A method for preventing gene drift of transgenic fluorescent ornamental fish

The vasa gene of transgenic fluorescent fish was knocked out using CRISPR/Cas9 technology to produce infertile F2 generation homozygotes, solving the problem of gene drift in transgenic fluorescent ornamental fish and protecting the property rights of wild populations and transgenic fish.

CN118556652BActive Publication Date: 2025-10-14XIAMEN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410767578.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-14
Publication Date
2025-10-14
Estimated Expiration
2044-06-14

AI Technical Summary

Technical Problem

The popularization of genetically modified fluorescent ornamental fish in the aquarium trade has led to the problem of gene drift, which has caused the transmission of genetically modified characteristics to wild populations and caused unpredictable impacts on the ecosystem.

Method used

By designing specific knockout targets, the vasa gene of transgenic fluorescent fish was knocked out using CRISPR/Cas9 technology, producing fertile F1 generation heterozygotes. The F1 generation heterozygotes were then self-pollinated to produce F2 generation homozygotes, ensuring that the F2 generation individuals were infertile, thereby preventing gene drift.

Benefits of technology

It effectively prevents transgenic fluorescent fish from mating with wild species, prevents gene drift, protects the property rights of transgenic fish, solves the problem of transgenic fish escape, and provides a method to prevent gene drift.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118556652B_ABST
    Figure CN118556652B_ABST
Patent Text Reader

Abstract

The application discloses a method for preventing gene drift of transgenic fluorescent ornamental fish, and belongs to the technical field of biotechnology. By designing a specific knockout target, a key gene vasa of fish reproductive development is knocked out by using CRISPR / Cas9 technology. After the knockout, the F0 generation chimeras are paired with wild type fish to generate fertile F1 generation heterozygotes. Then, the F1 generation heterozygotes are self-crossed to obtain F2 generation homozygotes. The homozygote phenotype is all male and sterile. By the method, a transgenic fluorescent ornamental fish family with vasa gene knockout can be constructed, and sterile male individuals are obtained. The method has great significance for preventing fluorescent gene drift of transgenic fish and protecting breeders' rights.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preventing gene drift of transgenic fluorescent ornamental fish. Background Art

[0002] CRISPR / Cas9 technology is the latest generation of gene editing technology, and its full name is Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / CRISPR-associated 9 (Cas9). This technology is cheap, convenient, simple to operate, and widely used, making it a very promising gene editing tool. CRISPR was first discovered in Escherichia coli and named "CRISPR" in 2000 (JANSEN R, EMBDEN JD, GAASTRA W, et al. Identification of genes that are associated with DNA repeats inprokaryotes [J]. Mol Microbiol, 2002, 43 (6): 1565-75). The commonly used CRISPR / Cas9 system consists of two parts: Cas9 and sgRNA. Under the guidance of sgRNA, the Cas9 protein can cut the double strand of target DNA, causing the insertion or deletion of bases, thereby achieving gene knockout.

[0003] The vasa gene, originally discovered in Drosophila melanogaster, plays a crucial role in the formation and development of Drosophila germ cells (SCHüPBACH T, WIESCHAUS E. Maternal-effect mutations altering the anterior-posterior pattern of the Drosophila embryo [J]. Rouxs Arch Dev Biol, 1986, 195(5):302-17). The vasa gene encodes an ATP-dependent RNA helicase, a member of the DEAD-box family, that is widely present in various organisms.

[0004] The vasa gene plays an important role in biological reproduction and is highly homologous and conserved. In fruit flies, silencing the expression of the vasa gene prevents the normal production of female eggs, resulting in female infertility. In zebrafish, knocking out the vasa gene results in male infertility (HARTUNG O, FORBES MM, MARLOW FL. Zebrafish vasa is required for germ-cell differentiation and maintenance [J]. Mol Reprod Dev, 2014, 81(10):946-61). In humans, in oligospermia, the expression level of the vasa gene is only 1 / 5 of that in normal individuals. This gene has been little studied in the marine model organism Oryzias melastigma.

[0005] Currently, genetically modified fish breeds are becoming increasingly widespread, including fast-growing salmon and loach, spiny-free Wuchang fish, and fluorescent ornamental fish. With the advancement of biotechnology, transgenic fluorescent ornamental fish are gaining popularity due to their unique fluorescent properties. However, the widespread adoption of these transgenic fish in the aquarium trade has also brought with it the issue of gene flow. Gene flow occurs when transgenic organisms mate with wild species, leading to the introduction of transgenic traits into wild populations and potentially causing unforeseen impacts on ecosystems. Effectively preventing the potential for genetic contamination from escaped transgenic fish during aquaculture has garnered widespread attention.

[0006] The black-spotted medaka has the advantages of fast reproduction, short growth cycle and in vitro fertilization, making it very suitable for gene editing. The establishment of a black-spotted medaka vasa gene knockout model can provide certain reference significance for solving the problem of escape of marine transgenic fish and the intellectual property protection of transgenic fish. Summary of the Invention

[0007] The present invention aims to address the existing problem of gene drift in transgenic fluorescent black-spotted medaka, which can lead to the spread of transgenic traits into wild populations. This method provides a method for preventing gene drift in transgenic fluorescent ornamental fish. By knocking out the vasa gene, this method prevents gene drift caused by mating between transgenic fluorescent fish and wild populations, thereby avoiding the harmful effects of gene drift and resolving the escape problem of transgenic marine fish.

[0008] To achieve the above objectives, the present invention adopts the following technical solutions.

[0009] A method for preventing gene drift in transgenic fluorescent ornamental fish involves designing a specific knockout target, utilizing CRISPR / Cas9 technology to knock out the vasa gene in the transgenic fluorescent fish, pairing the F0 generation with the wild type to produce fertile F1 generation heterozygotes, and then pairing the F1 generation heterozygotes to produce F2 generation homozygotes; the F2 generation homozygotes are infertile, thereby preventing gene drift in the transgenic fluorescent fish.

[0010] The method of knocking out the vasa gene of transgenic fluorescent fish using CRISPR / Cas9 technology comprises the following steps:

[0011] (1) Search the vasa gene sequence of transgenic fluorescent fish in the ensembl database;

[0012] (2) Design a knockout target site on the exon sequence after the ATG of the vasa gene, connect the target sequence to the pT7-gRNA vector, and perform sequencing verification;

[0013] (3) After determining the knockout target of the vasa gene, sgRNA was synthesized by in vitro transcription, and then the mixture of sgRNA, Cas9 protein and phenol red was injected into the fertilized eggs (1-2 cell stage) of transgenic fluorescent fish by microinjection;

[0014] (4) After 72 h, the genomic DNA of the injected transgenic fluorescent fish eggs was extracted, and mutants were screened by PCR combined with restriction endonuclease digestion and sequenced for verification;

[0015] (5) The F0 generation was cultured to sexual maturity and paired with the wild type to screen out the F1 generation heterozygotes. The heterozygotes with the same mutation type were paired to produce the F2 generation homozygotes. It was found that all homozygous individuals appeared male;

[0016] (6) The infertility of F2 homozygous individuals was further confirmed by histology and statistical analysis of the fertilization rate of eggs obtained by pairing F2 homozygous individuals with wild type individuals.

[0017] The present invention also provides a specific target site for knocking out the vasa gene of the black-spotted medaka, which is located on the seventeenth exon of the vasa gene sequence of the black-spotted medaka. The base sequence of the target site is shown in SEQ ID NO.1 in the sequence listing.

[0018] The specific target for knocking out the black-spotted medaka vasa gene is used for knocking out the vasa gene of the black-spotted medaka using CRISPR / Cas9 technology to prevent gene drift of the transgenic fluorescent black-spotted medaka.

[0019] Compared with the prior art, the present invention has the following outstanding advantages and technical effects:

[0020] The present invention discloses a method for preventing gene drift in transgenic fluorescent ornamental fish. By designing a specific knockout target, CRISPR / Cas9 technology is used to knock out the vasa gene, a key gene for fish reproductive development. After the knockout, the F0 generation chimeras are paired with wild-type fish to produce fertile F1 generation heterozygotes. The F1 generation heterozygotes are then self-pollinated to produce F2 generation homozygotes, all male and sterile. This method can be used to construct a transgenic fluorescent fish lineage with the vasa gene knockout and obtain sterile male individuals, effectively preventing gene drift caused by mating transgenic fluorescent fish with wild species. This method is of great significance for preventing fluorescent gene drift in transgenic fish and protecting variety rights. The present invention verifies the feasibility of knocking out the vasa gene in marine fish, providing certain help and reference for solving the escape problem and property rights issues of transgenic marine fish. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Figure 4. Target design and detection for the vasa gene knockout in the black-spotted medaka. Figure A shows a schematic diagram of the vasa gene knockout target design and detection in the black-spotted medaka. The numbers in the squares represent exon numbers, and the white boxes represent 3'UTR sequences. The black arrows indicate the knockout target design locations. F and R represent the detection primers for the knockout targets, and the numbers in the middle represent the sizes of the PCR products. Figure B shows the vasa gene knockout verification. In the figure, M represents a 2000bp marker, WT represents the wild-type genomic PCR product, 1-4 represents the NcoI-digested F0 embryo genomic PCR product, and the black overline indicates that the PCR sample has been digested with the NcoI restriction endonuclease. Figure C shows the vasa gene knockout type. In the figure, WT represents the wild-type vasa gene sequence, and Mutation represents the base sequence after vasa gene knockout. The red underline indicates the knockout target sequence, the black overline indicates the NcoI restriction site, the blue portion indicates the PAM sequence, and the black dashed line indicates the bases deleted after vasa gene knockout.

[0022] Figure 2 This figure compares the fertility of homozygous and heterozygous males of the vasa gene knockout, as well as common black-spotted medaka males. The data in the figure show the fertilization rates of eggs laid by homozygous and heterozygous males of the vasa gene knockout, common black-spotted medaka males, and wild-type black-spotted medaka females, respectively. Data were analyzed using the t-test. **** indicates a highly significant difference (p<0.0001). Data are presented as mean ± SEM. N = 3.

[0023] Figure 3Anatomical diagrams and histological observations of homozygous and heterozygous males with vasa gene knockout and wild-type male black-spotted medaka. Figures A: Side view of a male black-spotted medaka with no vasa gene knockout, B: Side view of a male black-spotted medaka with vasa gene knockout heterozygous, and C: Side view of a male black-spotted medaka with vasa gene knockout homozygous. A', B', and C' are the corresponding anatomical diagrams of the black-spotted medaka, with the rostral tip facing left. The red dotted outline represents the testis. A", B", and C" are the corresponding testes of the black-spotted medaka. 40x images of paraffin sections of tissue; A'', B'', C'' are 100x images of paraffin sections of black-spotted medaka testis tissue corresponding to A', B', C'; the black solid line in the lower right corner of A', B', C' is the scale bar, size 1mm; the black solid line in the lower right corner of A", B", C" is the scale bar, size 15μm; the black solid line in the lower right corner of A'', B'', C'' is the scale bar, size 5μm. DETAILED DESCRIPTION

[0024] The present invention is described in detail below with reference to the embodiments. The following experiments will help those skilled in the art to further understand the present invention. Without departing from the concept of the present invention, several adjustments and improvements can be made, which all fall within the scope of protection of the present invention.

[0025] The present invention discloses a method for preventing gene drift in transgenic fluorescent ornamental fish. The method utilizes CRISPR / Cas9 technology to knock out the vasa gene in the transgenic fluorescent fish by designing a specific knockout target. The F0 generation is then paired with wild-type individuals to produce fertile F1 generation heterozygotes. The F1 generation heterozygotes are then paired to produce F2 generation homozygotes. The F2 generation homozygotes are infertile, thereby preventing gene drift in the transgenic fluorescent fish. The specific steps include:

[0026] (1) Search the vasa gene sequence of transgenic fluorescent fish in the ensembl database;

[0027] (2) Design a knockout target site on the exon sequence after the ATG of the vasa gene, connect the target sequence to the pT7-gRNA vector, and perform sequencing verification;

[0028] (3) After determining the knockout target of the vasa gene, sgRNA was synthesized by in vitro transcription, and then the mixture of sgRNA, Cas9 protein and phenol red was injected into the fertilized eggs (1-2 cell stage) of transgenic fluorescent fish by microinjection;

[0029] (4) After 72 h, the genomic DNA of the injected transgenic fluorescent fish eggs was extracted, and mutants were screened by PCR combined with restriction endonuclease digestion and sequenced for verification;

[0030] (5) The F0 generation was cultured to sexual maturity and paired with the wild type to screen out the F1 generation heterozygotes. The heterozygotes with the same mutation type were paired to produce the F2 generation homozygotes. It was found that all homozygous individuals appeared male;

[0031] (6) The infertility of F2 homozygous individuals was further confirmed by histology and statistical analysis of the fertilization rate of eggs obtained by pairing F2 homozygous individuals with wild type individuals.

[0032] Transgenic fluorescent fish are organisms created through genetic engineering to emit fluorescence. These transgenic animals have a variety of applications in scientific research, including as biomarkers to study gene expression, cellular processes, and biological properties, as well as for drug screening and toxicity testing. When designing a specific target for vasa gene knockout, the basic design principles and steps remain the same.

[0033] Taking the black-spotted medaka as an example, a specific target for knocking out the vasa gene in the black-spotted medaka was designed, and the vasa gene in the transgenic fluorescent black-spotted medaka was knocked out using CRISPR / Cas9 technology. The F0 generation was paired with the wild type to produce fertile F1 generation heterozygotes, and then the F1 generation heterozygotes were paired to produce F2 generation homozygotes; the F2 generation homozygotes were infertile, thus preventing gene drift in the transgenic fluorescent black-spotted medaka.

[0034] The specific target site for knocking out the vasa gene of the black-spotted medaka is located on the seventeenth exon of the vasa gene sequence of the black-spotted medaka. The base sequence of the target site is shown in SEQ ID NO.1 in the sequence listing.

[0035] 1. Experimental Materials

[0036] The transgenic fluorescent black-spotted medaka (Tg: pminiTol2-mlc2f-mCherry) used in this example was laboratory-generated and can be prepared according to the method for preparing transgenic fluorescent black-spotted medaka disclosed by the present applicant in CN201710239770.5.

[0037] 2. Experimental methods

[0038] 2.1 sgRNA synthesis and purification

[0039] (1) Target design

[0040] a. Download the sequence: Search and download the gene sequence of the black-spotted medaka vasa from the Ensembl database (https: / / www.ensembl.org / index.html). The sequence number is ENSOMEG00000010651.

[0041] b. Target design: independently design the knockout target, design the target after the exon sequence of the vasa gene ATG, the target design is shown in FIG. A of Figure 1

[0042] (2) Target sgRNA synthesis

[0043] The pT7-gRNA plasmid is digested with restriction endonuclease BglII and SacI, the target fragment is purified and recovered, and the recovered product is digested with restriction endonuclease BsmBI. The recovered digestion product is a pT7-gRNA vector with sticky ends. Design primers to introduce the BsmBI restriction endonuclease digestion site at both ends of the sgRNA target sequence, i.e. the upper primer sequence is: taggCTTGGTCTCCACGAACACCA (SEQ ID NO. 2), and the lower primer sequence is: aaacTGGTGTTCGTGGAGACCAAG (SEQ ID NO. 3). After annealing at room temperature, use T4 ligase of NEB company to ligate the secondary digested pT7-gRNA vector, transform, plate, pick single colonies, use detection primers pT7-F: AGCGGATAACAATTTCACACAGG (SEQ ID NO. 4) and pT7-R: GATCCGCACCGACTCGGT GCCACT (SEQ ID NO. 5) to screen positive clones, and extract plasmids. Use primers pT7-F and pT7-R to amplify the target fragment with T7 promoter, cut the gel to recover the target band, and synthesize vasa gene knockout sgRNA by in vitro transcription according to the MEGAshortscriptTM Transcription T7 kit instructions.

[0044] (3) Target sgRNA purification

[0045] Use 2.5M LiCl to precipitate and purify the recovered sgRNA, and store the recovered product at -80°C after measuring the concentration by Nanodrop for standby use.

[0046] 2.2, Microinjection

[0047] ​The medaka used in this experiment were transgenic fluorescent black-spotted medaka (Tg:pminiTol2-mlc2f-mCherry) engineered in our laboratory. The evening before microinjection, females and males were placed in a breeding tank at a 1:1 ratio, separated by a partition. The partition was removed on the morning of injection. After the females laid eggs, fertilized eggs were collected and incubated at 28°C. The fertilization and developmental stages were then observed using a stereomicroscope. When the animal pole of the zygote began to bulge, a mixture of sgRNA (50 ng / μL) and Cas9 protein (200 ng / μL) was injected into the animal pole of the zygote using a microsyringe. Injection was maintained at the 1- to 2-cell stage.

[0048] 2.3 Knockout Detection

[0049] a. Extract genomic DNA from fish eggs. For every five eggs, add 100 μL of 50 mM NaOH and incubate at 95°C for 10 min. Vortex and briefly centrifuge. Add 10 μL of 1 M Tris·HCl, vortex to mix, and centrifuge.

[0050] b. PCR amplification of the target fragment: Use detection primer F: TCACGAAGTTCAACAAGCGG (SEQ ID NO. 6) and detection primer R: GATCCAAAAGCGGACCCTGA (SEQ ID NO. 7) to amplify the target fragment.

[0051] c. Enzyme digestion detection of mutants

[0052] The PCR product was digested with restriction endonuclease NcoI, and the digested product was subjected to gel electrophoresis. The number and size of the bands were used to determine whether the gene knockout occurred. Taking the knockout target site 2 located in exon 17 as an example, the PCR product before NcoI digestion was a single band with a size of 587 bp (e.g. Figure 1 Figure B in Figure 1 shows the number 1 band); if the gene is not knocked out, two bands will appear after enzyme digestion (such as Figure 1 Figure B in Figure 2 shows bands 3 and 4). If the gene is knocked out, three bands will appear after enzyme digestion (as shown in Figure 3). Figure 1 Subsequently, the knockout PCR product was recovered by gel excision, ligated to the pMD19-T vector, and sequenced to obtain the mutant sequence information ( Figure 1 A total of 50 chimeras were screened, and 11 F0 chimeras were identified, of which 4 were heritable.

[0053] 2.4. F2 generation homozygote screening

[0054] The F0 generation chimeras were raised for about 4 months until sexual maturity, and then paired with wild-type fish to produce F1 generation heterozygotes. A total of 185 fish were screened, of which 24 were F1 generation heterozygotes. Subsequently, the F1 generation heterozygote male and female fish with the same deletion type were mated to produce F2 generation homozygotes. A total of 84 fish were screened, of which 23 were homozygotes, 40 were heterozygotes, and 21 were not knocked out individuals.

[0055] 2.5. Phenotypic analysis of F2 generation homozygotes

[0056] All F2 homozygotes were male, and the fertility of F2 homozygotes was tested by pairing them with wild-type females and analyzing the fertilization rate. - / - ) male fish, heterozygous male fish (vasa + / -) and common black-spotted medaka males (vasa + / + ), each group was divided into 3 tanks (n=3), and one male fish was paired with one non-knockout female fish in each tank. The spawning situation within 10 days was counted and analyzed. Figure 2 Vasa gene knockout homozygotes (vasa - / - ) male fish, heterozygous male fish (vasa + / -) and common black-spotted medaka males (vasa + / + ) and the fertilization rate of eggs laid by wild-type black-spotted medaka females. Figure 2 As can be seen, the fertilization rate of eggs produced by F2 homozygous (vasa knockout) males paired with wild-type females was zero, indicating that the reproductive capacity of homozygous males was severely affected, possibly due to severe defects in sperm quantity or function. The fertilization rate of eggs from the control group (WT males and F2 heterozygous males) paired with wild-type females was higher, indicating that these males had normal or near-normal reproductive capacity. The fertility of F2 homozygous males was significantly different from that of the control group, indicating that vasa knockout has a significant negative impact on male reproductive capacity.

[0057] Figure 3 Images demonstrate the appearance, anatomical structure, and histological characteristics of the testes of male black-spotted medaka of different genotypes. Dissection and histological analysis of gonadal changes revealed that the testes of homozygous F2 individuals were significantly smaller and transparent, indicating significant changes in their volume and structure. Histological sections revealed the absence of mature germ cells in the testes of homozygous F2 individuals, further confirming the reduced reproductive capacity caused by vasa gene knockout.

[0058] Experiments have shown that male fish homozygous for the vasa gene knockout have severe fertility problems, as evidenced by a zero fertilization rate for eggs produced when paired with wild-type females, and significant degeneration and dysfunction of their testicular structures, indicating infertility in the F2 generation. The vasa gene plays an important role in spermatogenesis and reproduction in black-spotted medaka. In the case of transgenic fluorescent black-spotted medaka, vasa gene knockout leads to decreased reproductive capacity. In the wild, these transgenic fish encounter reproductive difficulties, and infertility deprives them of the opportunity to pass on transgenic traits to their offspring. This vasa gene knockout helps reduce the spread of transgenic traits in natural populations, effectively preventing the occurrence of gene drift. The present invention provides a new approach to preventing gene drift in transgenic fluorescent black-spotted medaka, and provides an important reference for preventing gene drift in transgenic fluorescent ornamental fish.

[0059] The above embodiments are only preferred embodiments of the present invention and should not be considered to limit the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. A method for preventing gene drift in transgenic fluorescent ornamental fish, characterized in that By designing a specific knockout target, CRISPR / Cas9 technology was used to knock out the transgenic fluorescent fish. vasa Gene, the F0 generation is paired with the wild type to produce fertile F1 generation heterozygotes, and then the F1 generation heterozygotes are paired to produce F2 generation homozygotes; The F2 generation homozygous individuals are sterile, thus preventing the gene drift of transgenic fluorescent fish; The method of knocking out transgenic fluorescent fish by using CRISPR / Cas9 technology vasa Gene, including the following steps: (1) Search for transgenic fluorescent fish in the ensembl database vasa Gene sequence; (2) Design knockout targets. vasa Design the target site on the exon sequence after the gene ATG, connect the target site sequence to the pT7-gRNA vector, and perform sequencing verification; (3) Determine vasa After knocking out the target gene, sgRNA is synthesized by in vitro transcription, and then a mixture of sgRNA, Cas9 protein, and phenol red is injected into the fertilized eggs of transgenic fluorescent fish by microinjection; the injection stage is maintained within the 1-2 cell stage; (4) After 72 hours, the genomic DNA of the injected transgenic fluorescent fish eggs was extracted, and mutants were screened by PCR combined with restriction endonuclease digestion, and then sequenced for verification; (5) The F0 generation was cultured to sexual maturity and paired with the wild type to screen out the F1 generation heterozygotes. The heterozygotes with the same mutation type were paired to produce the F2 generation homozygotes. It was found that all homozygous individuals were males. (6) Further confirm the infertility of F2 homozygous individuals through histology and statistical analysis of the fertilization rate of eggs obtained by pairing F2 homozygous individuals with wild-type individuals; Designing a black-spotted medaka vasa The specific target of gene knockout is located in the black-spotted medaka vasa The base sequence of the target point is shown in the sequence listing SEQ ID NO.

1.

2. A method for preventing gene drift in transgenic fluorescent ornamental fish according to claim 1, characterized in that The black-spotted medaka vasa Specific targets for gene knockout are used for CRISPR / Cas9 technology to knock out the black-spotted medaka vasa Gene to prevent gene drift in transgenic fluorescent black-spot medaka.

Citation Information

Patent Citations

  • Preparation method of transgenic oryzias melastigma

    CN106995823A

  • Method for creating rice engineering maintainer lines preventive against gene flow and application of rice engineering maintainer lines

    CN105063083A

  • Establishing method for fish male sterile model

    CN109402170A