Maize Nuclear Male Sterility Gene Ms16 and Its Molecular Marker and Application

Abstract

The present invention discloses a maize nuclear male sterility gene Ms16 and its molecular marker and application, belonging to the field of biotechnology. The nucleotide sequence of the maize nuclear male sterility gene Ms16 is shown in SEQ ID NO.1, and the nucleotide sequence of the molecular marker closely linked to the maize nuclear male sterility gene Ms16 is shown in SEQ ID NO.5; there is a SNP site at the 19bp of the sequence shown in SEQ ID NO.5, the base types of the SNP site include G and A, the genotypes include GG, GA and AA, and the maize anther with the genotype of GG or GA is fertile; the maize anther with the genotype of AA is sterile. The maize nuclear male sterility gene Ms16 discovered by the present invention has important value and significance for enriching the maize male sterility germplasm resources in my country.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a maize nuclear male sterility gene Ms16 and a molecular marker and application thereof. Background Art

[0002] Corn is one of the earliest crops in the world to produce hybrid seeds using male sterility. Since it is difficult to find the corresponding maintenance line for nuclear male sterile lines, it is also difficult to directly apply them in corn seed production. With the advent of molecular breeding technology, Pioneer Corporation of the United States has invented a new nuclear male sterile line seed production technology - SPT technology, which can directly distinguish between sterile and fertile seeds through seed fluorescence. The discovery of this technology effectively solves the problem of nuclear male sterility in maintaining sterile lines in hybrid breeding. As a result, nuclear sterile mutants have attracted the attention of more and more breeders.

[0003] So far, 26 nuclear male sterility genes have been reported, and Chinese scientists have cloned 14 of them. However, most of the germplasm resources come from the American Corn Germplasm Center, and only 5 corn nuclear male sterility mutants are independently created by my country. Therefore, creating more nuclear male sterility mutants is of great value and significance for enriching my country's corn male sterility germplasm resources. Summary of the invention

[0004] The purpose of the present invention is to provide a maize nuclear male sterility gene Ms16 and its molecular marker and application to solve the problems existing in the above-mentioned prior art. The present invention discovers a maize nuclear male sterility gene Ms16 in maize and develops a molecular marker closely linked to the gene. The fertility of maize can be accurately identified based on the molecular marker, which is of great significance to the production of maize sterile lines.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a maize nuclear male sterility gene Ms16, and the nucleotide sequence of the maize nuclear male sterility gene Ms16 is shown in SEQ ID NO.1.

[0007] The present invention also provides a molecular marker tightly linked to the maize nuclear male sterility gene Ms16, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.5; there is a SNP site at the 19bp of the nucleotide sequence shown in SEQ ID NO.5, the base types of the SNP site include G and A, and the genotypes include GG, GA and AA.

[0008] The present invention also provides a primer combination for detecting the molecular marker, comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a downstream universal primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0009] The present invention also provides a reagent or a kit for detecting the molecular marker, comprising the primer combination.

[0010] The present invention also provides the use of the primer combination or the reagent or the kit in early corn fertility identification, wherein the corn fertility includes corn male sterility and male fertility.

[0011] The present invention also provides a method for early identification of corn fertility, comprising the following steps:

[0012] Using the genomic DNA of the corn to be tested as a template, using the primer combination or the reagent or the kit to perform fluorescent quantitative PCR amplification on the template, converting the fluorescent signal into a genotype, and judging the fertility of the corn to be tested according to the genotype;

[0013] Corn with genotype GG or GA is male fertile; corn with genotype AA is male sterile.

[0014] Furthermore, the amplification system of the fluorescent quantitative PCR amplification is: 2×Mix 5.0 μL, primer mixture 1.4 μL, ddH2O 2.6 μL, DNA template 100 ng;

[0015] The primer mixture is prepared by mixing upstream primer F1: upstream primer F2: downstream universal primer R: water in a volume ratio of 1:1:2.5:3.8.

[0016] Furthermore, the amplification program of the fluorescent quantitative PCR amplification is: 94°C for 15 min; 94°C for 20 s, 65°C for 1 min, 10 cycles; 94°C for 20 s, 55°C for 1 min, 30 cycles; 37°C for 1 min.

[0017] The present invention also provides the use of the primer combination or the reagent or the kit in cultivating corn male sterile lines.

[0018] The present invention also provides the use of the primer combination or the reagent or the kit in molecular marker-assisted breeding of male sterile corn.

[0019] The present invention discloses the following technical effects:

[0020] The present invention utilizes ethyl methanesulfonate (EMS) to treat the pollen of the corn inbred line RP125, and unexpectedly finds a nuclear male sterile mutant in its induced progeny. The mutant is characterized by shriveled male flowers and undyable pollen grains, and is a completely sterile male sterile mutant. Further studies have found that the male sterility is controlled by a single recessive gene. Through allelic mutant function verification, it is determined that the nuclear sterile gene encodes an atypical isotropoid synthase, which is named Ms16.

[0021] The Ms16 gene discovered in the present invention is a SNP mutant gene, which only affects fertility and has no effect on the gene functions of other genes, and thus has no effect on other agronomic traits. It maintains stable sterility under different genetic backgrounds and has great utilization value. A pair of KASP primers are designed based on the SNP mutation site of the gene, and the primers can be used to accurately identify the fertility of corn, which is of great significance to the production of corn sterile lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 The phenotypic comparison diagrams of mutant ms16 and wild type at different growth stages, wherein a and b are the plant type and plant height comparison diagrams of wild type and mutant ms16 at the vegetative growth stage, respectively, and c and d are the pollen shedding comparison diagrams of wild type and mutant ms16 at the heading stage, respectively;

[0024] Figure 2 This is the location map of the sterility gene Ms16;

[0025] Figure 3 The genotyping diagram of sterile and fertile plants in the (ms16×B73) F2 population using primer KASP-Ms16;

[0026] Figure 4 This is the functional verification of the sterility gene Ms16, where a is a schematic diagram of the ms16-mut transposon mutant; b is the anther staining results of the wild type and ms16-mut transposon mutant, as well as the anther phenotype of the plant at the heading stage; c is the anther staining results of the hybrid offspring of the ms16-mut transposon mutant and GA genotype corn, as well as the anther phenotype of the plant at the heading stage. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] Example 1 Gene location of recessive nuclear male sterility gene ms16 in maize

[0033] 1. Fertility identification of the sterile mutant ms16

[0034] The inventors used ethyl methanesulfonate (EMS) to mutagenesis the pollen of the maize inbred line RP125. By screening the EMS-induced mutant library of the maize inbred line RP125, they obtained a male sterile mutant with normal female ear development and complete male ear abortion, named ms16. In the vegetative growth stage, there was no significant difference in phenotypes such as plant shape and plant height between the wild type and ms16 ( Figure 1 a and b). By observing the wild type and ms16 male spikes, it was found that at the heading stage, the wild type released a large amount of pollen, while ms16 had no pollen exposed ( Figure 1c and d), proving that ms16 is a nuclear male sterile mutant.

[0035] 2. Genetic Analysis of Restorer Genes

[0036] The mutant ms16 was crossed with maize B73 to produce the F1 generation, which was self-pollinated to produce the F2 generation, which was planted to obtain a trait segregating population. Hereinafter, the F1 will be referred to as (ms16×B73)F1, and the F2 will be referred to as (ms16×B73)F2.

[0037] In 2019 and 2020, the fertility survey statistics of the (ms16×B73)F2 trait segregation population were conducted in Wenjiang District, Chengdu City, Sichuan Province and Chongzhou City, Sichuan Province, respectively. The results are shown in Table 1. As shown in Table 1, the fertility survey results of two years and two points found that the segregation ratio of fertile plants and sterile plants in the (ms16×B73)F2 population was 3:1, which proved that the sterility trait of ms16 was controlled by a recessive single gene.

[0038] Table 1 (ms16×B73) F2 group sports survey

[0039]

[0040] Note: 2 (0.05,1)=3.84

[0041] 3. Fine mapping of the sterility gene Ms16

[0042] The target gene was located by map-based cloning with (ms16×B73)F2 as the positioning population. First, 134 pairs of InDel primers evenly distributed on 10 chromosomes were developed based on the genomic differences between maize B73 and maize inbred line RP125 to screen for polymorphisms between B73 and ms16, and a total of 73 pairs of primers with polymorphisms between the two parents were screened. In the next step, DNA of 10 sterile and fertile plants in the (ms16×B73)F2 population were randomly taken and mixed in equal amounts to construct sterile and fertile pools, and the sterile and fertile pools were genotyped using primers that were polymorphic between the parents. Finally, the primer umc1153 was screened out, which showed polymorphism in the two pools, that is, the sterile pool and ms16 had the same banding type, and the fertile pool and B73 had the same banding type. At the same time, the primer umc1153 was used to genotype the (ms16×B73)F1, and the primer showed a heterozygous banding type, which preliminarily proved that the primer umc1153 may be linked to the phenotype. Furthermore, six pairs of polymorphic primers were developed near primer umc1153, namely D46, B80, Q5, Q36, B5 and Q8, and 599 completely sterile plants in the (ms16×B73) F2 population were genotyped. Finally, the target gene was located at the InDel markers B80 and Q36 on chromosome 1, with a physical location interval of 18.6 Mb ( Figure 2 ), and the two markers screened 1 and 7 exchange plants, respectively. In order to further narrow the positioning interval, we expanded the positioning and developed 5 KASP markers in the initial positioning interval, namely KASP-276, KASP-280, KASP-281, KASP-282 and KASP-284, and genotyped 2181 completely sterile plants in the (ms16×B73)F2 population. Finally, the target gene was located between KASP-280 and KASP-282, and the physical distance between the two KASP markers was 2.07Mb ( Figure 2 ).

[0043] Example 2 Molecular marker and primer design of recessive nuclear male sterility gene ms16 in maize

[0044] According to the results of fine positioning in Example 1, candidate genes in this segment were predicted and cloned and sequenced, and it was found that the genome sequence of Zm00001d034032 gene (SEQ ID NO.1) had unique SNP differences between sterile plants and fertile plants.

[0045] SEQ ID NO.1:

[0046]

[0047] In view of the SNP difference, a pair of KASP primers KASP-Ms16 were designed. The specific sequences of the primers are as follows:

[0048] KASP-Ms16 F1:5'- GAAGGTGACCAAGTTCATGCT GTGGAGTACCTCCCCAACG-3'(SEQ IDNO.2);

[0049] KASP-Ms16 F2:5'- GAAGGTCGGAGTCAACGGATT GTGGAGTACCTCCCCAACA-3'(SEQ IDNO.3);

[0050] KASP-Ms16 R: 5'-CGGGCGGCCGCAGATGTGCT-3' (SEQ ID NO. 4).

[0051] In the above primer sequences, KASP-Ms16 F1 and KASP-Ms16 F2 are upstream primers, the underlined part is the universal fluorescent linker sequence, the 5' end of KASP-Ms16 F1 is connected to the HEX fluorescent group, and the 5' end of KASP-Ms16 F2 is connected to the FAM fluorescent group; the bold part at the 3' end is the typing site sequence. KASP-Ms16 R is a universal downstream primer. The target fragment amplified is: GTGGAGTACCTCCCCAACRAGCACATCTGCGGCCGCCCG (SEQ ID NO.5). "R" indicates that the base at this site is G or A.

[0052] The KASP primer KASP-Ms16 was used to perform fluorescence quantitative PCR amplification on all the individuals in the (ms16×B73)F2 population.

[0053] The amplification system is as follows: each 10 μL contains the following components: 2×Mix 5.0 μL, primer mixture 1.4 μL, ddH2O 2.6 μL, DNA template 100 ng. The primer mixture is mixed according to the volume ratio of upstream primer F1: upstream primer F2: downstream universal primer R: water = 1:1:2.5:3.8. The DNA template is extracted from corn leaves using the CTAB method.

[0054] The amplification program was: 94°C for 15 min; 94°C for 20 s, 65°C for 1 min, 10 cycles; 94°C for 20 s, 55°C for 1 min, 30 cycles; 37°C for 1 min to collect signals. Genotyping was performed based on the collected signals. The results are shown in Figure 2. Figure 3As shown, the green fluorescent signal close to the X-axis is the AA genotype, the blue fluorescent signal close to the Y-axis is the GG genotype, and the orange fluorescent signal in the middle is the GA genotype. The genotyping analysis results showed that all exchanged plants were co-segregated with the SNP.

[0055] 4. Functional verification of the sterility gene Ms16

[0056] In order to determine whether the mutant phenotype of mutant ms16 is caused by the mutation of the key candidate gene Zm00001d034032, the inventors purchased a transposon mutant of the Zm00001d034032 gene from the maize transposon mutant library and named it ms16-mut. The mutant transposon was inserted at 244 bp of the first exon (see Figure 4 a), the anther fertility of the mutant F2 population was investigated, and it was found that 3 of the 18 plants showed no anther exposure. The anthers of these 3 plants could not be stained by I2-KI staining. These 3 sterile plants were hybridized with corn individuals of the GA genotype (Ms16 / ms16) for allelic analysis, and it was found that the hybrid offspring had sterile plants ( Figure 4 b). This result proves that the mutant phenotype of mutant ms16 is caused by the mutation of the target gene Zm00001d034032.

[0057] The target gene Zm00001d034032 is a gene encoding an atypical isocarp synthase, and the location of the gene on the chromosome is: B73_RefGen_v4 Chr1: 281626478-281630659. The mutation of this gene will lead to the loss of its function, and eventually the male ear of corn will be aborted. Therefore, this gene was identified as a new nuclear male sterility gene and named Ms16.

[0058] Example 3 Verification of molecular markers of maize nuclear male sterility gene Ms16 and its application in sterile seed production

[0059] 1. Build a group

[0060] The male sterile mutant ms16 was used as the female parent and the maize inbred line B73 was used as the male parent. F1 was obtained by hybridization, and F2 ((ms16×B73)F2) was obtained by self-pollination. The F2 population showed fertility trait segregation.

[0061] 2. Identification of fertility genotypes at the seedling stage

[0062] At the seedling stage, leaves of individual plants in the F2 population were taken, and leaf DNA was extracted using the CTAB method. Fluorescence quantitative PCR amplification was performed using corn leaf DNA as a template and KASP-Ms16 designed in Example 2 as a primer.

[0063] The amplification system is as follows: each 10 μL contains the following components: 2×Mix 5.0 μL, primer mixture 1.4 μL, ddH2O 2.6 μL, DNA template 100 ng. The primer mixture is mixed according to the volume ratio of upstream primer F1: upstream primer F2: downstream universal primer R: water = 1:1:2.5:3.8. The DNA template is extracted from corn leaves using the CTAB method.

[0064] The amplification program is: 94℃15min; 94℃20s, 65℃1min, 10 cycles; 94℃20s, 55℃1min, 30 cycles; 37℃1min signal collection. Genotyping is performed based on the collected signals. The green fluorescent signal close to the X-axis is the AA genotype, the blue fluorescent signal close to the Y-axis is the GG genotype, and the orange fluorescent signal in the middle is the GA genotype.

[0065] 3. Fertility field survey

[0066] During the pollination period, the fertility of each individual plant in the (ms16×B73)F2 segregating population was investigated. Some of the investigation results are shown in Table 2.

[0067] Table 2 Genotypes and fertility results of some individual plants in the (ms16×B73) F2 segregating population

[0068] Plant number genotype Are the anthers fertile? Plant number genotype Are the anthers fertile? 1 AA Infertility 15 GA Fertile 2 GG Fertile 16 GA Fertile 3 GA Fertile 17 GA Fertile 4 GA Fertile 18 AA Infertility 5 AA Infertility 19 GG Fertile 6 GA Fertile 20 GA Fertile 7 GA Fertile 21 GA Fertile 8 GA Fertile 22 GA Fertile 9 GG Fertile 23 AA Infertility 10 GA Fertile 24 GG Fertile 11 GA Fertile 25 AA Infertility 12 AA Infertility 26 AA Infertility 13 GG Fertile 27 GA Fertile 14 GG Fertile 28 GA Fertile

[0069] Combined with the genotype identification results, it was found that in the (ms16×B73)F2 segregation population, individual plants with genotypes of GG or GA were fertile, while individual plants with genotypes of AA were sterile.

[0070] The above proves that the target fragment amplified by primer KASP-Ms16 has a complete linkage between the genotype and phenotype of the SNP site, and the sequence fragment shown in SEQ ID NO.5 can be used as a molecular marker to identify the male nuclear sterility trait of corn. Primer KASP-Ms16 can be used to identify the fertility of corn seedlings, and sterile individuals can be screened according to the identification results for sterile line seed production.

[0071] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker tightly linked to the maize nuclear male sterility gene Ms16, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.5; there is a SNP site at the 19bp of the nucleotide sequence shown in SEQ ID NO.5, the base types of the SNP site include G and A, and the genotypes include GG, GA and AA; the nucleotide sequence of the corn nuclear male sterility gene Ms16 is shown in SEQ ID NO.

1.

2. A primer combination for detecting the molecular marker according to claim 1, characterized in that: It comprises an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream universal primer R with a nucleotide sequence as shown in SEQ ID NO.

4.

3. A reagent or kit for detecting the molecular marker according to claim 1, characterized in that: Comprising the primer combination described in claim 2.

4. Use of the primer combination according to claim 2 or the reagent or kit according to claim 3 in early corn fertility identification, characterized in that: The corn fertility includes corn male sterility and male fertility.

5. A method for early identification of corn fertility, characterized in that: The following steps are involved: Using the genomic DNA of the corn to be tested as a template, using the primer combination of claim 2 or the reagent or kit of claim 3 to perform fluorescent quantitative PCR amplification on the template, converting the fluorescent signal into a genotype, and judging the fertility of the corn to be tested according to the genotype; Corn with genotype GG or GA is male fertile; corn with genotype AA is male sterile.

6. The method according to claim 5, characterized in that The amplification system of the fluorescent quantitative PCR amplification is: 2×Mix 5.0 μL, primer mixture 1.4 μL, ddH2O 2.6 μL, DNA template 100 ng; The primer mixture is prepared by mixing upstream primer F1: upstream primer F2: downstream universal primer R: water in a volume ratio of 1:1:2.5:3.

8.

7. The method according to claim 5, characterized in that The amplification program of the fluorescent quantitative PCR amplification is: 94°C for 15 min; 94°C for 20 s, 65°C for 1 min, 10 cycles; 94°C for 20 s, 55°C for 1 min, 30 cycles; 37°C for 1 min.

8. Use of the primer combination according to claim 2 or the reagent or kit according to claim 3 in breeding maize male sterile lines.

9. Use of the primer combination according to claim 2 or the reagent or kit according to claim 3 in molecular marker-assisted breeding of male sterile corn.

Images