dCAPS Molecular Marker of Rice Seed Vigor Gene OsRFP and Its Related Applications

By developing dCAPS molecular markers to detect the polymorphism of rice OsRFP gene, using specific primers and enzyme cleavage and electrophoresis technology, the problem of rice seed vitality identification was solved, and the rapid screening and identification of rice varieties with strong seed vitality was achieved, which improved breeding efficiency and seed vitality.

CN118497401BActive Publication Date: 2025-08-29江西省农业科学院水稻研究所
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410723869.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-05
Publication Date
2025-08-29
Estimated Expiration
2044-06-05

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently screen and identify the vitality of rice seeds, resulting in accelerated seed aging, affecting seed life and germination rate, especially in high temperature and high humidity environments.

Method used

A detection method based on dCAPS molecular marker was developed, using the polymorphism of the OsRFP gene, and the viability genotype of rice seeds was quickly identified by designing specific primers and restriction endonuclease BamHI digestion, combined with polyacrylamide gel electrophoresis.

Benefits of technology

It has achieved efficient screening of rice varieties with strong seed vitality without natural or artificial aging, saving costs, promoting rice breeding process, and improving seed vitality identification efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118497401B_ABST
    Figure CN118497401B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of molecular biology technology, and specifically relates to a rice seed vitality gene OsRFP The present invention discloses a dCAPS molecular marker and its related applications. The dCAPS molecular marker is located at a physical position of 10005615 bp on rice chromosome 6 and has an A / G polymorphism. The present invention also provides a specific primer pair associated with the dCAPS molecular marker for this locus. PCR amplification of genomic DNA from rice samples using these primers and electrophoresis of the amplified products revealed that rice seeds with an amplified band of 186 bp exhibited strong seed vigor. This invention has important application value in the screening and molecular marker-assisted breeding of rice varieties with strong seed vigor.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of rice breeding and molecular biology technology, and specifically relates to a rice seed vitality gene OsRFP dCAPS molecular markers and their related applications. Background Art

[0002] Rice is one of the three most important food crops globally, serving as a staple food for over 50% of the world's population. Therefore, increasing and maintaining rice yields is closely linked to global food security and social stability. During storage, rice seeds undergo a series of physiological changes, resulting in reduced seed vigor and a decline in seedling survival. Seed aging is the natural decline in seed vigor, accelerated by high temperature and high humidity. In some regions, rice seeds are subject to the long-term influence of the monsoon climate, which, combined with high temperature and high humidity, further accelerates the aging process. The lifespan and vigor of rice seeds are important indicators of rice quality. Because seed vigor and germination rates decrease after storage, improving seed vigor in rice varieties is a breeding goal and research priority for researchers.

[0003] Dongxiang wild rice is the most northern common wild rice in the world. Oryza rufipogon Griff), discovering and utilizing rice seed vigor genes from Dongxiang wild rice has important practical significance for promoting rice storage tolerance breeding.

[0004] Seed vigor is not only closely linked to external factors such as seed development and storage conditions, but is also under genetic control. The zinc finger protein (RFP) family is one of the most abundant transcription factors in higher plants. The zinc ions in zinc finger proteins are composed of cysteine ​​and histidine residues. Based on the position and number of histidine and cysteine ​​residues, they are primarily classified into C2H2, C2HC, C2HC5, C2C2, CCCH, C3HC4, C4, C4HC3, C6, and C8 types. These proteins are primarily involved in biological processes such as transcriptional regulation, DNA repair, cell proliferation, and stress resistance. Summary of the Invention

[0005] The present invention aims to provide a method for screening rice seed vitality genes OsRFP The present invention uses resequencing technology to locate a seed vigor QTL on rice chromosome 6. qGSS6 (8929129-12724047), whose enhanced allele comes from Dongxiang wild rice. A gene from the zinc finger protein family was found in this interval. OsRFP, and there is a one-base difference between the parents. Further research found that the LOD value of the site detected in the BC5F2 population constructed from Dongxiang wild rice was 2.9 and the PVE was 13.5%. In order to further accelerate its application in rice seed vigor breeding, qGSS6 The design and development of linked dCAPS molecular markers has important application value in promoting the molecular identification of rice seed vigor and marker-assisted breeding of rice seed vigor. This invention is dedicated to developing a dCAPS molecular marker that can rapidly detect rice seed vigor, thereby accelerating the application of molecular breeding of rice seed vigor.

[0006] To achieve the objectives of the present invention, a recombinant inbred line (RIL) population was first constructed by hybridizing the rice variety Xieqingzao B (weak seed vigor) with Dongxiang wild rice (strong seed vigor). Genomic DNA of the RILs population was extracted, and a high-density bin marker genetic linkage map was constructed using resequencing technology. SNP sites significantly associated with the rice seed vigor trait were obtained, and fragments linked to the above SNP sites were cloned and sequenced, and converted into dCAPS molecular markers. The successfully converted dCAPS molecular markers were used to identify rice seed vigor in natural populations and the above-mentioned recombinant inbred line (RIL) populations, and the molecular marker identification results were consistent with the phenotypic identification results.

[0007] Based on this, the present invention provides a rice seed vitality gene OsRFP The dCAPS molecular marker is GSS6-dCAPS;

[0008] The polymorphism of the dCAPS molecular marker GSS6-dCAPS is located at a physical position of 10005615 bp on rice chromosome 6, and the polymorphism of the GSS6-dCAPS is A or G.

[0009] The present invention also provides a specific primer pair for detecting the above-mentioned dCAPS molecular marker GSS6-dCAPS. The upstream primer sequence of the specific primer pair is shown in SEQ ID No. 1:

[0010] TCAATTGGGCTGTATGAAGTGGATC;

[0011] The downstream primer sequence of the specific primer pair is as shown in SEQ ID No. 2:

[0012] AACAACCTTCATGGAGGTGGTGCTT.

[0013] The present invention also provides a kit for detecting the dCAPS molecular marker GSS6-dCAPS, the kit comprising the specific primer pair. The kit provided by the present invention also contains the restriction endonuclease BamHI.

[0014] The present invention also provides the use of the specific primer pair and / or the kit in rice assisted breeding.

[0015] The present invention also provides the use of the specific primer pair and / or the kit in identifying rice seed vigor.

[0016] The present invention provides a method for identifying rice seed vitality, which comprises the following steps:

[0017] 1) Extract genomic DNA from rice leaves;

[0018] 2) using the genomic DNA extracted in step 1) as a template, performing a PCR amplification reaction using the specific primer pair shown in claim 2 to obtain a PCR amplification product;

[0019] 3) digesting the PCR amplification product obtained in step 2) with the restriction endonuclease BamHI to obtain a digestion product, and subjecting the digestion product to polyacrylamide gel electrophoresis;

[0020] 4) When the electrophoresis results show only one band of 207 bp, the genotype of the SNP site is AA homozygous, and the seed vigor of the rice material is weak;

[0021] When the electrophoresis results contain two main bands of 207 bp and 186 bp, and the genotype of the SNP site is AG heterozygous, the seed vigor of the rice material is intermediate;

[0022] When the electrophoresis results contain only one main band of 186 bp and the genotype of the SNP site is homozygous GG, the vigor of the rice seeds is strong.

[0023] In the present invention, the reaction system for PCR amplification in step 2) is: 10 μl of 2×Tolo FastTaq Premix, 1 μl of the specific primer pair according to claim 2 at 10 pmol / μl, and 1 μl of 300-500 ng / μl rice genomic template DNA, and sterilized ultrapure water is added to make up to 20 μl;

[0024] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 45 s, for 35 cycles; extension at 72°C for 10 min;

[0025] In step 3) of enzyme digestion, each 20 μl of enzyme digestion reaction system includes: 10 μl of PCR amplification product, 1 μl of BamHI and 9 μl of distilled water; the reaction temperature of the enzyme digestion is 37° C., and the reaction time of the enzyme digestion is 30 minutes;

[0026] During the polyacrylamide gel electrophoresis, 2 μl of the digested product was electrophoresed on a 6% polyacrylamide gel.

[0027] The beneficial effects achieved by the technical solution of the present invention are:

[0028] The molecular markers for identifying rice seed vigor provided by the present invention can be applied to rice seed vigor molecular marker-assisted breeding. Without the need for phenotypic identification methods such as natural aging or artificial aging treatment, rice varieties with strong seed vigor can be screened out conveniently and efficiently, saving costs and increasing efficiency, and promoting the rice breeding process. It has important theoretical and practical significance for cultivating new rice varieties with strong seed vigor. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 For genes OsRFP Sequencing profile in the recombinant backcross population (BC5F2);

[0030] Figure 2 The genotypes of the two parents and the heterozygous type at chr6_100056156 were obtained by PCR amplification of chr6_10005615 of the two parents using dCAPS primers and then sequencing results;

[0031] Figure 3 The polyacrylamide gel electrophoresis results of the PCR products of the two parents and the BC5F2 generation after digestion with the restriction endonuclease BamH I;

[0032] Figure 4 The average seed germination rate after seed aging of a population of backcross recombinant inbred lines (BILs) constructed from Dongxiang wild rice with strong seed vigor and Xieqingzao B with poor seed vigor. DETAILED DESCRIPTION

[0033] The following examples are used only to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0034] Example 1

[0035] Development of dCAPS Molecular Markers for Identifying Rice Seed Vigor Traits

[0036] 1. Cloning genes controlling rice seed vigor through map-based cloning

[0037] (1) A high-generation backcross BILs population of the BC5F2 generation was constructed using Dongxiang wild rice (strong seed vigor) and Xieqingzao B (weak seed vigor);

[0038] (2) A high-density genetic linkage map containing 2059 bin markers was constructed using resequencing technology;

[0039] (3) Combined with the high-density genetic linkage map, the seed vigor QTL of the BILs population was analyzed and a major effect QTL controlling seed vigor was detected. qGSS6 ( Figure 1 ), a candidate gene was obtained OsRFP , and obtained SNP loci closely linked to rice seed vigor.

[0040] 2. SNP site-specific enzyme cleavage site analysis and primer design

[0041] (1) OsRFP There is a difference of one base A / G at the 1243rd position from the gene start codon in the genome of Dongxiang wild rice with strong seed vigor and Xieqingzao B with poor seed vigor ( Figure 2 );

[0042] (2) Select the appropriate endonuclease BamH I;

[0043] (3) OsRFP The 1243bp site of the genome was genotyped in the BILs population, and three genotypes were shared: A, G, and S. S represents the AG merging bases. If the genotype of a material is S, it means that the material is in a heterozygous state at this site. According to the recognition sequence of the restriction endonuclease BamH I, if the SNP site is A, it can be digested; if it is G, it cannot be digested; if it is S, it can be partially digested. OsRFP The average phenotypic values ​​of the three genotypes at 1243pb were calculated respectively, and it was found that the seed vigor of the G or S genotype materials was significantly greater than that of the A genotype ( P <0.05).

[0044] (4) Develop OsRFP The dCAPS molecular marker at the 1243 bp site of the genome was named GSS6-dCAPS marker, and the dCAPS primer pair was designed using the online enzyme recognition software dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html).

[0045] Upstream primer F: 5′-TCAATTGGGCTGTATGAAGTGGATC-3′, SEQ ID No. 1;

[0046] Downstream primer R: 5'-AACAACCTTCATGGAGGTGGTGCTT-3', SEQ ID No. 2.

[0047] Based on this primer pair, PCR amplification of the DNA of the rice varieties Dongxiang wild rice and Xieqingzao B was performed, and both obtained 207bp products. After the above products were digested with the restriction endonuclease BamH I, if the strain has strong seed vigor, a single band of 186bp or two bands of 186bp and 207bp were obtained; if the strain has weak seed vigor, a single band of 207bp was obtained.

[0048] Example 2

[0049] Validation of the GSS6-dCAPS molecular marker for identifying seed vigor traits in rice

[0050] (1) The genomic DNA of the above-mentioned BILs population and its parents was extracted using the CTAB method;

[0051] (2) PCR amplification of the BILs population and its parents was performed using the specific primer pairs designed in Example 1. The PCR amplification reaction system for 10 μl was as follows: 1 μl of the genomic DNA to be tested, 10 μl of 2×Tolo FastTaq Premix, 1 μl of the primer pair described in claim 1 or 2 at 10 pmol / μl, and sterilized ultrapure water was added to make up to 20 μl. The PCR amplification reaction procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, 35 cycles; and finally extension at 72°C for 10 min.

[0052] (3) After the PCR reaction, 2 μl of the reaction product was taken and subjected to 6% polyacrylamide gel electrophoresis to detect the product genotype. All of them were single bands, indicating that the primers had good specificity.

[0053] (4) The PCR product of step (2) was digested with restriction endonuclease BamH I. The 20 μl digestion reaction system was as follows: 10 μl PCR product, 1 μl BamH I, 9 μl distilled water, and the digestion reaction conditions were 37°C for 30 min. After the digestion, 2 μl of the digestion product was subjected to genotyping detection on 6% polyacrylamide gel electrophoresis ( Figure 3 ), and the seeds of the corresponding rice materials were artificially aged at a temperature of 42°C and a humidity of 80% for 27 days, and then a germination test was conducted. The germination rate of the BIL population was statistically analyzed, and the results showed that the genotype was consistent with the seed vigor phenotype identification results ( Figure 4 ), among which the average germination rate of AA type was 36.7%, the average germination rate of GG type was 71.1%, and the average germination rate of AG type was 51.4%.

[0054] In summary, the dCAPS molecular marker designed for this SNP site in the present invention can be effectively used for molecular identification of rice seed vigor and marker-assisted selection breeding, and has great application value and prospects; the above is only a preferred embodiment of the present invention, and it should be pointed out that all variations that can be directly derived or associated with the contents disclosed by ordinary technicians in this field should be considered to be within the scope of protection of the present invention.

Claims

1. Use of a specific primer pair and / or a kit comprising the specific primers in identifying rice seed vigor; The specific primer pair is a specific primer pair for detecting the dCAPS molecular marker GSS6-dCAPS, the upstream primer sequence of the specific primer pair is shown as SEQ ID No. 1, and the downstream primer sequence of the specific primer pair is shown as SEQ ID No. 2; The dCAPS molecular marker GSS6-dCAPS is a molecular marker with a polymorphism located at a physical position of 10005615 bp on chromosome 6 of rice, and the polymorphism of the GSS6-dCAPS is A or G; The rice gene version number is: IRGSP-1.

0.

2. A method for identifying rice seed vigor, characterized in that: The identification method comprises the following steps: 1) Extract genomic DNA from rice leaves; 2) using the genomic DNA extracted in step 1) as a template and performing a PCR amplification reaction using the specific primer pair shown in claim 1 to obtain a PCR amplification product; 3) digesting the PCR amplification product obtained in step 2) with the restriction endonuclease BamHI to obtain a digestion product, and subjecting the digestion product to polyacrylamide gel electrophoresis; 4) When the electrophoresis results show only one band of 207 bp, the genotype of the SNP site is AA homozygous, and the seed vigor of the rice material is weak; When the electrophoresis results contain two main bands of 207 bp and 186 bp, and the genotype of the SNP site is AG heterozygous, the seed vigor of the rice material is intermediate; When the electrophoresis results contain only one main band of 186 bp and the genotype of the SNP site is homozygous GG, the vigor of the rice seeds is strong.

3. The identification method according to claim 2, characterized in that The reaction system for PCR amplification in step 2) is: 10 μl of 2×Tolo FastTaq Premix, 1 μl of the specific primer pair according to claim 1 at 10 pmol / μl, and 1 μl of 300-500 ng / μl rice genomic template DNA, and sterilized ultrapure water is added to make up to 20 μl; The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 45 s, for 35 cycles; extension at 72°C for 10 min; In step 3) of enzyme digestion, each 20 μl of enzyme digestion reaction system includes: 10 μl of PCR amplification product, 1 μl of BamHI and 9 μl of distilled water; the reaction temperature of the enzyme digestion is 37° C., and the reaction time of the enzyme digestion is 30 minutes; During the polyacrylamide gel electrophoresis, 2 μl of the digested product was electrophoresed on a 6% polyacrylamide gel.

Citation Information

Patent Citations

  • Rice zinc finger protein gene and its application

    CN106432450A

  • Primer composition, kit and method for identifying genotype of rice storable gene lox3

    CN112813185A