Application of strawberry FabPIP5K24 / FafPIP5K21 gene or its encoded protein in regulating strawberry powdery mildew susceptibility

By cloning and regulating the strawberry FabPIP5K24/FafPIP5K21 gene, the PI(4, 5)P2 content in strawberries was changed, and the chemical fungicide risk and drug resistance of strawberry powdery mildew was solved, and the susceptibility of strawberry powdery mildew was effectively regulated.

CN118460570BActive Publication Date: 2025-08-15ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410675423.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-28
Publication Date
2025-08-15
Estimated Expiration
2044-05-28

AI Technical Summary

Technical Problem

Strawberry powdery mildew is an economical disease that affects global strawberry production. The use of existing chemical fungicides brings environmental risks and pathogens are resistant to drugs, and there is a lack of effective genetic regulation methods.

Method used

By cloning the strawberry FabPIP5K24/FafPIP5K21 gene or its encoded protein, the content of phosphatidylinositol-4,5-diphosphate in strawberries was regulated, and the susceptibility of strawberry powdery mildew was used to change the PIP5K inhibitor UNC3230 or overexpression silencing vector.

Benefits of technology

It significantly reduces or improves the susceptibility of strawberry powdery mildew. The PI(4, 5)P2 content is positively correlated with powdery mildew susceptibility, providing new targets and drug applications for the regulation of strawberry powdery mildew resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118460570B_ABST
    Figure CN118460570B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of the strawberry FabPIP5K24 / FafPIP5K21 gene or the protein encoded by it in regulating strawberry powdery mildew susceptibility, and relates to the field of plant genetic engineering. The present invention reveals a positive correlation between strawberry PI (4,5) P2 content and powdery mildew susceptibility. The present invention clones the strawberry FabPIP5K24 / FafPIP5K21 gene through bioinformatics analysis and molecular biology experimental screening and establishes overexpression and silencing vectors. Through transient genetic transformation, it is verified that overexpression of the FabPIP5K24 / FafPIP5K21 gene can increase strawberry PI (4,5) P2 content and increase strawberry powdery mildew susceptibility, while silencing of the FabPIP5K24 / FafPIP5K21 gene can reduce strawberry PI (4,5) P2 content and reduce strawberry powdery mildew susceptibility, providing a new target for post-harvest resistance regulation of strawberries.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and in particular to application of strawberry FabPIP5K24 / FafPIP5K21 gene or the protein encoded by it in regulating strawberry powdery mildew susceptibility. Background Art

[0002] Powdery mildew is an economically destructive disease that affects strawberry production worldwide. It is caused by the obligate biotrophic fungus Podosphaera aphanis and can infect and damage almost all above-ground parts of strawberry, including flowers, leaves, buds, runners, and fruits. It can reduce the photosynthetic capacity of leaves and reduce yield, or directly infect fruits, causing a decline in fruit quality and making them unmarketable (Palmer MG, Holmes G J. Fungicide sensitivity in strawberry powdery mildew caused by podosphaera aphanis in california[J]. Plant Disease Journal, 2021, 105(9): 2601-2605.).

[0003] The favorable growing environment for powdery mildew growth and reproduction, coupled with the difficulty of early detection, often leads growers to use preventive and curative fungicides to control strawberry powdery mildew. During the 6 to 8 weeks of peak strawberry production, some growers apply fungicides every two weeks to control powdery mildew. The most common chemical categories are demethylation inhibitors, succinate dehydrogenase inhibitors, and quinone inhibitors, which act on specific processes of pathogen cell development or respiration. However, the use of chemical fungicides brings environmental risks, and there have been reports of powdery mildew resistance in different fruits and regions (Sombardier A, Dufour MC, Blancard D, et al. Sensitivity of podosphaera aphanis isolates todmi fungicides: Distribution and reduced cross-sensitivity [J]. Pest Management Science, 2010, 66 (1): 35-43.). Therefore, researchers have conducted extensive research on the pathogenicity of pathogens and the immune mechanisms of plants. The development of genomics has brought the possibility of regulating disease resistance in fruits and vegetables through genetic modification technology.

[0004] Phosphatidylinositol 4-phosphate 5-kinase (PIP5Ks) is a key enzyme in the phosphatidylinositol signaling pathway and plays an important role in plant growth and development, as well as responses to biotic and abiotic stresses. PIP5K specifically catalyzes the phosphorylation of phosphatidylinositol-4-phosphate (PI4P) at position D5 of the inositol ring to produce phosphatidylinositol-4,5-bisphosphate [PI(4,5)P2] (Van Den Bout I, Divecha N. PIP5K-driven PtdIns(4,5)P2 synthesis: regulation and cellular functions [J]. Journal of Cell Science, 2009, 122(21): 3837-3850.). Currently, research on the role of PI(4,5)P2 in plant-pathogen immune interactions has primarily focused on model plants such as Arabidopsis and rice. Studies have found that PI(4,5)P2 is enriched in cellular structures specifically associated with effector secretion and fungal infection, making it a disease susceptibility factor in plants. However, the role of the strawberry endogenous PIP5K gene and its PI(4,5)P2-mediated mechanism in regulating strawberry powdery mildew defense has not been reported. Cloning and functional validation of the PIP5K gene in octoploid strawberry will provide a new target for regulating postharvest resistance to strawberry powdery mildew and a new target gene for molecular genetic improvement of highly resistant varieties. Making full use of strawberry genomic resources, discovering powdery mildew-related genes, and cultivating disease-resistant varieties will be a more economical, effective, and environmentally friendly strategy for green control of strawberry. Modulating PI(4,5)P2 in strawberries through plant genetic engineering techniques may affect the formation of haustoria structures during powdery mildew infection, thereby inducing changes in strawberry powdery mildew susceptibility. Summary of the Invention

[0005] The present invention aims to provide a gene related to strawberry powdery mildew susceptibility, and to use the gene as a target to regulate the phosphatidylinositol-4,5-bisphosphate content in strawberries, thereby inducing changes in the susceptibility of strawberries to powdery mildew, that is, to use the FabPIP5K24 / FafPIP5K21 gene or the protein encoded by it in regulating the susceptibility of strawberries to powdery mildew.

[0006] The present invention provides application of strawberry FabPIP5K24 / FafPIP5K21 gene or protein encoded by the same in regulating strawberry powdery mildew susceptibility.

[0007] The present invention also provides use of the strawberry FabPIP5K24 / FafPIP5K21 gene or the protein encoded thereby in preparing a drug for reducing the susceptibility of strawberry to powdery mildew.

[0008] Preferably, the CDS nucleotide sequence of the strawberry FabPIP5K24 / FafPIP5K21 gene is shown as SEQ ID No. 1, and the amino acid sequence of the protein encoded by the strawberry FabPIP5K24 / FafPIP5K21 gene is shown as SEQ ID No. 2.

[0009] The present invention relates to treating strawberries with a PIP5K inhibitor, UNC3230, which significantly reduces the susceptibility of strawberries to powdery mildew. Transiently silencing the FabPIP5K24 / FafPIP5K21 gene in strawberries reduces the PI(4,5)P2 content in the strawberries by 31.0%, reduces the susceptibility of strawberries to powdery mildew, and reduces the percentage of powdery mildew lesion area by 7.9 percentage points. Overexpressing the FabPIP5K24 / FafPIP5K21 gene in strawberries increases the PI(4,5)P2 content in the strawberries by 69.4%, increases the susceptibility of strawberries to powdery mildew, and increases the percentage of powdery mildew lesion area by 12.4 percentage points, verifying the positive correlation between the PI(4,5)P2 content and the susceptibility of strawberries to powdery mildew.

[0010] The present invention also provides a method for regulating strawberry powdery mildew susceptibility. When it is necessary to reduce the susceptibility of strawberry powdery mildew, the FabPIP5K24 / FafPIP5K21 gene in the strawberry is silenced or knocked out; when it is necessary to increase the susceptibility of strawberry powdery mildew, the FabPIP5K24 / FafPIP5K21 gene in the strawberry is overexpressed.

[0011] The invention relates to that overexpression of FabPIP5K24 / FafPIP5K21 gene promotes accumulation of PI(4,5)P2 in strawberry, thereby inducing increased susceptibility of strawberry to powdery mildew; and silencing of FabPIP5K24 / FafPIP5K21 gene inhibits production of PI(4,5)P2 in strawberry, thereby causing reduced susceptibility of strawberry to powdery mildew.

[0012] Preferably, the CDS nucleotide sequence of the strawberry FabPIP5K24 / FafPIP5K21 gene is shown as SEQ ID No. 1.

[0013] In some embodiments of the present invention, silencing or knocking out the FabPIP5K24 / FafPIP5K21 gene in strawberry comprises the following steps:

[0014] (1) constructing a gene silencing or knockout vector, wherein the gene silencing or knockout vector is a plant expression vector carrying a sequence for silencing or knocking out the FabPIP5K24 / FafPIP5K21 gene;

[0015] (2) The gene silencing or knockout vector of step (1) is introduced into strawberry cells to silence or knock out the FabPIP5K24 / FafPIP5K21 gene, and transgenic strawberry plants are cultured.

[0016] Specifically, the plant expression vector is pNC-cambia2304. The target sequence for gene knockout is shown in SEQ ID No. 3.

[0017] The specific technical solutions of the present invention are as follows:

[0018] The present invention first focuses on the mode of action of PI(4,5)P2 in response to powdery mildew infection. By inhibiting the catalytic action of phosphatidylinositol 4-phosphate 5-kinase, a key enzyme in the biosynthesis of strawberry PI(4,5)P2, the authors verified that strawberry powdery mildew susceptibility was reduced. Based on this, octoploid strawberry genomic resources and bioinformatics analysis methods were combined to identify members of the PIP5K gene family in strawberry. Phylogenetic tree cluster analysis and spatiotemporal expression analysis were performed to screen for a candidate gene cluster, the FabPI5K21 cluster, which is constitutively expressed at high levels and significantly responds to powdery mildew infection.

[0019] The invention uses octoploid cultivated strawberry (Fragaria×ananassa Duch. Benihoppe) as the material, optimizes the primer sequence and PCR conditions, clones the full-length CDS (2493bp) of the FabPIP5K24 / FafPIP5K21 gene in the FabPI5K21 cluster, and recovers the cloned fragment by gel excision. The cloned fragment is then constructed into the pNC-AEnTopo blunt-end vector. The FabPIP5K24 gene in the pNC-AEnTopo vector is replaced with the NC cloning frame of the overexpression vector by an NC cloning reaction. The cloned fragment is then transformed into Escherichia coli, and the plasmid with the correct sequencing alignment is transformed into Agrobacterium GV3101 for preservation. Transient overexpression of the FabPIP5K24 / FafPIP5K21 gene in strawberries promotes the accumulation of PI(4,5)P2 in strawberries and induces increased susceptibility to powdery mildew.

[0020] A 442-bp targeting fragment from the FabPIP5K24 / FafPIP5K21 gene was selected, and primers with universal NC cloning adapter sequences at both ends were designed. The targeting fragment was cloned simultaneously in the forward and reverse directions into two NC cloning frames of the vector to form an hpRNA expression construct. Escherichia coli was transformed, and positive clones were identified by colony PCR. After sequencing and alignment, the plasmid was transformed into Agrobacterium tumefaciens GV3101 for storage. Transient silencing of the FabPIP5K24 / FafPIP5K21 gene in strawberry inhibited strawberry PI(4,5)P2 production and reduced susceptibility to powdery mildew. This study illustrates the role of PIP5K gene-mediated changes in PI(4,5)P2 content and its regulatory role in strawberry powdery mildew susceptibility.

[0021] The present invention also provides an application of the strawberry FabPIP5K24 / FafPIP5K21 gene or the protein encoded by it in strawberry breeding. A strawberry strain with low susceptibility to powdery mildew is obtained by screening strawberry plants in which the strawberry FabPIP5K24 / FafPIP5K21 gene is silenced or knocked out, or a strawberry strain with low susceptibility to powdery mildew is obtained by screening strawberry plants in which the protein encoded by the strawberry FabPIP5K24 / FafPIP5K21 gene is expressed at a low level or not expressed.

[0022] The present invention also provides a drug for reducing the susceptibility of strawberry powdery mildew, wherein the active ingredient includes a sequence for knocking out or silencing the strawberry FabPIP5K24 / FafPIP5K21 gene,

[0023] or a compound that inhibits the protein encoded by the strawberry FabPIP5K24 / FafPIP5K21 gene,

[0024] The strawberry FabPIP5K24 / FafPIP5K21 gene CDS nucleotide sequence is shown in SEQ ID No. 1.

[0025] Beneficial effects of the present invention:

[0026] 1. The present invention reveals the positive correlation between strawberry PI(4,5)P2 content and powdery mildew susceptibility.

[0027] 2. The present invention cloned the strawberry FabPIP5K24 / FafPIP5K21 gene through bioinformatics analysis and molecular biology experimental screening and established overexpression and silencing vectors. Through transient genetic transformation, it was verified that overexpression of the FabPIP5K24 / FafPIP5K21 gene can increase the strawberry PI (4,5) P2 content and increase the strawberry powdery mildew susceptibility, while silencing of the FabPIP5K24 / FafPIP5K21 can reduce the strawberry PI (4,5) P2 content and reduce the strawberry powdery mildew susceptibility. FabPIP5K24 / FafPIP5K21 can be used as a target in regulating the strawberry PI (4,5) P2 content and strawberry powdery mildew susceptibility, laying a foundation for the regulation of food nutritional components and the innovation and cultivation of powdery mildew-resistant strawberry germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Effects of PIP5K inhibitor UNC3230 treatment on PI(4,5)P2 content and powdery mildew resistance of strawberry;

[0029] Figure 2 Phylogenetic cluster analysis of strawberry PIP5K;

[0030] Figure 3 Heat map of PIP5K gene expression in strawberry roots, leaves, receptacles of different maturity levels, and achenes;

[0031] Figure 4 The expression differences of the high-expression PIP5K gene cluster in response to powdery mildew; ns indicates no significant difference, * indicates p < 0.05, and **** indicates p < 0.0001;

[0032] Figure 5 This is the electrophoresis diagram of the cloning and gel recovery of the CDS region of the FabPIP5K24 / FafPIP5K21 gene of Strawberry;

[0033] Figure 6 This is the vector map of the overexpression vector pNC-cambia2304-FabPIP5K24 / FafPIP5K21-OE;

[0034] Figure 7 This is the map of the silencing vector pNC-cambia2304-FabPIP5K24 / FafPIP5K21-RNAi vector;

[0035] Figure 8 Functional validation of FabPIP5K24 / FafPIP5K21 genes; * indicates p < 0.05, ** indicates p < 0.01;

[0036] Figure 9The powdery mildew susceptibility phenotype of strawberry tissue culture seedlings transiently overexpressing and silencing the FabPIP5K24 / FafPIP5K21 gene; * indicates p < 0.05, ** indicates p < 0.01. DETAILED DESCRIPTION

[0037] The present invention will be further described below with reference to the following examples. Unless otherwise specified, the methods used in the following examples are conventional methods; the materials, reagents, etc. used in the examples are all commercially available unless otherwise specified.

[0038] Example 1: Feasibility verification of regulating strawberry PI(4,5)P2 and strawberry powdery mildew susceptibility based on PIP5K

[0039] Effects of exogenous treatment with the PIP5K inhibitor UNC3230 on strawberry powdery mildew susceptibility

[0040] 1.1.1 Experimental Materials

[0041] The fluorescent probe vector P24Y of PI(4,5)P2 was kindly donated by Professor Yvon Jaillais of the French National Center for Scientific Research and was transformed into Agrobacterium GV3101 for preservation.

[0042] Subcultured “Hongyan” strawberry tissue culture seedlings (seedling supplier: Jiangsu Fengshou Dadi Seed Development Co., Ltd.; source of seedling mothers: Shanghai Qingpu Strawberry Garden) and Nicotiana benthamiana were planted in 10 × 10 cm (diameter × height) pots at 25 °C, 16 h / 8 h alternating day and night cultivation, and 75% relative humidity.

[0043] The powdery mildew strain was regularly subcultured and maintained on healthy strawberry pots for isolation and culture.

[0044] 1.1.2 Powdery mildew isolation, propagation and seed preservation

[0045] Powdery mildew fungi were collected from potted strawberry plants. Powdery mildew on the strawberry tissue was brushed into sterile water and filtered through a 40 μm cell strainer. The spore concentration was measured and adjusted to 2 × 10 spores using a hemocytometer. 6 CFU / mL, evenly spray 5mL of the bacterial suspension on healthy strawberry pots. A white mycelial layer will be visible to the naked eye after 10 days. Prepare a powdery mildew spore suspension every 30 days and spray it on transplanted tissue culture seedlings to propagate and preserve the powdery mildew fungus.

[0046] 1.1.3 Verification of the PIP5K inhibitor UNC3230's regulation of PI(4,5)P2 function

[0047] To prepare the Agrobacterium benthamiana infection solution: Weigh 0.976g of 2-(N-morpholino)ethanesulfonic acid (MES) and 0.476g of MgCl₂, dissolve them in 500mL of water, adjust the pH to 5.4 with NaOH, autoclave at 121°C for 15 minutes, cool, and store in a refrigerator at 4°C (i.e., 10mM MgCl₂, 10mM MES, pH 5.6). To prepare a 200mM acetosyringone (AS) stock solution, weigh 0.0392g of AS into a 2mL sterile test tube, add 1mL of DMSO, dissolve, filter sterilize, and store in a refrigerator at -20°C. Before use, dilute the AS stock solution 1000-fold into the Agrobacterium infection solution. The frozen P24Y Agrobacterium was streaked onto LB agar plates with 50 μg / mL spectinomycin and gentamycin using an inoculation loop. The LB plates were streaked three times and incubated at 28°C for 48 h. After the single colony was verified by electrophoresis to be correct, it was added to 20 mL of liquid LB with antibiotics and cultured with shaking for 48 h. The cells were collected after centrifugation at 5000 rpm for 5 min, washed twice with Agrobacterium infection solution, and diluted to OD 600 The concentration of the solution was 0.6-0.8, and the solution was placed in the dark at 28°C for 2 h before injection from the back of the tobacco leaf using a 1 mL syringe.

[0048] Subcellular Localization of Fluorescent Probes and UNC3230 Treatment: Two days after tobacco leaves were infected with the PI(4,5)P2 fluorescent indicator probe P24Y, Agrobacterium tumefaciens was used to inject the leaves. 1 μM UNC3230 (10 mg of UNC3230 was dissolved in 2.9033 mL of DMSO to prepare a 10 mM stock solution, which was then diluted with water to 1 μM for final use) was sprayed on the leaves. Control leaves were sprayed with an equal volume of the DMSO dilution. After 24 hours of treatment, tobacco leaves were excised, mounted on glass slides, and dripped with water. Fluorescent protein CITRINE was observed at 514 nm excitation and 530-600 nm emission wavelengths, while chloroplasts were observed at 650 nm emission wavelength.

[0049] 1.1.4 UNC3230 regulates strawberry powdery mildew susceptibility

[0050] UNC3230 treatment of strawberry tissue culture seedlings and powdery mildew inoculation: 1 μM UNC3230 solution was evenly sprayed on the red strawberry seedlings, and the control was sprayed with an equal amount of DMSO diluted solution. After 24 h, 2×10 6 A powdery mildew conidia suspension of CFU / mL was evenly sprayed on the leaves of the seedlings, and the disease resistance phenotype on the 10th day was recorded.

[0051] Observe the microstructure using a conventional optical microscope: Cut 3-4 leaves and place them in a 10mL centrifuge tube. Add 2-3mL of trypan blue staining solution (dissolve trypan blue in a solution of water: glycerol: lactic acid: phenol: ethanol at a volume ratio of 1:1:1:1:6, to a final concentration of 0.67mg / mL). Heat the centrifuge tube in a 100°C water bath for 10-15 minutes. After cooling in a fume hood (approximately 30 minutes), aspirate the trypan blue staining solution and add 3mL of chloral hydrate (Sigma, 1kg dissolved in 400mL of water, stored in a refrigerator) for decolorization for 24 hours. Then, add another 3mL of chloral hydrate for decolorization for 1-2 days. The discarded chloral hydrate is specially recovered.

[0052] UNC3230 treatment of tobacco leaves transiently expressing the PI(4,5)P2 fluorescent probe P24Y can cause a decrease in the fluorescence distribution indicated by P24Y in tobacco ( Figure 1 ), indicating that UNC3230 can inhibit the catalytic activity of PIP5K, leading to a reduction in PI(4,5)P2 content in plants. Spraying strawberry tissue culture seedlings with the PIP5K inhibitor UNC3230 significantly reduced the severity of powdery mildew compared to the control group. The macroscopically visible powdery layer on the leaves of the treated red strawberries was significantly reduced, as was the microscopic number of powdery mildew conidia.

[0053] Example 2: PIP5K candidate genes with high expression levels in octoploid strawberries and significant changes in response to powdery mildew infection

[0054] 2.1 Identification of the PIP5K gene family in octoploid strawberry

[0055] Download the strawberry genome data and annotation files of Fragaria×ananassaFL15.89-25Genome v1.0 Assembly&Annotation from the strawberry genome database (https: / / www.rosaceae.org / ), screen out the longest transcript from the CDS and protein files, and use the longest transcript as the representative sequence of a gene. Download the hidden Markov model (HMM model) PF01504 of the PIP5K gene family, and use hmmsearch to search for sequences containing the PIP5K domain in the strawberry proteome to obtain candidate family proteins. The protein sequence obtained in the previous step was aligned to the pFAM database using hmmscan, and the protein sequence containing the PIP5K domain (MORN / PIPKc / PIP5K) was further determined as the target gene family sequence. A total of 88 genes ( Figure 2The parents of "FL15.89-25" are Florida Beauty and FL12.115-10. This version of the genome is haplotyped, with each haplotype having its own file. The prefix "Bea" indicates a haplotype inherited from Florida Beauty, and the prefix "F12" indicates a haplotype inherited from FL12.115-10. Genes designated "Fab*" are from the Bea subgenome, and genes designated "Ff*" are from the F12 subgenome.

[0056] 2.2 Analysis of temporal and spatial expression differences of PIP5K gene in different tissues of strawberry and in response to powdery mildew infection

[0057] Download transcriptome data from different tissues and fruit maturity (receptacle and achene) of Camarosa strawberry (NCBI bioproject: PRJEB12420) and transcriptome data of Hongyan strawberry leaves in response to powdery mildew infection (CNCB bioproject: PRJCA001734, GSAs: CRA001964), and combine the 88 identified PIP5K gene family members to perform logarithmic transformation of the values using log2(fpkm+1) to draw a heat map ( Figure 3 Since the octoploid strawberry genome has 8 haplotypes and a large number of alleles or homologous genes with identical or highly homologous sequences, CD-hit-est was used to remove redundancy from highly homologous sequences (-c 0.97) when calculating expression levels. Only representative sequences were retained for expression calculation, and the 88 genes were simplified to 27 highly similar gene clusters. Figure 3 and 4 Representative sequences represent the overall expression levels of the entire group of highly similar genes. Highly expressed gene clusters FabPIP5K05, FabPIP5K06, FabPIP5K10, FabPIP5K21, FafPIP5K03, and FafPIP5K34 were identified. The highly expressed gene clusters FabPIP5K06, FabPIP5K10, FabPIP5K21, and FafPIP5K03 showed significant responses to powdery mildew infection, with expression levels increasing, decreasing, increasing, and increasing, respectively. The FabPIP5K21 cluster showed high expression levels and significant changes in response to powdery mildew infection, making it a candidate for subsequent clone screening.

[0058] Example 3: FabPIP5K21 / FafPIP5K21 gene cloning

[0059] The FabPIP5K21 cluster is a group of highly homologous, identically lengthed genes, encompassing eight sequences (Table 1): FabPIP5K21, FabPIP5K24, FabPIP5K27, FabPIP5K30, FafPIP5K18, FafPIP5K21, FafPIP5K26, and FafPIP5K27. These sequences are all 2493 bp in length and exhibit over 98% sequence similarity. Optimized PCR conditions and primer sequences were used for cloning of these eight sequences. Identical copies of the FabPIP5K24 and FafPIP5K21 genes were obtained, but they were located on different chromosomes: chromosomes Fvb6-2 of the Bea subgenome and Fvb6-2 of the F12 subgenome, respectively.

[0060] Table 1 FabPIP5K21 cluster members

[0061]

[0062]

[0063] RNA extraction and cDNA synthesis: Leaves from tissue-cultured strawberry seedlings were ground into a powder in liquid nitrogen. 50–100 mg of the powder was weighed and RNA was extracted according to the instructions for the Novagen Fast Pure Universal Plant Total RNA Isolation Kit (RC411). RNA extraction was verified by electrophoresis and Nano-Drop, and RNA concentration was determined. cDNA was synthesized using the Novagen HiScript III All-in-one RT SuperMix Perfect for qPCR (R333) reagent. 1 pg–1 ng of RNA was used for one-step cDNA synthesis according to the kit's instructions and stored at –20°C.

[0064] Cloning of FabPIP5K24 / FafPIP5K21 gene: Using Norvegren high-fidelity enzyme 2×Phanta Max MasterMix (Dye Plus) for cloning, the primer sequences are ACATTCCCGAGGGTAAGGGA (upstream primer 5′-3′), TCGCCCTCATAAACAGCACC (downstream primer 5′-3′), and the PCR system is ddH2O 8μL, Mix 12.5μL, forward primer 1μL, reverse primer 1μL, cDNA 2.5μL. Annealing temperature 56°C, extension time 2min 17s, cycle number 33 times. After band electrophoresis verification, prepare 50μL PCR system, and cut the gel for recovery if the electrophoresis band is correct ( Figure 5), and the operation was performed according to the Novozymes kit instructions. The recovered fragments were assayed for concentration and purity using Nano-Drop, transformed into Escherichia coli DH5α, and positive single colonies verified by PCR were sent to Qingke Biotechnology (Hangzhou) for sequencing and alignment with the predicted sequence (the CDS nucleotide sequence is shown in SEQ ID No. 1, and the amino acid sequence of the protein encoded by the strawberry FabPIP5K24 / FafPIP5K21 gene is shown in SEQ ID No. 2). The plasmids after alignment were transformed into Agrobacterium, and Agrobacterium with the correct bands were frozen in glycerol (Agrobacterium culture medium: 50% glycerol volume ratio = 1:1) at -80°C.

[0065] T-vector construction: Recover the cloned gene fragment from the gel and construct it into T-vector according to the instructions of the pNC-AEnTopo blunt-end cloning vector kit. Transform E. coli DH5α and plate the fragment. Single clones are selected for electrophoresis verification and the corresponding bacterial culture of positive clones is sent to Qingke Biotechnology Co., Ltd. (Hangzhou) for sequencing. Those with correct sequencing results are used for transformation into the overexpression vector.

[0066] Example 4: Construction of FabPIP5K24 / FafPIP5K21 gene overexpression vector and silencing vector

[0067] Overexpression vector construction: The FabPIP5K24 / FafPIP5K21 gene in pNC-AEnTopo was substituted for the NC cloning frame of the overexpression vector by NC cloning reaction to obtain pNC-cambia2304-FabPIP5K24 / FafPIP5K21-OE (map as shown in Figure 6 The plasmid was transformed into E. coli, and kanamycin (50 μg / mL) was added to the transformation plate. The correct plasmid was verified by sequencing and transformed into Agrobacterium GV3101. E. coli and Agrobacterium were stored at -80°C.

[0068] Construction of silencing vector: A 442 bp fragment (sequence 1) in the CDS region of FabPIP5K24 / FafPIP5K21 was selected as the target fragment with a GC content of 45%. Primers with NC cloning universal adapter sequences were designed at both ends. The target fragment was cloned into two NC cloning frame positions of the vector in both forward and reverse directions to obtain pNC-cambia2304-FabPIP5K24 / FafPIP5K21-RNAi (see Figure 1). Figure 7 As shown), the hpRNA expression structure was formed, and after the electrophoresis band was verified to be correct, it was transformed into Escherichia coli. Two antibiotics, kanamycin (50 μg / mL) and chloramphenicol (5 μg / mL), were added to the transformation plate. After sequencing verification, it was transferred into Agrobacterium GV3101 and stored at -80°C.

[0069] (1) The nucleic acid sequence of the RNAi vector targeting fragment sequence 1 is shown in SEQ ID No. 3:

[0070] (2) Primers for cloning sequence 1 fragment (the underlined part is the NC universal linker):

[0071] F-RNAi:

[0072] AGTGGTCTCTGTCCAGTCCT AGCTGATGGTTTGGGAATGGTTG,

[0073] R-RNAi:

[0074] GGTCTCAGCAGACCACAAGT AATGAATTCCAAGAAGCGTCGGG. Example 5: Verification of FabPIP5K24 / FafPIP5K21 gene function

[0075] Antibiotic preparation method: Weigh rifampicin powder and dissolve it in DMSO to prepare 25 mg / mL; dissolve chloramphenicol in anhydrous ethanol to prepare 50 mg / mL; dissolve kanamycin in sterile water to prepare 50 mg / mL; sterilize by filtration with a filter membrane, and dispense into 1.5 mL sterile EP tubes.

[0076] Preparation of Agrobacterium infection solution: Prepare infection solution Co-buffer at 4.44 g / L MS + 20 g / L sucrose, pH 5.8, sterilize, and store at 4°C. Prepare a 200 mM acetosyringone (AS) stock solution and dilute it 1000-fold into Co-buffer immediately before use.

[0077] Preliminary preparation of Agrobacterium infection solution: Take out the glycerol bacteria of pNC-cambia2304-FabPIP5K24 / FafPIP5K21-OE and pNC-cambia2304-OE-empty vector frozen at -80℃, and use an inoculation loop to streak on LB agar plates with kanamycin and rifampicin resistance; take out the single colony glycerol bacteria of pNC-cambia2304-FabPIP5K24 / FafPIP5K21-RNAi and pNC-cambia2304-FabPIP5K24 / FafPIP5K21-RNAi-empty vector frozen at -80℃, and use an inoculation loop to streak on LB agar plates with chloramphenicol, kanamycin, and rifampicin resistance. After streaking three times, incubate at 28°C for 48 hours. After verifying the correct bands by electrophoresis of a single colony, add the colony to 20 mL of LB liquid medium containing the appropriate resistance and incubate with a shaker at 180 rpm / min for 24 hours. Then, transfer the colony to 200 mL of LB liquid medium to increase the OD to approximately 0.8. Centrifuge at 4000 rpm for 5 minutes, resuspend the colony in Agrobacterium infection medium (add acetosyringone when using), and incubate at 28°C for 2-3 hours.

[0078] Agrobacterium vacuum infiltration of strawberry tissue culture seedlings: Prepare a large volume of Agrobacterium infection solution of FabPIP5K24 / FafPIP5K21-OE and empty vector-OE, FabPIP5K24 / FafPIP5K21-RNAi and empty vector-RNAi, and divide it into sterile plant tissue culture glass tissue culture bottles, 200 mL per bottle. In the clean bench, carefully remove the agar medium with the roots of the tissue culture seedlings, place them with the leaves facing down and the roots facing up in the Agrobacterium suspension in the tissue culture bottle, open the lid and place them in a water circulating vacuum pump container, and maintain the vacuum pressure at 0.7 MPa. During the process, bubbles can be observed in the leaves. Remove them after 10 minutes of treatment, dry them on absorbent paper, and then divide them into seedlings and plant them in pots. Samples are taken on the 5th day to determine the PI(4,5)P2 content in the leaves.

[0079] Extraction and determination of PI (4,5) P2 from strawberry tissue culture seedling leaves: Grind strawberry leaves into powder in liquid nitrogen, weigh about 100-200 mg of powder for each sample, add 1 mL of 0.5 M trichloroacetic acid (TCA), incubate on ice for 5 minutes, centrifuge at 3000 rpm at 4°C for 7 minutes, and discard the supernatant; add 1 mL of 5% TCA / 1 mM EDTA to the precipitate in the test tube, vortex for 30 seconds, centrifuge at 3000 rpm for 5 minutes, discard the supernatant, and repeat the washing once; add 1 mL of MeOH:CHCl3 (2:1), vortex at room temperature for 10 minutes, centrifuge at 3000 rpm for 5 minutes, discard the supernatant, and repeat the extraction once. Add 750 μL of MeOH:CHCl₃:HCl (80:40:1) and vortex at room temperature for 25 minutes. Centrifuge at 3000 rpm for 5 minutes. Transfer the supernatant to a new 2 mL centrifuge tube, add 250 μL of CHCl₃ and 450 μL of 0.1 N HCl, vortex for 30 seconds, and centrifuge at 3000 rpm for 5 minutes. The organic and aqueous phases are separated. Use a pipette to remove 0.5 mL of the lower organic phase and place it in a 1.5 mL centrifuge tube. Place it in a vacuum desiccator for 45-60 minutes. The organic phase will evaporate, and the dried lipids will be invisible to the naked eye. It can be stored at -20°C. For sample analysis, resuspend the sample in PBS and use it for subsequent ELISA absorbance measurement. PI(4,5)P2 levels in different samples were determined using a competitive ELISA kit (Echelon Biosciences). According to the detection scheme, the colorimetric signal is read at an absorbance of 450 nm. The colorimetric signal is inversely proportional to the amount of PI(4,5)P2 extracted from the cells. Figure 8 As shown, the PI(4,5)P2 content in the strawberry leaves transiently transformed with the overexpression vector increased by 69.4% compared with the empty vector, and the PI(4,5)P2 content in the strawberry leaves transiently transformed with the silencing vector decreased by 31.0% compared with the empty vector, indicating that the FabPIP5K24 / FafPIP5K21 gene can be successfully expressed in strawberry leaves and can play a catalytic role to produce a higher content of PI(4,5)P2, verifying the function of the FabPIP5K24 / FafPIP5K21 gene in strawberry.

[0080] Example 6: FabPIP5K24 / FafPIP5K21 gene regulates powdery mildew susceptibility

[0081] Overexpression vector and silencing vector genetic transformation of strawberry tissue culture seedlings: Agrobacterium vacuum infiltration of strawberry tissue culture seedlings was the same as in Example 5. 48 hours after seedlings were planted in pots, strawberry powdery mildew spore suspension was evenly sprayed, and the phenotype was recorded on the 10th day after powdery mildew inoculation.

[0082] The percentage of lesion area was calculated as follows: the ratio of the white mycelial layer area on the leaf surface to the total leaf area at 10 dpi was calculated, and the average lesion percentages of the experimental group and the control group were calculated.

[0083] FabPIP5K24 / FafPIP5K21 gene regulation of powdery mildew susceptibility: The Agrobacterium vacuum infiltration method was used to immerse the Agrobacterium infection solution into the seedling leaf tissue. The expression level of the FabPIP5K24 / FafPIP5K21 gene was measured at 10 dpi (the primers for the measurement are shown in Table 2) and the powdery mildew disease phenotype was observed.

[0084] Table 2 Primers for determining strawberry FabPIP5K24 / FafPIP5K21 gene expression

[0085]

[0086] like Figure 9 As shown, the expression level of the transiently transformed strawberry FabPIP5K24 / FafPIP5K21 gene was 3 times that of the empty control, and the average percentage of the powdery mildew disease area increased by 12.4 percentage points; the expression level of the transiently transformed strawberry FabPIP5K24 / FafPIP5K21 gene was 0.7 times that of the empty control, and the average percentage of the powdery mildew disease area decreased by 7.9 percentage points.

Claims

1. Strawberries FabPIP5K24 / FafPIP5K21 Application of genes or proteins encoded by them in regulating strawberry powdery mildew susceptibility, strawberry FabPIP5K24 / FafPIP5K21 The CDS nucleotide sequence of the gene is shown in SEQ ID No. 1, strawberry FabPIP5K24 / FafPIP5K21 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

2.

2. Strawberries FabPIP5K24 / FafPIP5K21 Application of gene or protein encoded by it in preparing medicine for reducing susceptibility of strawberry to powdery mildew, strawberry FabPIP5K24 / FafPIP5K21 The CDS nucleotide sequence of the gene is shown in SEQ ID No. 1, strawberry FabPIP5K24 / FafPIP5K21 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 2; When applying, put the strawberry FabPIP5K24 / FafPIP5K21 Gene silencing or knockout, or FabPIP5K24 / FafPIP5K21 The expression of the protein encoded by the gene is reduced or not expressed.

3. A method for regulating strawberry powdery mildew susceptibility, characterized in that: When it is necessary to reduce the susceptibility of strawberry to powdery mildew, FabPIP5K24 / FafPIP5K21 Gene silencing or knockout; when it is necessary to increase the susceptibility of strawberry to powdery mildew, FabPIP5K24 / FafPIP5K21 Gene overexpression; strawberry FabPIP5K24 / FafPIP5K21 The nucleotide sequence of the gene CDS is shown in SEQ ID No.

1.

4. The method according to claim 3, wherein The strawberries FabPIP5K24 / FafPIP5K21 When silencing or knocking out a gene, the following steps are involved: (1) Constructing a gene silencing or knockout vector, wherein the gene silencing or knockout vector is a vector with FabPIP5K24 / FafPIP5K21 Plant expression vectors containing sequences for gene silencing or knockout; (2) Introduce the gene silencing or knockout vector from step (1) into strawberry cells FabPIP5K24 / FafPIP5K21 Gene silencing or knockout, and transgenic strawberry plants after cultivation.

5. The method according to claim 4, wherein The plant expression vector is pNC-cambia2304.

6. The method according to claim 4, wherein The target sequence for gene knockout is shown in SEQ ID No.

3.

7. Strawberries FabPIP5K24 / FafPIP5K21 Application of genes or their encoded proteins in strawberry breeding, through screening for silencing or knocking out strawberries FabPIP5K24 / FafPIP5K21 Strawberry lines with low susceptibility to powdery mildew can be obtained by removing the gene from strawberry plants, or by selecting strawberry FabPIP5K24 / FafPIP5K21 Strawberry plants with low or no expression of the gene-encoded protein can obtain strawberry lines with low susceptibility to powdery mildew. FabPIP5K24 / FafPIP5K21 The CDS nucleotide sequence of the gene is shown in SEQ ID No. 1, strawberry FabPIP5K24 / FafPIP5K21 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.

2.

8. A drug for reducing susceptibility to powdery mildew of strawberries, characterized in that: Active ingredients include for knocking out or silencing strawberry FabPIP5K24 / FafPIP5K21 A nucleic acid molecule having a nucleotide sequence shown in SEQ ID No. 3 of a gene, Or suppress strawberries FabPIP5K24 / FafPIP5K21 A compound for a protein encoded by a gene, wherein the compound is a PIP5K inhibitor UNC3230, The strawberry FabPIP5K24 / FafPIP5K21 The nucleotide sequence of the gene CDS is shown in SEQ ID No.1.

Citation Information

Patent Citations

  • Powdery mildew resistance gene of strawberry and application of powdery mildew resistance gene

    CN113666992A

  • Castor PIP5K11 gene and application thereof

    CN116622745A