Nucleic acid aptamers for recognizing simethoprim, terbutaline and amethoxazole and screening method

Abstract

The present invention belongs to the technical field of small molecule pollutant detection, and discloses a nucleic acid aptamer and screening method for identifying simethoprim, terbutryn and amethoprim, and the sequence of the nucleic acid aptamer is SEQ ID NO.1. The screening method comprises: designing an initial library and renaturing it, incubating a mixed solution of simethoprim, terbutryn and amethoprim as a target to obtain an initial library; performing PCR amplification, centrifugation, concentration, and dialysis on the initial library to obtain a new single-stranded library; performing 7 rounds of screening in total, and performing reverse screening from the third round of screening; performing PCR amplification, recovery and purification on the library screened in 7 rounds, and performing high-throughput sequencing analysis on the purified libraries at all levels. The present invention screens out nucleic acid aptamers for simethoprim, terbutryn and amethoprim through exponential enrichment ligand system evolution technology combined with specific positive screening and reverse screening strategies, thereby solving technical problems such as inconvenience in the method for detecting triazine herbicides.

Description

Technical Field

[0001] The present invention belongs to the technical field of small molecule pollutant detection, and in particular relates to nucleic acid aptamers for identifying simetryn, terbutaline and ametryn and a screening method. Background Art

[0002] With the development of agricultural activities, traditional weed control methods have been replaced by herbicides, especially triazine herbicides, which have become the most commonly used herbicides. More than 70% of triazine herbicides have good stability (average half-life of about 10 days), and will enter the environment with water circulation after use, resulting in frequent detection in the environment. At the same time, these herbicides are fat-soluble and can accumulate in organisms, resulting in the detection of herbicides in organisms. At the same time, studies have found that triazine herbicides are extremely toxic and can cause serious harm to organisms and the environment. Therefore, it is crucial to establish corresponding detection methods.

[0003] At present, triazine herbicides are mainly detected by liquid chromatography and gas chromatography. Although these methods have high sensitivity, they require relatively expensive equipment and complex pre-treatment technology, and are resource- and labor-intensive detection methods. Common and simple immunological detection technologies require the transformation of small molecules first, lack guiding theories, and have the risk of transformation failure. At the same time, there are many types of triazine herbicides, and it is impossible to develop one-to-one corresponding antibodies. Universal antibodies have different recognition of different herbicides, so it is difficult to establish an effective immunological detection method.

[0004] Aptamers are single-stranded nucleic acid sequences that can be folded into a variety of structures including stem loops and concave loops through intermolecular interactions. They can recognize substances with similar structures by binding to specific groups. Aptamers are mainly screened through the systematic evolution of ligands by exponential enrichment (SELEX) technology. Aptamers have the advantages of easy synthesis, labeling and modification, low toxicity, and good biochemical stability. Aptamers are considered to be substitutes for antibodies and have been used to establish a variety of detection methods including biosensors. Although aptamers have the above advantages, only aptamers for atrazine and promethazine have been prepared so far, and no aptamers that can bind to other triazine herbicides have been found.

[0005] Through the above analysis, the problems and defects of the existing technology are as follows: (1) The current method of using liquid chromatography and gas chromatography to detect triazine herbicides requires relatively expensive equipment and complex pre-treatment technology, which is costly and cumbersome to operate. (2) Immunological detection technology lacks guiding theory and there is a risk of transformation failure; and universal antibodies have different recognition of different herbicides, making it difficult to establish an effective immunological detection method. (3) There is no report on nucleic acid aptamers that can bind to other triazine herbicides in the existing technology.

[0006] The existing detection technology requires expensive equipment and complicated steps. The key to establishing a quick detection method is to find an excellent recognition element. However, such an element is currently lacking. The present invention obtains an excellent nucleic acid aptamer that can simultaneously recognize three herbicides through nucleic acid aptamer screening. Summary of the invention

[0007] In order to overcome the inconvenience and other problems existing in the related methods for detecting triazine herbicides, the disclosed embodiments of the present invention provide nucleic acid aptamers and screening methods for identifying simethoprim, terbutaline and ametryn, and the technical scheme is as follows:

[0008] A nucleic acid aptamer for recognizing simethoprim, terbutaline and ametryn. The sequence of the nucleic acid aptamer is used as a recognition element. By establishing a lateral flow chromatography test strip, the detection development of a biosensor is realized, and the biosensor is used for detecting food, aquatic products and medicinal materials. The sequence of the nucleic acid aptamer is SEQ ID NO.1.

[0009] Another object of the present invention is to provide a screening method for screening the nucleic acid aptamers that recognize simetryn, terbutaline and ametryn, characterized in that the screening method comprises:

[0010] S1, design of initial library;

[0011] S2, primary screening: After the initial library is dissolved, it is renatured using a PCR instrument, and a mixed solution of simethoprim, terbutaline and amethoxazole is incubated as a target to obtain a primary screening nucleic acid aptamer library;

[0012] S3, secondary library preparation: the initial library obtained by screening is amplified by PCR, centrifuged, concentrated, and dialyzed overnight. The next day, the solution in the dialysis bag is collected as a new single-stranded library for the next round of screening;

[0013] S4, multiple screening: Based on the first round of screening, a total of 7 rounds of screening were performed, among which counter-screening was performed from the third round of screening to remove nucleic acid aptamers with poor specificity;

[0014] S5, library sequencing: The libraries screened in 7 rounds were amplified by PCR. After the PCR, each library was recovered and purified, and the purified libraries at each level were subjected to high-throughput sequencing analysis.

[0015] In step S1, the sequence of the initial library is SEQ ID NO. 2;

[0016] The primers for nucleic acid aptamer screening include S1-CS, whose nucleotide sequence is SEQ ID NO.3; S1-FAM, whose nucleotide sequence is SEQ ID NO.4; A2-ployA, whose nucleotide sequence is SEQ ID NO.5; QP-S1, whose nucleotide sequence is SEQ ID NO.6; and QP-A2, whose nucleotide sequence is SEQ ID NO.7.

[0017] In step S2, the initial screening includes:

[0018] After dissolving 1OD of the initial library in a 1mL sterilized EP tube using 0.1M PBS, add 14μL of 100μM primer S1-CS dissolved in advance; use a PCR instrument for slow denaturation; after denaturation, add 1mL of streptavidin magnetic beads and incubate for 30min, then wash the coupled magnetic beads 6 times with 0.1M PBS solution; incubate the mixed solution of simethoprim, terbutaline and amethoxazole as a target for 30min; then use a magnet to fish the magnetic beads, and collect the supernatant solution to obtain the primary screening nucleic acid aptamer library.

[0019] Further, 0.1 M PBS includes 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4;

[0020] The renaturation procedures were 95°C, 10 min; 60°C, 1 min; 25°C, 1 min; and the cooling rate was 0.1°C / min.

[0021] In step S3, secondary library preparation includes:

[0022] The initial library obtained by screening was amplified by PCR; after the amplification PCR was completed, the PCR products were collected, 5 volumes of n-butanol were added and centrifuged at 8000rpm for 1 min, and the solution showed obvious stratification; the supernatant was discarded, and the lower layer solution was concentrated to 0.1 mL, and an equal volume of 2X TBE-Urea loading buffer was added, and after boiling for 10 min, 8% urea denaturing PAGE was used for separation at a voltage of 300 V and a time of 45 min;

[0023] Under the irradiation of ultraviolet light, the fluorescent band was cut out, and the band was placed in 4mL PBS solution and boiled for 10 minutes. After collecting the supernatant, the solution was concentrated again with n-butanol. After repeated several times, the sample volume was concentrated to 0.1mL, and the concentrated solution was placed in a dialysis bag and dialyzed in PBS solution at 4°C overnight; the next day, the solution in the dialysis bag was collected as a new single-stranded library for the next round of screening; at the same time, 9mL of emulsion was added to the PCR system starting from the third round for emulsion PCR amplification; after the PCR amplification was completed, the emulsion was broken by centrifugation at 12000rpm, concentrated with n-butanol and separated using urea denatured PAGE.

[0024] Further, the initial library obtained by screening was subjected to PCR amplification, including: amplification conditions: pre-denaturation at 95°C for 5 min, 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles, 72°C for 5 min;

[0025] The emulsion is 73% Tegosoft, 20% mineral oil, 7% ABIL WE;

[0026] The emulsion PCR amplification conditions were as follows: pre-denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min, and finally 72°C for 5 min.

[0027] In step S4, multiple screenings are performed, including:

[0028] After adding 200 μL of a 100 μM mixed solution of propanone and propazine to the aptamer library immobilized on the magnetic beads and incubating for 30 min, the eluate was collected and recorded as Elution 1; after washing 6 times, a mixed solution of simethoprim, terbutaline and ametryn was added and incubated for 30 min, and the eluate was collected and recorded as Elution 2; the results of each round of screening were monitored by RT-PCR and the retention rate after each round of screening was calculated.

[0029] In step S5, PCR amplification is performed, including: 25 μL 2×Pro Taq Master Mix, 2 μL template, 1 μL upstream primer, 1 μL downstream primer, and water is added to make up to 50 μL; the template is the library obtained in each round of screening, the upstream primer is 10 μM S1-FAM, and the downstream primer is 10 μM A2-ployA;

[0030] The reaction system was: pre-denaturation at 94°C for 5 min, 98°C for 10 s, 55°C for 30 s, 72°C for 1 min, 30 cycles, and 72°C for 5 min.

[0031] In step S5, each library is recovered and purified, including:

[0032] Add 450 μL Binding Buffer I and mix well, then transfer the mixed solution to the adsorption column, let it stand at room temperature for 2 minutes, and centrifuge it at 8000 rpm for 2 minutes; pour out the liquid in the collection tube and place the adsorption column in the same collection tube; add 500 μL Wash Solution to the adsorption column, centrifuge it at 10000 rpm for 1 minute, and repeat this step once; pour out the waste liquid in the collection tube, put the adsorption column in the same collection tube, and centrifuge it at 10000 rpm for 2 minutes; place the adsorption column in a clean 1.5 mL centrifuge tube, add 30-50 μL Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 5 minutes, centrifuge it at 10000 rpm for 2 minutes, and perform high-throughput sequencing analysis on the purified libraries at each level; among them, the single band of the 7-round library can be used for high-throughput sequencing results.

[0033] Combining all the above technical solutions, the beneficial effects of the present invention are as follows: the present invention screens out nucleic acid aptamers for simethoprim, terbutaline and amethoxazole through exponential enrichment ligand system evolution technology combined with specific positive screening and reverse screening strategies, thereby solving the technical problems such as the inconvenience of existing methods for detecting triazine herbicides. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The accompanying drawings herein are incorporated in and constitute a part of the specification, illustrate embodiments consistent with the present disclosure, and together with the description, serve to explain the principles of the present disclosure;

[0035] Figure 1 It is a flow chart of a method for screening nucleic acid aptamers for simultaneously identifying simethoprim, terbutaline and ametryn provided in an embodiment of the present invention;

[0036] Figure 2 It is a schematic diagram of a nucleic acid aptamer screening method for simultaneously identifying simethoprim, terbutaline and ametryn provided in an embodiment of the present invention;

[0037] Figure 3 is a schematic diagram of high-throughput sequencing results provided by an embodiment of the present invention;

[0038] Figure 4 Schematic diagram of the enrichment of the nucleic acid aptamer library provided in an embodiment of the present invention;

[0039] Figure 5 is a schematic diagram of affinity determination results provided by an embodiment of the present invention;

[0040] Figure 6 It is a standard curve diagram of the nanogold colorimetry provided by an embodiment of the present invention. DETAILED DESCRIPTION

[0041] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific implementation disclosed below.

[0042] The present invention provides a nucleic acid aptamer for recognizing simetryn, terbutryn and ametryn, the sequence of the nucleic acid aptamer is used as a recognition element, and a lateral flow chromatography test strip is established to realize the detection and development of a biosensor for detecting food, aquatic products and medicinal materials, and the nucleic acid aptamer sequence is SEQ ID NO. 1. Example 1, the nucleic acid aptamer sequence for simultaneously recognizing simetryn, terbutryn and ametryn provided in an embodiment of the present invention is SEQ ID NO. 1 (GACGCGAATAGCGGACCTATGTGTGGTGTGTTACGGCGAG).

[0043] like Figure 1 As shown, the nucleic acid aptamer screening method for simultaneously identifying simethoprim, terbutaline and amethoxazole provided in an embodiment of the present invention comprises the following steps:

[0044] S1, design the initial library, the initial library sequence is SEQ ID NO.2;

[0045] S2, primary screening: the initial library is dissolved and then renatured using a PCR instrument, and a mixed solution of simethoprim, terbutaline and amethoxazole is incubated as a target to obtain a primary screening nucleic acid aptamer library;

[0046] S3, secondary library preparation: the initial library obtained by screening is PCR amplified, centrifuged, concentrated, dialyzed overnight, and the solution in the dialysis bag is collected the next day as a new single-stranded library for the next round of screening;

[0047] S4, multiple screening: Based on the first round of screening, a total of 7 rounds of screening were performed, of which counter-screening was performed starting from the third round of screening to remove nucleic acid aptamers with poor specificity;

[0048] S5, library sequencing: The libraries screened in 7 rounds were amplified by PCR. After the PCR, each library was recovered and purified, and the purified libraries at each level were subjected to high-throughput sequencing analysis.

[0049] like Figure 2 As shown, the nucleic acid aptamers provided in the embodiment of the present invention are mainly screened by the capture SELEX method, and the specific screening process includes the following steps:

[0050] (1) Design of the initial library: The initial library sequence is SEQ ID NO.2 (5'-ATTGGCACTCCACGCATAGG-N(40)-CCTATGCGTGCTACCGTGAA-3'). N(40) is a random sequence, and both ends are primer binding regions, which are convenient for amplifying nucleic acid aptamers and hybridizing with biotin-labeled primer aptamers. The primer sequences are shown in Table 1.

[0051] Table 1 Primers for aptamer screening

[0052]

[0053] (2) Primary screening: First, 0.1M PBS (137mM NaCl, 2.7mM KCl, 4.3mM Na2HPO4, 1.4mM KH2PO4) was used to dissolve the 1OD initial library in a 1mL sterilized EP tube, and 14μL of 100μM primer S1-CS dissolved in advance was added. A PCR instrument was used for slow denaturation, and the denaturation program was 95℃, 10min; 60℃, 1min; 25℃, 1min; the above cooling rate was 0.1℃ / min. After the denaturation was completed, 1mL of streptavidin magnetic beads (Thermo Fisher Scientific, American) was added and incubated for 30min. After the coupled magnetic beads were washed 6 times with 0.1M PBS solution, a mixed solution of sildenafil, terbutaline and amethoxazole was incubated as a target for 30min. Then, a magnet was used to fish the magnetic beads, and the supernatant solution was collected to obtain the primary screening nucleic acid aptamer library.

[0054] (3) Preparation of secondary library: The initial library obtained by screening was subjected to PCR amplification. The PCR amplification system is shown in Table 2. The amplification conditions are: pre-denaturation at 95°C for 5 min, 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles, and 72°C for 5 min. After the PCR was completed, the PCR products were collected, 5 volumes of n-butanol were added, and centrifuged at 8000rpm for 1 min. The solution was clearly stratified. The supernatant was discarded, and the lower layer solution was concentrated to 0.1 mL. Then, an equal volume of 2X TBE-Urea loading buffer (Sangonbiotech, Shanghai) was added. After boiling for 10 min, 8% urea denaturing PAGE was used for separation. The voltage was 300 V and the time was about 45 min. Because the upstream primer of PCR had a green fluorescent marker and the downstream primer had a spacer arm, it would be divided into two single-stranded DNAs due to different molecular weights. The fluorescent band was cut under the irradiation of ultraviolet light, and the band was placed in 4 mL PBS solution and boiled for 10 min. After collecting the supernatant, the solution was concentrated again with n-butanol. After repeated several times, the sample volume was concentrated to about 0.1 mL. The concentrated solution was placed in a dialysis bag and dialyzed in a PBS solution at 4°C overnight. The solution in the dialysis bag was collected the next day as a new single-stranded library for the next round of screening. At the same time, in order to avoid the preferential amplification of PCR products, 9 mL of emulsion (73% Tegosoft, 20% mineral oil, 7% ABIL WE) was added to the common PCR system from the third round to perform emulsion PCR. The amplification conditions were: 95°C pre-denaturation for 5 min, 95°C for 1 min, 60°C for 1 min, 72°C for 1 min, 30 cycles, 72°C for 5 min. After the amplification, the emulsion was broken by centrifugation at 12000 rpm, and then concentrated with n-butanol and separated by urea denaturation PAGE.

[0055] Table 2 Common PCR reaction system

[0056]

[0057]

[0058] (4) Multiple screening: Referring to the first round of screening, a total of 7 rounds of screening were performed, wherein counter-screening was performed from the third round of screening to remove nucleic acid aptamers with poor specificity. The specific steps were as follows: 200 μL of a 100 μM mixed solution of propanone and propantheline was added to the nucleic acid aptamer library immobilized on the magnetic beads and incubated for 30 min, and the eluate was collected and recorded as Elution 1. After washing 6 times, a mixed solution of simethoprim, terbutaline and amethoxazole was added and incubated for 30 min, and the eluate was collected and recorded as Elution 2. Then, the results of each round of screening were monitored by RT-PCR and the retention rate after each round of screening was calculated.

[0059] (5) Library sequencing: The libraries screened in seven rounds were subjected to conventional PCR amplification. The amplification system was as follows: 25 μL 2× Pro Taq Master Mix (Takara, Shanghai), 2 μL template (library obtained in each round of screening), 1 μL upstream primer (S1-FAM, 10 μM), 1 μL downstream primer (A2-ployA, 10 μM), and water was added to make up to 50 μL; the reaction system was as follows: pre-denaturation at 94°C for 5 min, 98°C for 10 s, 55°C for 30 s, 72°C for 1 min, 30 cycles, and 72°C for 5 min. After PCR, use Shanghai Biotech's oligonucleotide purification kit to recover and purify each library. The specific method is to add 450μL Binding Buffer I and mix well, then transfer the mixed solution to the adsorption column, let it stand at room temperature for 2 minutes, and centrifuge it at 8000rpm for 2 minutes; pour out the liquid in the collection tube and put the adsorption column into the same collection tube; add 500μL Wash Solution to the adsorption column, centrifuge it at 10000rpm for 1 minute, and repeat this step once; pour out the waste liquid in the collection tube, put the adsorption column into the same collection tube, and centrifuge it at 10000rpm for 2 minutes; put the adsorption column into a clean 1.5mL centrifuge tube, add 30-50μL Elution Buffer to the center of the adsorption membrane, let it stand at room temperature for 5 minutes, and centrifuge it at 10000rpm for 2 minutes. The purified libraries at each level are subjected to high-throughput sequencing analysis. PCR results are as follows: Figure 3 As shown, the single band of the 7-round library can be used for high-throughput sequencing results.

[0060] (6) High-throughput results show that Figure 4 , the horizontal axis is the library to which the nucleic acid aptamer belongs after sequencing. A: the first round library; B: the second round library; C: the third round library; ...; G: the seventh round library. The vertical axis is the nucleic acid aptamer measured: from top to bottom, the first sequence, the second sequence, ..., the 32nd sequence. Figure 4 The color band on the right is the frequency of occurrence of each nucleic acid aptamer. The darker the color, the higher the frequency.

[0061] As the number of screening rounds progressed, multiple sequences were enriched, among which the highest T1 enrichment number was 1285. The present invention selected the three nucleic acid aptamers with the highest enrichment for subsequent experiments.

[0062] Example 2: The affinity of the nucleic acid aptamer provided in the embodiment of the present invention is mainly verified by nanogold colorimetry, and the specific method is as follows:

[0063] Step (1) preparing the nucleic acid aptamer solution of the present invention;

[0064] Step (2) preparing a gold nanoparticle solution;

[0065] Step (3) mixing and incubating the nucleic acid aptamer obtained in step (1) with the nanogold particle solution obtained in step (2);

[0066] Step (4) measuring and recording the absorbance of the solution obtained in step (3) at wavelengths of 530 nm and 650 nm, and calculating the ratio A1;

[0067] Step (5) incubating the solution obtained in step (3) with the sample to be tested, and then adding a NaCl solution not exceeding 0.0625%;

[0068] Step (6) measuring and recording the absorbance of the solution obtained in step (5) at wavelengths of 530 nm and 650 nm and calculating the ratio A2;

[0069] In step (7), a standard curve is prepared with the Log value of the added simetryn / terbutryn / ametryn concentration as the abscissa and the A2 value as the ordinate.

[0070] The preparation process of the gold nanoparticles provided in the embodiment of the present invention is as follows:

[0071] Nano-gold particles were prepared by sodium citrate reduction method. First, 100 mL of ultrapure water was heated to boiling, followed by the addition of 1 mL of 1% chloroauric acid solution, and 10 mL of 1% sodium citrate solution after 1 min. The solution turned from light yellow to gray and finally to wine red. After heating for 5 min, the heat source was turned off and cooled to room temperature.

[0072] The establishment process of the nanogold colorimetry provided by the embodiment of the present invention is as follows:

[0073] According to the high-throughput sequencing results, three sequences that were significantly enriched were selected, and the above sequences were synthesized by Shanghai Biotech and diluted to 10μM. Then 168μL of nanogold solution was added to a 96-well plate, followed by 2μL of 10μM nucleic acid aptamer, and incubated at room temperature for 30 minutes. Then, 30μL of different concentrations of simethoprim, terbutaline and amethoxazole solutions (15-2000ng / mL) were added respectively. After incubation at room temperature for 30 minutes, 10μL of 10% NaCl solution was added. After incubation at room temperature for 5 minutes, the OD values ​​at 530nm and 650nm were measured using an enzyme reader. According to the OD 530 / OD 650 Determine the affinity of the aptamer. Figure 5 The affinity determination results showed that T1 could simultaneously recognize simethoprim, terbutaline and amethoxazole.

[0074] The process of establishing the nanogold colorimetry standard curve provided by the embodiment of the present invention is as follows:

[0075] 2 μL of 10 μM nucleic acid aptamer was added to 168 μL of nanogold solution and incubated at room temperature for 5 min. Then, 30 μL of the sample to be tested and the standard were added. After incubation at room temperature for 5 min, 10% NaCl solution was added and color was developed for 10 min. The 530nm / 650nm OD value was measured. Figure 5 It is shown that the nucleic acid aptamer provided by the present invention can be used to establish a nanogold colorimetric method for simultaneously detecting simetryn, terbutryn and ametryn, wherein the detection ranges of simetryn and terbutryn are 125-2000 ng / mL, and the detection range of ametryn is 62.5-1000 ng / mL. Figure 6 This is a standard curve diagram of the nanogold colorimetry method established in an embodiment of the present invention.

[0076] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0077] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principles of the present invention should be covered within the protection scope of the present invention.

[0078]

[0079]

[0080]

[0081]

Claims

1. A nucleic acid aptamer for recognizing simethoprim, terbutaline and ametryn, characterized in that: The nucleic acid aptamer sequence is SEQ ID NO.

1.

2. A biosensor, characterized in that: The biosensor comprises the nucleic acid aptamer for recognizing simetryn, terbutaline and ametryn as claimed in claim 1.

3. A method for preparing a biosensor as claimed in claim 2, characterized in that: The preparation method of the biosensor comprises: using the sequence SEQ ID NO.1 of the nucleic acid aptamer according to claim 1 as a recognition element, and establishing a lateral flow chromatography test strip to realize the detection development of the biosensor.

4. Use of the biosensor as claimed in claim 2 in the detection of food, aquatic products and medicinal materials.

Images