UDP-glucose transferase mutant and its application

Abstract

The present invention belongs to the field of genetic engineering and biocatalysis technology, and specifically relates to a UDP-glucosyltransferase mutant and its application. The mutant is obtained by subjecting the amino acid sequence of the UDP-glucosyltransferase shown in SEQ ID NO.2 to at least one of the following mutations: mutating the leucine at position 61 to methionine, mutating the asparagine at position 87 to leucine, mutating the glutamine at position 129 to phenylalanine, and mutating the serine at position 139 to alanine, and the enzyme activity of the mutant is significantly higher than that of the wild type. The UDP-glucosyltransferase mutant is used to prepare Reb D, and the conversion rate is high.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and biocatalysis, and specifically relates to a UDP-glucose transferase mutant and an application thereof. Background Art

[0002] Steviosides (SGs) include stevioside, rebaudioside A (Reb A), rebaudioside B (Reb B), rebaudioside C (Reb C), rebaudioside D (Reb D), rebaudioside E (Reb E) and rebaudioside F (Reb F), dulcoside A (Dulcoside A) and stevioside, rebaudioside M (Reb M) and rebaudioside I (Reb I), etc. RebD is about 150 times sweeter than sucrose, has a good taste and no bitterness. RebD is formed by connecting the R1 end of the RebA structure with a β-1,2 glycosidic bond to the glucosyl group. The preparation of RebD mostly adopts the method of extraction, separation and purification from stevia. Since the content of RebD in stevia is extremely low (<0.5%), this preparation method is inefficient and it is difficult to meet the growing market demand. Therefore, enzymatic synthesis is a more effective method. The conversion rate of Reb D synthesized by enzymatic method is high. Chinese invention patent CN114657227 A discloses a glycosyltransferase mutant F121V, which can prepare high-purity Reb D. However, at present, there are few sites available for glycosyltransferase directed modification. Directed screening of glycosyltransferases based on molecular docking technology and improving enzyme activity are key methods in the field of genetic engineering. Therefore, it is of great significance to improve its activity through directed evolution modification based on protein crystal structure to meet the large-scale production of Reb D. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide a UDP-glucosyltransferase mutant and its application in the preparation of Reb D. The enzyme activity of the mutant is significantly higher than that of the wild type, and the conversion rate of preparing Reb D is high.

[0004] The technical solution of the present invention is as follows:

[0005] A UDP-glucosyltransferase mutant, wherein the nucleotide sequence of the UDP-glucosyltransferase is shown in SEQ ID NO.1, the amino acid sequence of the UDP-glucosyltransferase is shown in SEQ ID NO.2, and the UDP-glucosyltransferase is derived from potato;

[0006] The UDP-glucosyltransferase mutant is obtained by subjecting the amino acid sequence shown in SEQ ID NO.2 to at least one of the following mutations:

[0007] The leucine at position 61 was mutated to methionine and named L61M;

[0008] and / or mutating the asparagine at position 87 to leucine, designated N87L;

[0009] and / or mutating the glutamine at position 129 to phenylalanine, designated Q129F;

[0010] and / or mutating the serine at position 139 to alanine, designated as S139A.

[0011] The present invention also provides a UDP-glucosyltransferase combined mutant GT-61M / 87L, which is obtained by mutating the leucine at position 61 to methionine and the asparagine at position 87 to leucine in the amino acid sequence shown in SEQ ID NO.2.

[0012] The method for constructing the mutant comprises the following steps:

[0013] (1) Determine the mutation site, design mutation primers for site-directed mutagenesis, use the vector carrying the UDP-glucosyltransferase gene as a template for site-directed mutagenesis, and construct a plasmid vector containing the gene encoding the mutant;

[0014] The plasmid vector is a pET series vector, preferably pET28a(+);

[0015] (2) Transforming the mutant plasmid into host cells;

[0016] The host cell includes a bacterial or fungal cell, preferably Bacillus subtilis or Escherichia coli;

[0017] (3) Select positive clones for fermentation culture to obtain crude enzyme solution of UDP-glucosyltransferase mutant.

[0018] The present invention also provides the use of the UDP-glucosyltransferase mutant in the preparation of Reb D.

[0019] The preparation method of Reb D is as follows: Reb A is used as a substrate, and the obtained crude enzyme solution is used to carry out a catalytic reaction under the conditions of pH 6-7 and temperature 37-38° C., thereby obtaining Reb D.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The shake flask fermentation enzyme activities of the UDP-glucosyltransferase mutants L61M, N87L, Q129F and S139A provided by the present invention are 2.24 times, 1.98 times, 1.53 times and 1.31 times of the wild enzyme respectively; the present invention also provides a UDP-glucosyltransferase mutant combination GT-61M / 87L, which has a conversion rate of 95% in the process of catalyzing the synthesis of Reb D from Reb A. The present invention improves the application potential of UDP-glucosyltransferase in the food, medicine and chemical industries. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a visualization diagram of the molecular docking results of UDP-glucosyltransferase;

[0023] Figure 2 HPLC chart of UDP-glucosyltransferase combined mutant GT-61M / 87L;

[0024] Figure 3 This is the HPLC chart of the catalytic activity of the UDP-glucosyltransferase combined mutant GT-61M / 87L enzyme solution. DETAILED DESCRIPTION

[0025] The embodiments of the present invention are only used as further explanations of the present invention and cannot be used as limiting the content or scope of the present invention. For molecular biology experimental methods not specifically described in the present embodiments, reference can be made to the Molecular Cloning Experiment Guide.

[0026] The culture medium involved in the embodiment is as follows:

[0027] LB medium: tryptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L;

[0028] TB medium: tryptone 12 g / L, yeast powder 24 g / L, glycerol 5 g / L, KH2PO4 2.31 g / L, K2HPO4·3H2O 16.43 g / L.

[0029] Example 1 Construction of wild-type strain of UDP-glucosyltransferase

[0030] The sequence of UDP-glucosyltransferase (XP_004250485.1) was submitted to a gene company for synthesis and construction of the wild-type strain PET28a-GT. The strain was inoculated into LB liquid culture medium (containing 50 mg / L kanamycin sulfate) at a ratio of 1:100 to prepare seed solution. The seed solution was inoculated into TB liquid fermentation medium at a 1% inoculation rate. After induced culture and fermentation at 20°C in a shaker for 48 hours, the fermentation liquid was centrifuged at 4°C and 12000 rpm for 15 minutes, the precipitate was taken and crushed, and the supernatant was obtained, which was the crude enzyme solution of the wild enzyme.

[0031] Example 2 Preparation and expression of UDP-glucosyltransferase mutants

[0032] According to the nucleotide sequence of UDP-glucosyltransferase, as shown in SEQ ID NO.1, primers for introducing single mutations were designed and synthesized, and the glucosyltransferase gene was subjected to site-directed mutagenesis. The mutant vector was constructed using seamless cloning technology. The vector carrying the mutant gene was introduced into Escherichia coli BL21-DE3 for induced expression to obtain a glucosyltransferase mutant strain. Site-directed mutagenesis: The vector was subjected to site-directed mutagenesis using gene overlapping PCR technology, and the linearized fragment was recovered and purified for recombination.

[0033] In addition to L61M, N87L, Q129F, and S139A, a mutant named D30W was prepared in this example. D30W was obtained by mutation of aspartic acid at position 30 to tryptophan.

[0034] The site-directed mutagenesis primers for introducing the D30W mutation are:

[0035] The nucleotide sequence of the forward primer is shown in SEQ ID NO.3:

[0036] 5'-TGCAAAACAGTTGGCTTGGCGTGGCTTCCTTATCTA-3';

[0037] The reverse primer nucleotide sequence is shown in SEQ ID NO.4:

[0038] 5'-TAGATAAGGAAGCCACGCCAAGCCAACTGTTTTGCA-3'.

[0039] The site-directed mutagenesis primers for introducing the Q129F mutation were:

[0040] The nucleotide sequence of the forward primer is shown in SEQ ID NO.5:

[0041] 5'- AACATGTTGCGAACGAATTCAACATCCCGGCGGGTAAA-3';

[0042] The reverse primer nucleotide sequence is shown in SEQ ID NO.6:

[0043] 5'- TTTACCCGCCGGGATGTTGAATTCGTTCGCAACATGTT-3'.

[0044] The site-directed mutagenesis primers for introducing the S139A mutation were:

[0045] The nucleotide sequence of the forward primer is shown in SEQ ID NO.7:

[0046] 5'-GCGGGTAAACTGCTGACCGCGTGTGCAGCGGTCTTCAG-3';

[0047] The reverse primer nucleotide sequence is shown in SEQ ID NO.8:

[0048] 5'-CTGAAGACCGCTGCACACGCGGTCAGCAGTTTACCCGC-3'.

[0049] The site-directed mutagenesis primers for introducing the L61M mutation are:

[0050] The nucleotide sequence of the forward primer is shown in SEQ ID NO.9:

[0051] 5'-ACGCAGATAGCATCCACATGATTGAATTGCAACTGC-3';

[0052] The reverse primer nucleotide sequence is shown in SEQ ID NO.10:

[0053] 5'-GCAGTTGCAATTCAATCATGTGGATGCTATCTGCGT-3'.

[0054] The site-directed mutagenesis primers for introducing the N87L mutation are:

[0055] The nucleotide sequence of the forward primer is shown in SEQ ID NO.11:

[0056] 5'- CGGCCTGCCACCGCATCTGCTGCCGACCCTGCATAAAGCAT-3';

[0057] The reverse primer nucleotide sequence is shown in SEQ ID NO.12:

[0058] 5'- TGCTTTATGCAGGGTCGGCAGCAGATGCGGTGGCAGGCCG-3'.

[0059] The PCR reaction systems are:

[0060] 1 μL each of 10 μM forward primer and reverse primer, 25 μL of PrimeStar polymerase, 1 μL of template, and make up to 50 μL with double distilled water.

[0061] The PCR conditions were as follows: pre-denaturation at 94°C for 4 min; followed by 25 cycles (94°C for 10 s, 55°C for 5 s, 72°C for 7 min 50 s); extension at 72°C for 10 min; and finally incubation at 4°C.

[0062] The PCR products were detected by 1% agarose gel electrophoresis.

[0063] The above-verified correct PCR product was seamlessly cloned and transferred into Escherichia coli TOP10 competent cells. The transformation product was spread on LB plates containing 50 mg / L kanamycin sulfate and cultured at 37°C overnight. Five single colonies were picked from the plates and inoculated into LB liquid culture medium. The bacterial liquid was PCR verified and sequenced, and the results were correct.

[0064] The correctly sequenced plasmid was transformed into Escherichia coli BL21 (DE3) to obtain recombinant Escherichia coli expressing the variant.

[0065] Expression of mutants:

[0066] The prepared recombinant Escherichia coli expressing the variants were inoculated into LB liquid culture medium and cultured for 16 h. The seeds were inoculated into TB liquid fermentation medium at a 1% inoculation rate. After the Escherichia coli was cultured and fermented in a shaking incubator at 20°C for 48 h, the fermentation broth was centrifuged at 4°C and 12000 rpm for 15 min, and the supernatant was crushed to obtain the crude enzyme solution of the mutant.

[0067] Example 3 Analysis of UDP-glucosyltransferase activity

[0068] The crude enzyme solution obtained in Example 2 was subjected to activity assay respectively. The enzyme activity assay method was as follows: 1 mL 1.2 mm Reb A, 1 mL UDPG, 1 mL wild-type and mutant crude enzyme solution were reacted at 37° C., 200 rpm for 1 h, and HPLC assay was performed. The enzyme activity assay results of the wild-type and mutant UDP-glucosyltransferase are shown in Table 1. The HPLC chart of the combined mutant GT-61M / 87L is shown in Table 1. Figure 2 .

[0069] The specific method parameters of HPLC determination are as follows: add 200 μL of chromatographic acetonitrile, shake and mix, let stand for 10 minutes, centrifuge at 12000 rpm for 10 minutes at room temperature, pass the supernatant through a 0.22 μm organic membrane, and then analyze it using HPLC. HPLC uses a C18 reverse-phase bonded silica gel separation column (4.6 mm×250 mm, 5 μm), 25% acetonitrile as the mobile phase, a flow rate of 1 mL / min, a column temperature of 40°C, a UV detector VWD, a VWD detector wavelength of 210 nm, and an injection volume of 10 μL.

[0070] Table 1 Enzyme activity test results of wild-type and mutant UDP-glucosyltransferase

[0071] Enzymes Peak area Enzyme activity (%) A4 (wild type) 166111 100 D30W 107367 64.6357 L61M 373245 224.6961 N87L 329040 198.0844 S139A 254567 153.2511 Q129F 218625 131.6138 GT-61M / 87L 253567 152.2511

[0072] The results show that the shake flask fermentation enzyme activities of the mutants L61M, N87L, Q129F, S139A, and GT-61M / 87L are 2.24 times, 1.98 times, 1.53 times, 1.31 times, and 1.52 times that of the wild enzyme, respectively. Only the shake flask fermentation enzyme activity of D30W is 0.64 times that of the wild enzyme. The enzyme activities of all mutants described in the present invention are higher than those of the wild type.

[0073] Example 4 Conversion of UDP-glucosyltransferase

[0074] The crude enzyme solution of the combined mutant GT-61M / 87L of the glucosyltransferase obtained in Example 3 was used for catalysis, and Reb A with a concentration of 30 g / L was used as a substrate, and the enzyme solutions of glucosyltransferase, sucrose, and sucrose synthase were used for catalysis. The reaction conditions were 37° C., pH 7, and the reaction time was 24 h. After the reaction was stopped, HPLC detection was performed. The results are as follows: Figure 3 Finally, with 30 g / L Reb A as substrate and reaction time of 24 h, the conversion rate of Reb A to Reb D catalyzed by GT-61M / 87L was 95%.

[0075] The nucleotide sequence of the UDP-glucosyltransferase is shown in SEQ ID NO.1:

[0076] 1 tatctctcat ttcactctat acatagagaa atcccaaatc aacttatttc aatattttga

[0077] 61 ttcatggcta ctaatttgag ggtactaatg tttccatggt tagctttatgg acacatttca

[0078] 121 ccatttctaa acatagccaa gcaactcgcg gatagaggat tcttgattta cctctgttcc

[0079] 181 acgcgaatca atcttgaatc catcatcaag aaaatccctg aaaagtatgc tgattcgatt

[0080] 241 catctttatcg aacttcaatt gccagaatta cccgaacttc ctcctcatta ccatacgacg

[0081] 301 aatggcctcc caccccatct caatcccacc cttcataagg ccctgaaaat gtccaaacca

[0082] 361 aacttttcga gaatcttgca aaatctgaaa cctgatttat tgatttacga tgtattgcag

[0083] 421 ccgtgggctg aacatgttgc gaatgaacaa aacattccag caggtaagct gctaacttcg

[0084] 481 tgtgcagctg tgttttcgta ttttttcagc tttcgaaaga atccaggggt tgaattccct

[0085] 541 ttccctgcta ttcatctccc ggaagttgag aaagtaaaga tcagagaaat actcgcgaaa

[0086] 601 gaacctgaag aagggggtcg tctagacgag ggaaataagc aaatgatgtt gatgtgtacg

[0087] 661 tctagaacta tcgaggctaa atacatagat tactgcactg aattgtgcaa ttggaaagtt

[0088] 721 gttccagttg gtccaccatt ccaagatttg atcactaatg atgcggacaa caaggagctt

[0089] 781 atcgattggc ttggaacaaa acatgaaaat tcaactgttt tcgtctcctt tgggagtgag

[0090] 841 tatttcttgt caaaagaaga tatggagaa gtagctttcg cgctggagtt aagtaatgtt

[0091] 901 aatttcatat gggttgcaag atttccgaaa ggtgaagagc gaaatctcga agatgcatta

[0092] 961 ccaaaaggtt ttcttgaaag aattggagaa aggggaagag ttttggacaa atttgcacca

[0093] 1021 caaccaagaa ttctaaatca tccgagcacc ggaggatta taagtcattgtggttggaat

[0094] 1081 tcagcaatgg aaagtataga ttcggggtt cctataatcg caatgcctattcataatgat

[0095] 1141 caacctataa atgctaagtt gatggtagaa ttgggagtcg cggtggagattgttagagat

[0096] 1201 gatgatggga aaattcacag aggagaaatc gcggaaactc ttaaaagtgtcgtaacaggg

[0097] 1261 gaaacagggg aaatttgag ggctaaagtg agagaaatca gcaagaatttgaaatctata

[0098] 1321 agagatgaag agatggatgc tgttgctgaa gagctaattc aactttgtaggaatagtaat

[0099] 1381 aagagcaaat aatgtgttat gttatgattc gatttacaaa attatattgtatttgtggtg

[0100] 1441 ctttgtttgt cttcgaaata tatcgaggtt gaa

[0101] Connect UDP-Connector to SEQ ID NO.2:

[0102] 1 MATNLRVLMF PWLAYGHISP FLNIAKQLAD RGFLIYLCST RINLESIIKK IPEKYADSIH

[0103] 61LIELQLPELP ELPPHYHTTN GLPPHLNPTL HKALKMSKPN FSRILQNLKP DLLIYDVLQP

[0104] 121WAEHVANEQN IPAGKLLTSC AAVFSYFFSF RKNPGVEFPF PAIHLPEVEK VKIREILAKE

[0105] 181PEEGGRLDEG NKQMMLMCTS RTIEAKYIDY CTELCNWKVV PVGPPFQDLI TNDADNKELI

[0106] 241DWLGTKHENS TVFVSFGSEY FLSKEDMEEV AFALELSNVN FIWVARFPKG EERNLEDALP

[0107] 301KGFLERIGER GRVLDKFAPQ PRILNHPSTG GFISHCGWNS AMESIDFGVP IIAMPIHNDQ

[0108] 361PINAKLMVEL GVAVEIVRDD DGKIHRGEIA ETLKSVVTGE TGEILRAKVR EISKNLKSIR

[0109] 421DEEMDAVAEE LIQLCRNSNK SK。

Claims

1. A UDP-glucosyltransferase mutant, characterized in that: The nucleotide sequence of the UDP-glucosyltransferase is shown in SEQ ID NO.1, the amino acid sequence of the UDP-glucosyltransferase is shown in SEQ ID NO.2, and the UDP-glucosyltransferase mutant is a mutant in which the leucine at position 61 of the amino acid sequence shown in SEQ ID NO.2 is mutated to methionine and the asparagine at position 87 is mutated to leucine.

2. Use of the UDP-glucosyltransferase mutant according to claim 1 in the preparation of rebaudioside D.

3. The use according to claim 2, characterized in that: The preparation method of rebaudioside D is as follows: using rebaudioside A as a substrate, using the obtained crude enzyme solution to carry out a catalytic reaction under the conditions of pH 6-7 and temperature 37-38°C, so as to obtain rebaudioside D.

Images