Sex molecular marker, primer, kit, method and application of black carp

Abstract

The present application discloses a sex molecular marker, primer, kit, method and application of black carp. The molecular marker includes genome sequencing of male and female black carp populations and differential fragments of structural variation. The molecular marker and its primer can be used to effectively distinguish XX female fish, XX pseudo-male fish, XY male fish, XY pseudo-female fish, YY super male fish and YY pseudo-female fish. The present application also provides great convenience for sex-controlled breeding of black carp, which will accelerate the breeding process and provide important technical support for the analysis of the sex determination mechanism of black carp.

Description

Technical Field

[0001] The present application relates to the technical field of black carp, and in particular to black carp sex molecular markers, primers, kits, methods and applications. Background Art

[0002] Opsariichthys bidens is a small carnivorous fish widely distributed in my country. It is rich in polyunsaturated fatty acids (DHA and EPA) essential to the human body. Its content is much higher than that of carp and snakehead, and is comparable to that of bluefin tuna, which has the highest content of DHA in the world. Therefore, Opsariichthys bidens is also known as "flowing DHA". Regular consumption can help children's brain and vision development, reduce the risk of cardiovascular diseases in humans, and is one of the highest quality aquatic products.

[0003] At present, the black carp industry is constrained by the shortage of seedlings. In the process of artificial breeding, more female fish are used and less male fish are used. Generally, the ratio of male to female fish is 10:1. Black carp can only be identified by its male secondary sexual characteristics (such as ribbon-like stripes, elongated anal fins, rough beads on the head, etc.) when it is close to the breeding season. In general seasons, it is impossible to distinguish between males and females by appearance. More importantly, male black carps grow more than 50% faster than females. Breeding all-male fish is the most important direction of breeding and the most important means for breeding units to control core germplasm. XX, XY and YY genetic sex identification is a very important technical means in sex-controlled breeding. The identification of genetic sex can accelerate the process of sex-controlled breeding and reduce breeding costs.

[0004] Xu et al. developed a sex-specific molecular marker and primer pair for sex identification of Opsariichthys bidens in 2024 (A male-specific insert of Opsariichthys bidens identified based on genome-wide association analyses and comparative genomics. Aquaculture Reports 35, 101982). This primer pair can amplify a band in the DNA of male Opsariichthys bidens but not in the DNA of female Opsariichthys bidens. However, in the practice of large-scale sex identification using this primer pair, it was found that the PCR band could not be amplified due to the quality of the extracted genomic DNA, resulting in misjudgment. In addition, it was also found in practice that the specificity of this primer pair was not strong, and mixed bands were often amplified. The template sequence corresponding to the reverse primer pair of this primer pair has 4 locations in the male genome. During PCR amplification, mixed bands will appear due to the weak primer specificity, and it cannot effectively distinguish between the two genotypes of Opsariichthys bidens individuals, XY and YY. Therefore, a primer pair that can amplify bands using the DNA of both male and female individuals and has different bands can simultaneously distinguish between molecular markers of the three genotypes of XX, XY and YY, which is urgently needed for the genetic sex identification of black carp and the breeding of new all-male varieties. Summary of the invention

[0005] Based on the sequencing of the genomes of male and female members of the group of black carp and the analysis of the differences in structural variation, the present application screens out two segments of InDel fragments that are homozygous for females and heterozygous for males. The InDel fragments alone or in combination of two are used as specific molecular markers for genetic sex identification of black carp, and the sex identification of black carp can reach 100% accuracy. And using the molecular marker and its primers, it is possible to effectively distinguish XX female fish, XX pseudo-male fish, XY male fish, XY pseudo-female fish, YY super male fish, and YY pseudo-female fish. In large-scale detection, the technical solution provided by the present application can avoid false negatives caused by low DNA quality, that is, when the quality of male DNA is not high, there is no band and it is identified as female, avoiding detection errors. In addition, the present application also provides great convenience for the sex control breeding of black carp, which will accelerate the breeding process, and also provides important genomic resources for the analysis of the sex determination mechanism of black carp. The technical solution provided in the present application can be used to identify the sex of black carp from the fertilized egg to the adult fish stage. In black carp individuals that have developed to the stage of having fin rays, there is no need to kill them. The sex can be identified by extracting DNA from the fin rays. This is simple, fast, low-cost and harmless to the fish body.

[0006] To this end, the embodiments of the present application at least disclose the following technical solutions:

[0007] In a first aspect, the embodiments disclose molecular sex markers of Opsariichthys bidens, including male-female difference fragments of Opsariichthys bidens, wherein the male-female difference fragments are located at the 7301962-7301996nt position or the 7302023-7302042nt position of chromosome 14 of the Opsariichthys bidens XX genotype genome.

[0008] In a second aspect, the embodiments disclose a nucleic acid for identifying the sex of Opsariichthys bidens, including a DNA molecule as shown in SEQ ID NO.1.

[0009] In a third aspect, the embodiments disclose a nucleic acid for identifying the sex of Opsariichthys bidens, including a DNA molecule as shown in SEQ ID NO.2.

[0010] In a fourth aspect, the embodiments disclose a primer pair for identifying the sex of Opsariichthys bidens, comprising a DNA molecule as shown in SEQ ID NO.3 and a DNA molecule as shown in SEQ ID NO.4.

[0011] In a fifth aspect, an embodiment discloses a kit comprising the primer pair described in the fourth aspect and other reagents required for PCR amplification.

[0012] In the sixth aspect, the embodiment discloses a method for identifying the sex of a black carp, which comprises: obtaining genomic DNA of a black carp to be tested; performing PCR amplification using the primer pair described in the third aspect; and determining the sex of the black carp based on the amplified product.

[0013] In the seventh aspect, the embodiments disclose the application of the molecular marker described in the first aspect, the nucleic acid described in the second aspect, the primer pair described in the second aspect, or the kit described in the third aspect, and the application is selected from: 1) sex identification and screening of black carp; 2) all-male breeding of black carp. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The agarose gel electrophoresis diagram of 44 fish for sex molecular marker verification. In the figure, the XX genotype female fish shows a larger band with a nucleic acid size of 634bp, and the XY genotype male fish shows two bands, one large and one small, of 634bp and 581bp respectively. The 44 lanes in the upper and lower figures correspond to the sample detection of 44 fish.

[0015] Figure 2This is an agarose gel electrophoresis diagram of sex identification of 45 randomly sampled large groups of horsemouth fish. In the figure, the XX genotype female fish shows a larger band with a nucleic acid size of 634bp, and the XY genotype male fish shows two bands, one large and one small, with a total of 634bp and 581bp respectively. The 45 lanes in the upper and lower figures correspond to the sample detection of 45 fish.

[0016] Figure 3 This is an agarose gel electrophoresis diagram for genetic sex identification of 24 XY and YY groups. In the figure, the XY genetic male fish shows two bands, one large and one small, with nucleic acid sizes of 634bp and 581bp respectively, and the YY genetic super male fish shows a smaller band with a nucleic acid size of 581bp. A total of 24 lanes correspond to the sample detection of 24 fish. DETAILED DESCRIPTION

[0017] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0018] Based on the genome sequencing and structural variation difference analysis of male and female mackerel populations, the present application screens out two InDel fragments that are homozygous for females and heterozygous for males. The InDel fragments alone or in combination are used as specific molecular markers for genetic sex identification of mackerel, and the sex identification of mackerel can reach 100% accuracy. And using the molecular marker and its primers, XX female fish, XX pseudo-male fish, XY male fish, XY pseudo-female fish, YY super male fish, and YY pseudo-female fish can be effectively distinguished.

[0019] To this end, on the one hand, the embodiments disclose sex molecular markers of Opsariichthys bidens, including male-female difference fragments of Opsariichthys bidens, wherein the male-female difference fragments are located at the 7301962-7301996nt position or the 7302023-7302042nt position of chromosome 14 of the Opsariichthys bidens XX genotype genome.

[0020] In one aspect, the embodiments disclose nucleic acids for identifying the sex of Opsariichthys bidens, including a DNA molecule as shown in SEQ ID NO. 1. For example, the sex of Opsariichthys bidens can be determined by identifying whether the nucleic acid fragment or nucleic acid sequence shown in SEQ ID NO. 1 exists in a DNA sample of Opsariichthys bidens.

[0021] In one aspect, the embodiments disclose a nucleic acid for identifying the sex of Opsariichthys bidens, including a DNA molecule as shown in SEQ ID NO. 2. For example, the sex of Opsariichthys bidens can be determined by identifying whether the nucleic acid fragment or nucleic acid sequence shown in SEQ ID NO. 2 is present in a DNA sample of Opsariichthys bidens.

[0022] On the one hand, the embodiment discloses a primer pair for identifying the sex of Opsariichthys bidens, including a DNA molecule as shown in SEQ ID NO.3 (F:CTGGGTGACAAACGGAGTGT) and a DNA molecule as shown in SEQ ID NO.4 (R:TTCACTGCGTCAACTGCGTA).

[0023] On the one hand, the embodiment also discloses a kit, comprising the primer pair and other reagents required for PCR amplification.

[0024] On the one hand, the embodiment discloses a method for identifying the sex of a black carp, which comprises: obtaining a black carp genomic DNA to be tested; performing PCR amplification using the primer pair; and determining the sex of the black carp according to the amplified product.

[0025] In some embodiments, if the amplified product is shown as two bands of 634 bp and 581 bp by gel electrophoresis, the horse mackerel is an XY male individual.

[0026] In some embodiments, if the amplified product only shows a 634 bp band on gel electrophoresis, the horsemouth fish is an XX female individual.

[0027] In some embodiments, if the amplified product only shows a band of 581 bp on gel electrophoresis, the horsemouth fish is a super male individual.

[0028] In addition, the embodiments also disclose applications of the molecular marker, the primer pair, the nucleic acid or the kit, and the applications are selected from any of the following: 1) sex identification and screening of black carp; 2) all-male breeding of black carp.

[0029] The present application is now further described in conjunction with specific examples. The following examples are only intended to explain the present application, but do not constitute a limitation to the present application. The test samples and test processes used in the following examples include the following (if the specific experimental conditions are not specified in the examples, they are usually in accordance with conventional conditions or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following examples, if not otherwise specified, can all be obtained from commercial sources).

[0030] 1. Mining of Sexually Differentiated Fragments of the Carcharhinus ocellaris

[0031] The embodiment provides a method for mining sex-differentiated fragments of croaker. The method comprises:

[0032] 1) Whole genome sequencing of male and female populations of black carp: Normal artificially bred black carp offspring were obtained from the breeding base of Hubei Huangyouyuan Fishery Development Co., Ltd. At the sexual maturity stage, 80 individuals were randomly collected, anesthetized and dissected, and the sex of the individuals was determined by the gonads. The fin rays of each fish were stored in a marked centrifuge tube filled with 95% ethanol. DNA was extracted from the fin ray tissues of 20 females and 20 males, and then whole genome sequencing was performed.

[0033] 2) Comparison of male and female genomes and analysis of structural variation differences: The genomes of 20 female and 20 male fish were aligned to the reference genome of female mackerel (National Center for Bioinformation, GWHBEIO00000000, biological sample number SAMC461871, https: / / ngdc.cncb.ac.cn / gwh / Assembly / 22234 / show), and structural variation differences were analyzed. After screening the obtained differential InDel (insertion and deletion) fragments, two longer male-female difference fragments were obtained, one fragment was formed by the nucleotide sequence at the position of 7301962-7301996nt in chromosome 14 of the mackerel XX genotype genome, and the other was formed by the nucleotide sequence at the position of 7302023-7302042nt in chromosome 14 of the mackerel XX genotype genome.

[0034] 3) Design of male-female specific primers: Design the upper (SEQ ID NO. 3) and downstream primers (SEQ ID NO. 4) containing the two fragments.

[0035] 4) Verification of male-female specific primers

[0036] 44 sexually mature samples from other groups raised by Hubei Huangyouyuan Fishery Development Co., Ltd. were randomly selected, and the physiological gender was determined by the secondary sexual characteristics of the black carp. The male fish was covered with about 11 colorful longitudinal stripes, while the female fish had no stripes. After anesthesia, the fin ray tissue was obtained and preserved in 95% ethanol. The gender information corresponded to the fin ray number information.

[0037] Extract DNA samples from fin tissues, and adjust the concentration to 100 ng / μL after testing the DNA concentration. Use the above primers to perform PCR amplification on SEQ ID NO.3 and 4. The PCR reaction system contains 3 μL ddH2O, 5 μL PreMix PCRbuffer, 0.5 μL upstream primer (SEQ ID NO.3), 0.5 μL downstream primer (SEQ ID NO.4) and 1 μL DNA sample in 10 μL. The PCR amplification program is: 94°C for 3 min; 94°C for 4 s, 58°C for 30 s, 72°C for 40 s, 34 cycles; 72°C for 5 min; drop to 4°C. Take the PCR product for agarose gel electrophoresis, the agarose gel electrophoresis concentration is 1.3%, the electrophoresis voltage is 150 V, and the electrophoresis bands are observed in the gel imaging system after 80 min.

[0038] like Figure 1 As shown, among the 44 fish, 16 fish had one larger band in the gel run, which was 100% corresponding to the physiological female fish in the sampling records, and 28 fish had two bands in the gel run, which was 100% corresponding to the physiological male fish in the sampling records.

[0039] 2. Sex Identification of XX and XY Genetic Types of Carcharhinus edulis

[0040] (1) Collection of male and female samples of mackerel

[0041] 45 adult mackerel were randomly collected from the breeding base of Hubei Huangyouyuan Fishery Development Co., Ltd. The fish were the offspring of normal male and female fish and were raised in outdoor ponds. After anesthesia, they were dissected and their sex was determined by the gonads. The dorsal fin rays of each fish were cut and placed in a centrifuge tube with digital markings and 95% ethanol. After each fish fin ray was matched with the digital number one by one, it was stored in a -80℃ refrigerator for later use.

[0042] (2) DNA extraction from black carp

[0043] Fin ray tissue DNA samples were extracted using the conventional phenol-chloroform method. The DNA concentration quality and concentration were tested using Nanodrop 2000, and the DNA concentration of each fish was adjusted to 100 ng / μL.

[0044] (3) PCR amplification

[0045] The reaction system contained 3 μL ddH2O, 5 μL PreMix PCR buffer, 0.5 μL upstream primer (SEQ ID NO.3), 0.5 μL downstream primer (SEQ ID NO.4) and 1 μL DNA sample in 10 μL. The reaction program of the PCR amplification was: 94°C for 3 min; 94°C for 4 s, 58°C for 30 s, 72°C for 40 s, 34 cycles; 72°C for 5 min; drop to 4°C.

[0046] (4) Gel electrophoresis

[0047] The PCR product was subjected to agarose gel electrophoresis at a concentration of 1.3% and an electrophoresis voltage of 150 V. After 80 min, the electrophoresis bands were observed in a gel imaging system.

[0048] (5) Gender determination

[0049] In the above process, from DNA extraction to gel electrophoresis, only the sample number is recorded throughout the process, regardless of gender. Figure 2 The gel electrophoresis results showed that when the sampling records were compared with the electrophoresis results one by one, among the 45 fish, 12 fish had one larger band, which corresponded 100% to the female fish in the sampling records; 33 fish had two bands, which corresponded 100% to the male fish in the sampling records.

[0050] 3. Sex identification of XY normal male and YY super male of mackerel

[0051] (1) Collection of samples of black carp

[0052] Through estrogen induction, XY pseudo-female fish were obtained and cultured to sexual maturity. The XY pseudo-female fish were bred with XY normal male fish to obtain a group containing three genotypes: XX, XY and YY. When they reached sexual maturity after one year of culture, all the XX female fish were eliminated through the male tertiary sexual characteristics, and 24 individuals were randomly selected from the XY and YY mixed group, and the fin tissue was taken and preserved in 95% ethanol.

[0053] (2) DNA extraction from black carp

[0054] Fin ray tissue DNA was extracted using the conventional phenol-chloroform method. The DNA quality and concentration were tested using Nanodrop 2000, and the DNA concentration of each fish was adjusted to 100 ng / μL.

[0055] (3) PCR amplification

[0056] The reaction system contained 3 μL ddH2O, 5 μL PreMix PCR buffer, 0.5 μL upstream primer (SEQ ID NO.3), 0.5 μL downstream primer (SEQ ID NO.4) and 1 μL DNA sample in 10 μL. The reaction program of the PCR amplification was: 94°C for 3 min; 94°C for 4 s, 58°C for 30 s, 72°C for 40 s, 34 cycles; 72°C for 5 min; drop to 4°C.

[0057] (4) Gel electrophoresis

[0058] The PCR product was subjected to agarose gel electrophoresis at a concentration of 1.3% and an electrophoresis voltage of 150 V. After 80 min, the electrophoresis bands were observed in a gel imaging system.

[0059] (5) Genetic gender determination

[0060] like Figure 3 As shown, among the 24 individuals, 23 had two bands, which were XY genotypes, and 1 had a smaller band, which was YY genotype, and was clearly different from the larger band corresponding to the XX genotype in Examples 1 and 2.

[0061] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. Carp ( Opsariichthys bidens ) sex molecular markers, including male and female difference fragments of the mackerel, the male and female difference fragments are located at the 7301961-7301996 nt position and the 7302022-7302042 nt position in the chromosome 14 of the mackerel XX genotype genome, the nucleotide sequences of the male and female difference fragments are shown in SEQ ID NO.1~2, respectively, and the male and female difference fragments are InDel fragments that are homozygous for females and heterozygous for males.

2. Identification of the horsemouth fish ( Opsariichthys bidens ) A primer pair for determining the sex of a human, comprising a DNA molecule as shown in SEQ ID NO.3 and a DNA molecule as shown in SEQ ID NO.

4.

3. A kit comprising the primer pair as claimed in claim 2 and other reagents required for PCR amplification.

4. Methods for identifying the sex of the mackerel include: Obtaining the genomic DNA of the to-be-tested black carp; Perform PCR amplification using the primer pair as claimed in claim 2; Determine the sex of the black carp according to the amplified product; If the amplified product is shown as two bands of 634 bp and 581 bp by gel electrophoresis, the horsemouth fish is an XY male individual; If the amplified product is only shown as a 634 bp band on gel electrophoresis, the horsemouth fish is a XX female individual; If the amplified product only shows a band of 581 bp on gel electrophoresis, the black carp is a YY super male individual.

5. Use of the primer pair according to claim 2 or the kit according to claim 3 in sex identification and screening of black carp.

Images