 3 As shown in A. Western blotting of AMH in clinical samples showed that AMH was highly expressed in tumors in paired tissue pairs, as shown in Figure 3 As shown in B. Figure 3 C shows that AMH is highly expressed in tumors in paired tissue pairs. The results of the TCGA database analysis of male and female liver cancer patients and different disease courses showed that AMH expression in male and female liver cancer was higher than that in the healthy group, and was even higher in samples with pathological grades 1-2, such as Figure 3 As shown in D.

[0043] In this example, a p53 functionally deficient liver organoid was infected with a CRISPR-Cas9 whole genome library and sequenced under Erastin-induced ferroptosis screening conditions to discover and verify a new ferroptosis inhibitor, the anti-Mullerian hormone gene. Further analysis of the TCGA database and detection of clinical liver cancer patient samples preliminarily revealed that AMH was significantly highly expressed in liver cancer patients. This can provide a new target for the development of p53-targeted drugs and the treatment of liver cancer resistant to ferroptosis. At the same time, the present invention also unexpectedly discovered that knocking down the expression of the anti-Mullerian hormone gene in the liver can significantly increase the sensitivity of liver cancer cells to Erastin-induced ferroptosis, reduce the activity of liver cancer cells, and achieve the treatment of liver cancer.

[0044] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. Use of a substance for detecting an anti-Mullerian hormone encoding gene or the level of anti-Mullerian hormone expressed in the preparation of a product for detecting liver cancer.

2. Use of the substance for detecting the anti-Mullerian hormone encoding gene or expressing the anti-Mullerian hormone level according to claim 1 in the preparation of a product for detecting liver cancer, characterized in that: The product for detecting liver cancer can detect the transcription of the anti-Mullerian hormone encoding gene in a sample by a high-throughput sequencing method and / or a quantitative PCR method and / or a probe hybridization method.

3. Use of the substance for detecting the anti-Mullerian hormone encoding gene or expressing the anti-Mullerian hormone level according to claim 2 in the preparation of a product for detecting liver cancer, characterized in that: The sample is liver cancer tissue.

4. Use of the substance for detecting the anti-Mullerian hormone encoding gene or expressing the anti-Mullerian hormone level according to claim 1 in the preparation of a product for detecting liver cancer, characterized in that: The product for detecting liver cancer is a kit.

5. Use of a substance that inhibits the anti-Mullerian hormone encoding gene and its expression product or reduces the activity of anti-Mullerian hormone in the preparation of a product for treating liver cancer; The substance that inhibits the anti-Mullerian hormone encoding gene and its expression product or reduces the activity of the anti-Mullerian hormone is siRNA or sgRNA targeting the anti-Mullerian hormone, and a ferroptosis inducer; The nucleotide sequence of the sgRNA is shown in SEQ ID NO.1-2; the nucleotide sequence of the siRNA is shown in SEQ ID NO.3; The ferroptosis inducer is Erastin.

6. A composition characterized in that: These include substances that inhibit anti-Mullerian hormone encoding genes and their expression products or reduce the activity of anti-Mullerian hormone, as well as ferroptosis inducers; The substance that inhibits the anti-Mullerian hormone encoding gene and its expression product or reduces the activity of anti-Mullerian hormone is an siRNA or sgRNA targeting anti-Mullerian hormone, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.1-2; the nucleotide sequence of the siRNA is shown in SEQ ID NO.3; The ferroptosis inducer is Erastin.

7. The composition according to claim 6, wherein Also included are pharmaceutically acceptable excipients and / or pharmaceutically acceptable carriers.

8. Use of the composition according to any one of claims 6 to 7 in the preparation of a medicament for treating liver cancer.

Images