Drought-resistant gene msERF1B of alfalfa and application thereof
By cloning and verifying the alfalfa drought-resistant gene MsERF1B, constructing a recombinant vector and verifying its function in yeast and Arabidopsis, the problem of insufficient drought resistance of alfalfa was solved, and the drought resistance and growth ability of alfalfa were improved.
Patent Information
- Application Number
- CN202410604372.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-15
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-05-15
AI Technical Summary
The existing technology has insufficient drought resistance of alfalfa, which affects its yield and quality, and lacks effective drought-resistant gene resources.
The alfalfa drought-resistant gene MsERF1B was cloned and verified, a recombinant vector was constructed and its function of improving drought resistance was verified in yeast and Arabidopsis, and the drought resistance of alfalfa was improved through genetic engineering.
It improves the drought resistance of yeast and plants, promotes the growth and survival of alfalfa under drought stress, and provides germplasm materials with strong drought resistance.
Smart Images

Figure CN118406692B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of plant genetic engineering, and in particular to a drought-resistant gene MsERF1B of Medicago sativa and application thereof. BACKGROUND
[0002] Drought is an important abiotic stress factor limiting the growth and development and production of crops. In recent years, with global warming, the precipitation pattern has been changing, and extreme weather such as drought has been occurring frequently. Therefore, it is particularly important to breed crop varieties that are suitable for survival and drought resistance.
[0003] Medicago sativa is a high-quality perennial legume forage, which is known as the "king of forage" due to its high yield, rich nutrition, good palatability, strong adaptability and other characteristics. However, drought stress in the northwest region seriously affects the yield and quality of alfalfa, and restricts the high-quality development of animal husbandry. Therefore, using modern biotechnology to mine drought-resistant genes of alfalfa and study their regulation mechanism undoubtedly has important significance for accelerating the breeding of new drought-resistant alfalfa varieties.
[0004] Ethylene-responsive factors (ERFs) are a class of transcription factors unique to plants, which play an important role in plant growth and development and stress response. ERF belongs to the AP2 / ERF transcription factor superfamily, which only contains a conserved AP2 domain, which can bind to the GCC-box of the downstream gene promoter, and plays an important regulatory role in plant response to abiotic stress. The function of ERF genes in Arabidopsis, rice, tomato, wheat and other plants has been reported, but the function and application of Medicago sativa ERF gene (MsERF1B) have not been reported. SUMMARY
[0005] In view of the above shortcomings in the prior art, the purpose of the present application is to provide a drought-resistant gene MsERF1B of Medicago sativa and application thereof, which provides an important genetic resource for breeding alfalfa with strong drought resistance.
[0006] In order to achieve the above-mentioned purpose of the application, the technical scheme adopted by the present application is as follows:
[0007] In the first aspect, a drought-resistant gene MsERF1B of Medicago sativa is provided, and the nucleotide sequence of the coding region is shown in SEQ ID NO. 1.
[0008] In the second aspect, a protein encoded by the drought-resistant gene MsERF1B of Medicago sativa is provided, and the amino acid sequence is shown in SEQ ID NO. 2.
[0009] In the third aspect, a recombinant vector containing the drought-resistant gene MsERF1B of Medicago sativa is provided.
[0010] In a fourth aspect, a recombinant engineering bacterium containing a recombinant vector of the alfalfa drought-resistant gene MsERF1B is provided.
[0011] In a fifth aspect, an application of the alfalfa drought-resistant gene MsERF1B in improving the drought resistance of yeast is provided.
[0012] In a sixth aspect, an application of the alfalfa drought-resistant gene MsERF1B in improving the drought resistance of transgenic plants is provided.
[0013] The present application has the following beneficial effects:
[0014] The present application clones the MsERF1B gene related to drought resistance from alfalfa, constructs a recombinant vector of the MsERF1B gene, and verifies the function of the MsERF1B gene in improving the drought resistance of yeast and plants in yeast and Arabidopsis thaliana, and analyzes the response of MsERF1B in alfalfa drought stress, so that the present application can be used for improving the drought resistance of alfalfa and creating alfalfa germplasm materials with strong drought resistance. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 PCR amplification diagram of the coding region sequence of the MsERF1B gene;
[0016] Figure 2 Coding region sequence of the MsERF1B gene of alfalfa and protein structure domain;
[0017] Figure 3 Sequence alignment of the MsERF1B protein and the ERF1B protein of other legume plants;
[0018] Figure 4 Evolutionary tree of the MsERF1B protein and the ERF1B protein of other legume plants;
[0019] Figure 5 Relative expression amount of the MsERF1B gene in alfalfa under drought stress;
[0020] Figure 6 Tolerance phenotype of the MsERF1B transgenic yeast under drought stress;
[0021] Figure 7 RT-PCR identification of the MsERF1B transgenic Arabidopsis thaliana positive seedlings;
[0022] Figure 8 Germination rate of the MsERF1B transgenic Arabidopsis thaliana under drought stress;
[0023] Figure 9 Root length change of the MsERF1B transgenic Arabidopsis thaliana under drought stress;
[0024] Figure 10 Survival rate statistics of MsERF1B transgenic Arabidopsis under drought stress;
[0025] Figure 11 Physiological index changes of MsERF1B transgenic Arabidopsis under drought stress. DETAILED DESCRIPTION
[0026] The specific embodiments of the present application are described below to facilitate the understanding of the present application for those skilled in the art, but it should be clear that the present application is not limited to the scope of the specific embodiments, and for those skilled in the art, it is obvious that various changes are within the spirit and scope of the present application defined and determined by the appended claims, and all the inventions utilizing the concept of the present application are within the scope of protection.
[0027] Example 1: Cloning of Medicago sativa MsERF1B gene
[0028] 1. Using the RNA kit to extract total RNA from Medicago sativa 'Zhongma No. 1' leaf, and using the reverse transcription kit to reverse transcribe the extracted RNA into cDNA, which is stored at -20℃ for standby use.
[0029] 2. Screening Medicago sativa MsERF1B gene from transcriptome data, using full genome database to obtain its full-length sequence, and designing MsERF1B gene amplification specific primers through Primer 5.0 software:
[0030] MsERF1B-F: 5'-ATGCTTCTATATGGCATGATAAC-3'
[0031] MsERF1B-R: 5'-TCACCAAGGATTTTGATTGTCAT-3'
[0032] 3. Using the above extracted cDNA as a template, and using MsERF1B-F / R as primers for PCR amplification, and performing gel electrophoresis on the amplified product (( Figure 1 ), and after the band size is correct, connecting it to the pMD18-T vector, then performing E. coli transformation and sending for sequencing, and finally identifying the nucleotide sequence and the encoded amino acid sequence of Medicago sativa MsERF1B gene. The full-length of MsERF1B gene is 516 bp, encoding 171 amino acids. Analysis of the amino acid sequence in NCBI found that MsERF1B has an AP2 conserved domain ( Figure 2 ), and has a high homology with ERF1B protein of other plants ( Figure 3 ), Figure 4 Evolutionary tree of MsERF1B and proteins of other species.
[0033] The nucleotide sequence of the obtained alfalfa drought-resistant gene MsERF1B is (5'→3'):
[0034] atgcttctat atggcatgat aacttcatca ccacaagaac aaacccttag caaaagtagcaatgaaaaaacaacaaagaa caacaaagat aagaaccaca aatcttatcg aggcgttcga cgtagaccatgggggaaatttgcagcagaa ataagggatt caactagaca tggcataagg gtatggttag gaacatttgatagtgctgaagcagcagcac tagcttatga tcaagctgct ttttcaatga gaggttcagc tgcaacacttaattttccag ttgaaaaggttaaggaatca cttagggaca tgaattatgt gttgtctaat gataatgagtgttcacctgt tattgctttg aagagaaagcattctatgaa acgtaaaatg gatgaaaaga agaagaaacatgacacagat gttaggatag ataatttggttgtgtttgaa gatcttggtg ctgattattt ggaacaattgttgatgtctt ctgatgaca atcaaaatcc ttggtga.
[0035] The amino acid sequence coded by the gene is:
[0036] Met Leu Leu Tyr Gly Met lie Thr Ser Ser Pro Gin Glu Gin Thr Leu Ser Lys Ser Ser Asn Glu Lys Thr Thr Lys Asn Asn Lys Asp Lys Asn His Lys Ser Tyr Arg Gly Val Arg Arg Arg Pro Trp Gly Lys Phe Ala Ala Glu lie Arg Asp Ser Thr Arg His Gly lie Arg Val Trp Leu Gly Thr Phe Asp Ser Ala Glu Ala Ala Ala Leu Ala Tyr Asp Gin Ala Ala Phe Ser Met Arg Gly Ser Ala Ala Thr Leu Asn Phe Pro Val Glu Lys Val Lys Glu Ser Leu Arg Asp Met Asn Tyr Val Leu Ser Asn Asp Asn Glu Cys Ser Pro Val lie Ala Leu Lys Arg Lys His Ser Met Lys Arg Lys Met Asp Glu Lys Lys Lys Lys His Asp Thr Asp Val Arg lie Asp Asn Leu Val Val Phe Glu Asp Leu Gly Ala Asp Tyr Leu Glu Gin Leu Leu Met Ser Ser Asp Asp Asn Gin Asn Pro Trp.
[0037] Example 2: Response of Medicago sativa MsERFlB gene to drought stress
[0038] 1. The seedlings of Medicago sativa (Zhongmo No. 1) were cultured at 25 °C / 16 h light / 8 h dark for about one month, and then the seedlings were treated with 20% PEG-6000. The leaf samples were collected at 0, 2, 4, 8 and 12 h, respectively, and quickly frozen in liquid nitrogen, and stored at -80 °C for later use.
[0039] 2, Extract the RNA of the above sample and reverse transcribe it into cDNA, design the real-time fluorescent quantitative primer qMsERF1B-F / R of MsERF1B gene in Primer-blast of NCBI, synthesize the primer of the internal reference gene Msactin at the same time, and then use the American Bio-RAD CFX Connet quantitative instrument to detect the expression amount of MsERF1B gene under drought stress. The fluorescent quantitative primer is as follows:
[0040] qMsERF1B-F: 5'-CTTATCGAGGCGTTCGACGTA-3'
[0041] qMsERF1B-R: 5'-TGTTGCAGCTGAACCTCTCA-3'
[0042] Msactin-F: 5'-TTTGAGACTTTCAATGTGCCCGCC-3'
[0043] Msactin-R: 5'-TAGCATGTGGGAGTGCATAACCCT-3'
[0044] 3, The relative expression amount of MsERF1B gene is calculated by 2 -△△CT Msactin as the internal reference gene. The quantitative result shows that MsERF1B gene is obviously induced at 2 h, reaches the maximum value at 8 h Figure 5 , indicating that MsERF1B gene actively responds to drought stress in alfalfa.
[0045] Example 3: Drought resistance function verification of MsERF1B gene in yeast
[0046] 1, In order to preliminarily identify the function of MsERF1B gene, the CDS sequence of MsERF1B gene is cloned by using pYES2-MsERF1B-F / R as primer, and then it is connected to pYES2 vector by homologous arm recombination method by using ClonExpress MultiS OneStep Cloning Kit reagent kit of Nuoyuan Biological Company, transformed into Escherichia coli and detected by using vector universal primer pYES2-F / R, and the recombinant vector pYES2-MsERF1B is obtained after sequencing. The primer sequences used are as follows:
[0047] pYES2-MsERF1B-F:
[0048] 5'-CTTGGTACCGAGCTCGGATCCATGCTTCTATATGGCATGATAAC-3'
[0049] pYES2-MsERF1B-R:
[0050] 5'-TGATGGATATCTGCAGAATTCCCAAGGATTTTGATTGTCATCAG-3'
[0051] pYES2-F:5'-AATATACCTCTATACTTTAACGTC-3'
[0052] pYES2-R:5'-GCGTGAATGTAAGCGTGAC-3'
[0053] 2. The above recombinant vector was transformed into Saccharomyces cerevisiae INVSc1, and then spread on SD / -Ura-deficient medium for growth. After colonies grew, single clones were picked for PCR verification. The primers used were the universal primers pYES2-F / R for the above vector.
[0054] 3. After shaking culture of the verified positive clones in liquid medium SD / -Ura containing 2% galactose, they were plated at a gradient of 1:1, 1:10, and 1:100 on solid SD / -Ura medium containing 100 mM mannitol for growth. The results showed that the MsERF1B gene can improve the tolerance of yeast to drought stress ( Figure 6 ).
[0055] Example 4: Acquisition and Verification of MsERF1B Transgenic Arabidopsis
[0056] 1. Using primers 1300-MsERF1B-F / R as specific primers, clone the CDS sequence of the MsERF1B gene with an EcoR I restriction site. Use the ClonExpress MultiS One Step Cloning Kit from Novozymes Biopharmaceuticals to ligate it into the pCAMBIA1300 vector via homology arm recombination. Transform E. coli and perform bacterial testing using the universal primers 1300-F / R. After sequencing, obtain the overexpression recombinant vector pCAMBIA1300-MsERF1B. The primer sequences used are as follows:
[0057] 1300-MsERF1B-F:
[0058] 5'-TCGAGCTCAAGCTTCGAATTCATGCTTCTATATGGCATGATAAC-3'
[0059] 1300-MsERF1B-R:
[0060] 5'-GTACCGTCGACTGCAGAATTCCCAAGGATTTTGATTGTCATCAG-3'
[0061] 1300-F: 5'-CAAGCATTCTACTTCTATTGCAGC-3'
[0062] 1300-R: 5'-GCAGCAGTCTTCTGCTTGTCTA-3'
[0063] 2, The above recombinant plasmid was transformed into Agrobacterium GV3101 by chemical transformation method, and then coated on YEP medium for growth. After the colonies grew, single colonies were picked for PCR verification. The primers used were the above vector universal primers 1300-F / R. After verification, the correct one was stored at -80°C for standby.
[0064] 3, The pCAMBIA1300-MsERF1B recombinant plasmid Agrobacterium was transformed into wild-type Arabidopsis (WT) by dipping method, and then placed in normal conditions for growth after 24h dark culture. After the seeds matured, the seeds (T0 generation) were collected. The harvested seeds were sown in vermiculite, and after two cotyledons grew, 50 mg / L Basta was sprayed to screen positive seedlings. The finally survived ones were the successfully transformed positive seedlings. The same method was used for screening until the F2 generation homozygous seeds were obtained.
[0065] 4, The F2 generation homozygous seeds were sown, and after two weeks of growth, RNA was extracted, and then reverse transcribed to synthesize cDNA. The semi-quantitative RT-PCR reaction was performed using 2x Taq Master Mix enzyme with the primers of the internal reference gene AtActin-F / R and the target gene MsERF1B-F / R. The expression of MsERF1B in two transgenic Arabidopsis lines (L4 and L7) was detected. The primer sequences used are as follows:
[0066] AtActin-F: ATGAAAATACAGTGTGATGT
[0067] AtActin-R: TTAGCCGAAATCTGGCACCA
[0068] MsERF1B-F: ATGCTTCTATATGGCATGATAAC
[0069] MsERF1B-R: CCAAGGATTTTGATTGTCATCAG
[0070] The results are shown in Figure 7 The transgenic Arabidopsis lines L4 and L7 contain the target gene MsERF1B
[0071] , while WT does not have the band, indicating that the MsERF1B gene has been successfully transformed into Arabidopsis, and the obtained lines are overexpression plants.
[0072] Example 5: Drought resistance identification of MsERF1B transgenic Arabidopsis
[0073] 1. The seeds of wild type WT and MsERF1B transgenic lines L4 and L7 were respectively sowed on 1 / 2 MS solid medium containing 0, 200, 300 and 400 mM mannitol for germination test, and 3 replicates were set for each treatment. The germination was recorded for 7 days and the germination rate was calculated. The results are shown in Table 1. Figure 8 As shown in Table 1, under the drought condition simulated by mannitol, the germination rate and final germination rate of the seeds of MsERF1B transgenic lines were significantly higher than those of WT, indicating that MsERF1B gene can improve the germination rate of Arabidopsis seeds under drought stress.
[0074] 2. The seeds of wild type WT and MsERF1B transgenic lines were respectively sowed on 1 / 2 MS solid medium, and after 5 days of growth, they were transferred to medium containing 0, 200, 300 and 400 mM mannitol for seedling root length test. After 7 days of growth, the seedling root length was measured, and the number of lateral roots and the chlorophyllization rate of cotyledons were counted. The results are shown in Table 2. Figure 9 As shown in Table 2, under drought conditions, the root length, lateral root number and cotyledon chlorophyllization rate of MsERF1B transgenic lines were significantly higher than those of wild type, indicating that MsERF1B gene can promote the growth of seedlings under drought stress.
[0075] 3. Arabidopsis WT and MsERF1B transgenic seedlings which had grown on 1 / 2 MS solid medium for 10 days were transplanted into vermiculite. The seedlings with consistent growth were selected as much as possible during transplanting, and Hoagland nutrient solution was irrigated every 3 days. After about 3 weeks of growth, drought treatment was performed. The plants were irrigated thoroughly and then stopped watering for 12 days, and then normal watering was restored for 5 days. The plants normally irrigated with nutrient solution were used as the control group. The phenotypic changes of the plants were observed every day, and photographs were taken for record. The results are shown in Figure 3. Figure 10 As shown in Figure 3, after drought and rehydration, the growth of MsERF1B transgenic plants was significantly better than that of WT, and the survival rate of transgenic lines was also significantly higher than that of WT, indicating that overexpression of MsERF1B gene can improve the drought resistance of Arabidopsis plants.
[0076] Example 6: Cell membrane damage and active oxygen accumulation of MsERF1B transgenic Arabidopsis under drought stress
[0077] According to the method of Example 5, Arabidopsis WT and MsERF1B transgenic seedlings were transplanted and subjected to drought treatment. After 8 days of drought, the leaves of the control group and the treatment group were collected, and the contents of malondialdehyde, relative conductivity, hydrogen peroxide and superoxide anion were determined using the Solapbio kit. The results are shown in Table 3. Figure 11Under drought stress, the contents of malondialdehyde, relative conductivity, hydrogen peroxide and superoxide anion in transgenic lines were significantly lower than those in wild type, which indicated that MsERF1B gene positively regulated drought tolerance of plants, and provided important gene resources and germplasm materials for breeding alfalfa new varieties with strong drought tolerance.
[0078] It will be obvious to a person skilled in the art that, without departing from the scope of the present application, the application can be implemented in other specific forms. The examples are therefore to be considered as being illustrative and not restrictive, the scope of the application being indicated by the annexed claims rather than by the description above, which is given solely by way of non-limiting example. It is therefore intended that all changes that come within the meaning and range of equivalency of the claims are to be embraced within the scope of the application.
Claims
1. Application of alfalfa drought-resistant gene MsERF1B to improve drought resistance of Arabidopsis thaliana, characterized in that, The nucleotide sequence of the coding region of the MsERF1B gene is shown as SEQ ID NO.
1. The nucleotide sequence of the coding region of the MsERF1B gene is shown as SEQ ID NO. 1.