Engineering strains for synthesizing spinosad by continuous gene editing via genome rearrangement

Abstract

The genome-rearranged gene continuous editing synthesis of spinosad engineered strains, from the genome-rearranged Saccharopolyspora spinosa mutants, pccB1 Genes and ectD Gene knockout and nasA The strain was obtained by gene overexpression; the growth ability of this strain was significantly stronger than that of the original strain, and the production of polysaccharide was significantly increased compared with the original strain.

Description

Technical Field

[0001] The present invention relates to an engineered strain for synthesizing spinosyn, and in particular to an engineered strain for synthesizing spinosyn through gene editing after genome rearrangement. Background Art

[0002] Spinosad is a new type of microbial insecticide with contact and feeding toxins produced by soil actinomycete Saccharopolyspora spinosa through aerobic fermentation. It has become the most promising new type of biological pesticide in the world today due to its unique mode of action, high selectivity, safety to non-target animals and safety of degradation products. However, the low yield of spinosad from wild-type Saccharopolyspora spinosa and the long fermentation cycle seriously restrict the fermentation production and application of spinosad. How to improve the yield of spinosad from Saccharopolyspora spinosa has become a hot topic in current research. Due to the powerful restriction and modification system of Saccharopolyspora spinosa, the difficulty of exogenous gene transformation and the small number of marker genes available for screening, the directed transformation of Saccharopolyspora spinosa at the molecular level at home and abroad is mostly focused on the single gene level and heterologous recombinant expression. Studies have reported that the biosynthetic pathway of spinosad is very complex and is jointly controlled by multiple functional genes. Modification of only a single functional gene may have limited impact on the entire synthesis pathway. The yield of synthesized spinosad using heterologous recombinant expression is extremely low and difficult to be significantly improved. The CRISPR / Cas9 system is an immune system that exists in prokaryotes and is used to resist the invasion of foreign genetic material. It is mainly used by bacteria to produce a protein-RNA complex, in which RNA is responsible for recognizing foreign DNA and cutting the genetic material of invaders through Cas9. In addition, artificial mutagenesis can also be used as a strategy for screening high-yield strains, such as genome shuffling (GS), which is widely used in actinomycetes. It mainly simulates the process of natural evolution, reduces or eliminates harmful mutations through high-throughput screening, and finally obtains improved strains involving genetic traits from multiple positive mutant strains, greatly increasing the genetic diversity of "complex offspring".

[0003] At present, the production of spinosad from Saccharopolyspora spinosa needs to be further improved. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the above-mentioned defects of the prior art and provide an engineered strain for efficiently synthesizing spinosad by continuous gene editing through genome rearrangement.

[0005] The technical solution adopted by the present invention to solve the technical problem is as follows: an engineering strain for efficiently synthesizing spinosad through continuous gene editing with genome rearrangement is obtained by knocking out the pccB1 gene and the ectD gene and overexpressing the nasA gene in a mutant strain of Saccharopolyspora spinosa with genome rearrangement;

[0006] The pccB1 gene refers to the propionyl-CoA carboxylase gene;

[0007] The ectD gene refers to the ectoine hydroxylase gene;

[0008] The nasA gene refers to the nitrate reductase gene.

[0009] By adopting the above technical solution, an engineered strain capable of efficiently synthesizing spinosad can be obtained.

[0010] Preferably, the method for obtaining a mutant of Saccharopolyspora spinosa with genome rearrangement comprises: preparing Saccharopolyspora spinosa into protoplasts, and performing UV inactivation and heat inactivation respectively; fusing the UV-inactivated protoplasts with the heat-inactivated protoplasts, resuscitating, and screening high-yield strains to obtain a mutant of Saccharopolyspora spinosa with genome rearrangement.

[0011] By adopting the above technical solution, an engineered strain capable of efficiently synthesizing spinosad can be obtained.

[0012] Preferably, the pccB1 gene, ectD gene and nasA gene are all cloned from the genome of Saccharopolyspora spinosa;

[0013] The nucleotide sequence of the pccB1 gene is shown in SEQ ID NO.1;

[0014] The nucleotide sequence of the ectD gene is shown in SEQ ID NO.2;

[0015] The nucleotide sequence of the nasA gene is shown in SEQ ID NO.3.

[0016] By adopting the above technical solution, an engineered strain capable of efficiently synthesizing spinosad can be obtained.

[0017] Preferably, the sgRNA sequence of the propionyl-CoA carboxylase gene pccB1 used in gene editing is as shown in SEQ ID NO.4.

[0018] By adopting the above technical solution, pccB1 gene knockout can be achieved.

[0019] Preferably, the sgRNA sequence of the tetrahydropyrimidine hydroxylase gene ectD used in gene editing is shown in SEQ ID NO.5.

[0020] By adopting the above technical solution, ectD gene knockout can be achieved.

[0021] Preferably, the method for knocking out the pccB1 gene and ectD gene is:

[0022] The S. spinosa genome was extracted, and the upstream and downstream homologous arms of the pccB1 and ectD genes were amplified respectively; sgRNA was fused with the upstream and downstream homologous arms of the pccB1 and ectD genes by fusion PCR, and subcloned into the vector pKCcas9 to obtain recombinant plasmids pKCcas9-pccB1 and pKCcas9-ectD; the recombinant plasmids pKCcas9-pccB1 and pKCcas9-ectD were transferred into the Saccharopolyspora spinosa cells by protoplast transformation technology to achieve the knockout of the pccB1 gene and ectD gene;

[0023] The S. spinosa is a wild type Saccharopolyspora spinosa.

[0024] Under the guidance of sgRNA, Cas9 cuts at specific sites inside the pccB1 and ectD genes, and then recombines with the upstream and downstream homologous arms on the recombinant plasmids pKCcas9-pccB1 and pKCcas9-ectD, gradually completing the replacement of the pccB1 and ectD genes; by adopting the above technical solution, the knockout of the pccB1 gene and ectD gene can be achieved.

[0025] Preferably, the method for overexpressing the nasA gene is:

[0026] The nasA gene fragment was amplified by PCR from the S. spinosa genome using the primer pair nasA-F / nasA-R; the plasmid pOJ260 was used as a template, P ermE -F / P ermE -RnasA was used as the primer pair, and PCR amplified P ermE Fragment; The two fragments were fused by fusion PCR to obtain a fusion fragment P ermE -nasA; use Xba I / Hind III two fast cutting enzymes to digest pOJ260 plasmid and P ermE -nasA fragment, purified the fragment and carried out enzyme ligation to obtain the recombinant plasmid pOJ260-P ermE -nasA; the recombinant plasmid pOJ260-P was transformed into ermE -nasA was transferred into the Saccharopolyspora spinosa to achieve overexpression of the nasA gene;

[0027] The S. spinosa refers to wild-type Saccharopolyspora spinosa;

[0028] The nucleotide sequence of nasA-F is: GAGCATGCCGTTGCCGACGATGCG;

[0029] The nucleotide sequence of nasA-R is: CCCAAGCTTGGGTAACGCCGCCTT;

[0030] The P ermE The nucleotide sequence of -F is: GCTAAGCTTCTGGACTTCTAGAGCTAGCCTCG;

[0031] The P ermE The nucleotide sequence of -RnasA is: GCAATGGTCGCACTGCGGCGACTCTA.

[0032] By adopting the above technical solution, nasA gene overexpression can be achieved.

[0033] Preferably, the engineered strain for efficient synthesis of spinosad by continuous gene editing after genome rearrangement is classified and named Fusant Saccharopolyspora spinosa YX1, and was deposited in the China Center for Type Culture Collection on January 12, 2023, with the deposit number CCTCC NO: M 2023079.

[0034] The strain is an engineered strain for efficiently synthesizing spinosad.

[0035] The invention discloses an application of the engineered strain for efficiently synthesizing spinosyns through continuous gene editing after genome rearrangement in the production of biosynthetic spinosyns.

[0036] By adopting the above technical solution, spinosad can be efficiently synthesized.

[0037] In the previous study, the present invention screened three genes that are particularly critical to the biosynthesis of spinosad in Saccharopolyspora spinosa by comprehensively utilizing genomics, proteomics and metabolomics determination and analysis, namely, the propionyl-CoA carboxylase gene pccB1, the nitrate reductase gene nasA and the tetrahydropyrimidine hydroxylase gene ectD. As a kind of acyl-CoA carboxylase, propionyl-CoA carboxylase is responsible for catalyzing propionyl-CoA to generate methylmalonyl-CoA, which is an important expansion unit in the biosynthesis of spinosad. By increasing the expression level of acyl-CoA carboxylase, the strain can be prompted to produce more methylmalonyl-CoA, providing more abundant precursors for the synthesis of spinosad. Nitrate is an important inorganic nitrogen source for the growth and development of actinomycetes, bacteria, fungi, etc., and the concentration regulation process of nitrate by organisms is very fine and accurate. The product encoded by the nitrate reductase gene (nasA) is responsible for converting intracellular nitrate into nitrite, which is an important way for cells to transport nitrate. The nasA gene is involved in the "nitrate stimulation effect". Its overexpression helps to enhance the strain's uptake and utilization of nitrogen sources and improve the strain's primary and secondary metabolism levels; the global regulator of nitrogen metabolism GlnR can enhance the synthesis of secondary metabolites by increasing the expression of the nasA gene, so the overexpression of nasA has further research value. Tetrahydropyrimidine hydroxylase gene (ectD), belonging to Fe 2+ The 2-ketoglutarate-dependent dioxygenase superfamily, the enzymes of which are commonly found in various Gram-positive and Gram-negative bacteria, and their catalytic product 5-hydroxylated ectoine can be used as a cell protector and stabilizer. The global regulator of nitrogen metabolism GlnR can negatively regulate the ectD operon, promote the balance of osmotic pressure inside and outside the cell, improve the strain's resistance to extreme environments, prolong the life cycle of the strain, promote the primary and secondary metabolic life activities of the strain, and thus enhance the biosynthesis of spinosad in Saccharopolyspora spinosa. Therefore, weakening the expression of ectD has an important regulatory role.

[0038] Beneficial effects of the present invention:

[0039] The invention continuously edits the pccB1, ectD and nasA genes in the genome of Saccharopolyspora spinosa based on genome rearrangement to obtain an engineered strain capable of efficiently synthesizing spinosad; wherein the growth ability of the engineered strain YX1 is significantly stronger than that of the original strain, and the spinosad yield is increased by 3.82 times compared with the original strain.

[0040] Description of Microbiological Deposit

[0041] The engineered strain of the present invention that has undergone genome rearrangement and continuous gene editing and efficiently synthesizes spinosad was deposited in the China Center for Type Culture Collection (CCTCC for short, address: Wuhan University, Wuhan, China) on January 12, 2023, and the strain collection number is CCTCC NO: M 2023079; the classification name is: Fusant Saccharopolyspora spinosa YX1; Latin name: Fusant Saccharopolyspora spinosa YX1. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is a whole genome sequencing diagram of Saccharopolyspora spinosa after genome rearrangement in an embodiment of the present invention.

[0043] Figure 2 This is a principle flow chart of the recombinant plasmid pKCcas9-ectD knockout and pOJ260-nasA overexpression in the embodiment of the present invention: left figure - knockout; right figure - overexpression.

[0044] Figure 3 It is a partial PCR identification diagram of the engineering strains pKCcas9-pccB1, pKCcas9-ectD, and pOJ260-nasA in the embodiments of the present invention.

[0045] Figure 4 It is a qRT-PCR analysis diagram of the spn series genes in S. spinosa, S. spinosa GS, and YX1 strains in the examples of the present invention.

[0046] Figure 5 It is a growth curve measurement diagram of the engineering strain YX1 in the embodiment of the present invention.

[0047] Figure 6 This is a mycelial morphology diagram of the engineering strain YX1 in the embodiment of the present invention.

[0048] Figure 7 This is a high performance liquid chromatography analysis chart of spinosad production by the engineered strain YX1 in the embodiment of the present invention.

[0049] Figure 8 It is the mass spectrum of M. multilosin produced by the engineered strain YX1 in the embodiment of the present invention. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.

[0051] Example

[0052] The strains, plasmids and primers involved in this example are shown in Table 1.

[0053] (I) Specific culture medium formulation and culture conditions

[0054] S. spinosa seed activation medium CSM: 9.0g / L tryptic soy broth, 3.0g / L glucose, 3.0g / L yeast powder, 0.5g / L MgSO4·7H2O. Add 15-20g / L agar powder to the above liquid to prepare CSM solid medium. Inoculate a single clone or 2% strain stock solution into a 150mL shake flask containing 20mL CSM and culture at 30℃, 280r / min for 48h.

[0055] S. spinosa AM6 fermentation medium: 20.0 g / L starch, 10.0 g / L glucose, 4.0 g / L yeast powder, 5.0 g / L peptone, 0.5 g / L MgSO4·7H2O. Inoculate 2% of the strain activation solution into a 300 mL shake flask containing 50 mL AM6 and culture at 30°C, 280 r / min for 12 days.

[0056] Protoplast transformation used R5 medium: sucrose 103 g / L, glucose 10 g / L, casamino acid 0.1 g / L, yeast powder 5 g / L, K2SO4 0.25 g / L, MgCl2·6H2O 10.12 g / L, TES 5.73 g / L, agar powder 15-20 g / L.

[0057] E. coli DH5α liquid culture medium LB: 1g / L tryptone, 0.5g / L yeast powder and 1g / L NaCl. Add 15-20g / L agar powder to the above liquid to prepare LB solid culture medium.

[0058] (II) Genome rearrangement of Saccharopolyspora spinosa

[0059] Saccharopolyspora spinosa was made into protoplasts, and then fused after UV inactivation and heat inactivation:

[0060] (1) Preparation of protoplasts: Saccharopolyspora spinosa was activated in CSM medium for 48 hours, transferred to TSB medium containing 0.2% glycine and cultured for two days, treated with lysozyme at a final concentration of 20 mg / mL for 30 minutes, centrifuged to remove the supernatant, and added P buffer to obtain an isotonic protoplast solution.

[0061] (2) Ultraviolet inactivation: Spread the protoplast solution evenly on a plate, place it 50 cm below a UV lamp, and irradiate for 2 minutes, 4 minutes, and 8 minutes respectively.

[0062] (3) Heat inactivation: Place the protoplast solution in an EP tube and place it in a 60°C water bath for 45 minutes.

[0063] (4) Protoplast fusion: The UV-inactivated and heat-inactivated protoplasts were mixed together, centrifuged to remove the supernatant, 50% PEG1000 was added, mixed and placed in a 30°C water bath for 5 minutes, centrifuged to remove the supernatant, Pbuffer was added, and the mixture was spread on R5 solid plate culture medium for recovery.

[0064] (5) Select a white single clone and inoculate it into a 300 mL shake flask filled with AM6 medium for fermentation. The fermentation time is 12 days. The yield is detected using HPLC1290, and the high-yield strain is selected and subcultured and preserved. The whole genome sequencing of S. spinosa GS after genome rearrangement is shown in Figure 1 , it can be seen that a certain range of mutations have occurred.

[0065] (III) Recombinant plasmids pKCcas9-pccB1, pKCcas9-ectD, pOJ260-P ermE - Construction of nasA

[0066] (1) Design of sgRNA for pccB1 and ectD genes

[0067] Input the pccB1 and ectD gene sequences into the ZIFIT software for analysis, set the corresponding parameters, click identify target sites, obtain the sgRNA sequence, and finally select:

[0068] pccB1-sgRNA:

[0069] TTGGACTAGTCGGAGAGCGACCAGGAACAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGAG

[0070] ectD-sgRNA:

[0071] TACAACAAGCCCTCTAAGACCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTGAG

[0072] The sgRNA used for this gene knockout was sent to Bioengineering Co., Ltd. (Shanghai) for synthesis.

[0073] (2) Amplification of sgRNA and upstream and downstream homology arms (UHA, DHA) of pccB1, ectD, and nasA

[0074] Using plasmid pKCcas9 as template, FpccB1sgRNA / gTEMdn, FectDsgRNA / gTEMdn, as primer pairs, amplify the fragment containing sgRNA. Using the S. spinosa genome as template, homology arm primers FpccB1up / RpccB1up, FpccB1down / RpccB1down, FectDup / RectDup, FectDdown / RectDdown, FnasAup / RnasAup, FnasAdown / RnasAdown were designed to amplify the upstream and downstream homology arms of pccB1, ectD, and nasA genes, respectively. The PCR reaction system was 20μL (H2O 5.2μL, 2X PrimeSTAR GC Buffer 10μL, dNTPs 1.6μL, primers 1μL each, template (pKCcas9 / S. spinosa) 1μL, PrimeSTAR 0.2μL). The PCR reaction program was set as follows: pre-denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 90 seconds (sgRNA fragment extension time was 30 seconds), cycled 30 times, and finally maintained at 72°C for 10 minutes and terminated at 20°C.

[0075] (3) Fusion of sgRNA with the upstream and downstream homology arms of pccB1 and ectD

[0076] Using the above three PCR products as templates, FpccB1up / RpccB1up, FpccB1down / RpccB1down, FectDup / RectDup, and FectDdown / RectDdown as primer pairs, the three fragments were fused in the order of sgRNA, Up, and Down using the fusion PCR method to obtain the three-fragment fusion product sgRNA-UppccB1-DownpccB1 ， sgRNA-UpectD-DownectD. PCR reaction system 50μL (H2O 10.5μL, 2X PrimeSTAR GC Buffer 25μL, dNTPs 4μL, primers 2μL each, template sgRNA, UppccB1, DownpccB1 、 UpectD、DownectD 、 UpnasA, DownnasA 2 μL each, PrimeSTAR 0.5 μL). The PCR reaction program was set as: 95°C pre-denaturation for 5 min, followed by 95°C denaturation for 30 s, 56°C annealing for 30 s and 72°C extension for 150 s, 30 cycles, and finally 72°C for 10 min, and the reaction was terminated at 20°C.

[0077] (4) Construction of nasA overexpression plasmid pOJ260-P ermE -nasA

[0078] The nasA gene fragment was amplified from the S. spinosa genome by PCR using the primer pair FnasA / RnasA. The fragment size was about 1.5 kb. The plasmid pOJ260 was used as a template. ermE -F / P ermE -RnasA as primer pair, PCR amplification P ermE The fragment has a band size of about 260 bp. Then the two fragments are fused by fusion PCR to obtain the fusion fragment P ermE -nasA. The pOJ260 plasmid and P were digested with Xba I / Hind III enzymes respectively. ermE -nasA fragment, the purified fragment was enzyme-ligated. The enzyme-ligated product was introduced into E. coli DH5α by thermal transfer, and E. coli DH5α (pOJ260-P ermE -nasA).

[0079] (5) Fusion product sgRNA-UppccB1-DownpccB1 ， sgRNA-UpectD-DownectD and plasmid pKCcas9 enzyme ligation

[0080] The above fusion product sgRNA-UppccB1-DownpccB1 ， sgRNA-UpectD-DownectD ， The product was recovered and purified, and double-digested with PstI and Hind III. At the same time, the plasmid pKCcas9 was also double-digested to construct a recombinant plasmid. The digested product after recovery and purification was ligated under the action of T4 DNA ligase, and the ligated product was heat-transferred into E. coli DH5α competent cells. Transformants were screened and verified on LB resistance plates (apramycin) to obtain recombinant plasmids pKCcas9-pccB1 and pKCcas9-ectD (identification see Figure 3 ).

[0081] (III) Construction of engineered strain YX1

[0082] The steps are as follows: first, prepare S. spinosa GS protoplasts, and then use the protoplast transformation method to successively transform the exogenous recombinant plasmids pKCcas9-pccB1, pKCcas9-ectD, pOJ260-P ermE-nasA was transferred into S.spinosa GS, S.spinosa GS-ΔpccB1, S.spinosa GS-ΔpccB1ΔectD protoplasts. An appropriate amount of linear fragments (50-200ng) and fusogen PEG 2000 (40%) were added to the Ep tube containing the protoplasts, mixed well, and the mixture was spread on the R5 plate without antibiotics, and inverted in a 30°C constant temperature incubator for 16-20h. Apramycin (50μg / ml) was covered and continued to be placed in a 30°C incubator for inverted culture for 3-7 days until white transformants appeared.

[0083] Then, 6-8 white transformants were picked from the R5 plate and streaked on TSB plates containing apramycin (50 μg / ml) for rescreening, and incubated in a 30°C constant temperature incubator for 3-5 days, until a bacterial lawn was formed in the streaked area of ​​the plate, and repeated 2-3 times. S. spinosa GS-ΔpccB1, S. spinosa GS-ΔpccB1ΔectD, and YX1 were activated in non-resistant CSM liquid medium, cultured and subcultured at 37°C for 10 days, streaked and activated on non-resistant CSM plate medium, and single colonies were selected to grow on apramycin plates to detect the complete elimination of the plasmid.

[0084] Part of the bacterial moss was picked from the TSB plate and placed in TSB liquid medium. The culture was shaken at 30°C for 48 hours. 1 mL of bacterial liquid was collected and the genome was extracted as a template. The primer pair FpccB1 / RpccB1 and FectD / RectD were used for PCR amplification. The genome of the original strain S. spinosa was used as a positive control, and the plasmids pKCcas9-pccB1 and pKCcas9-ectD were used as negative controls. The correct transformants (recombinant strains) were identified by PCR and named as: S. spinosa GS-ΔpccB1, S. spinosa GS-ΔpccB1ΔectD, and YX1. The results showed that no bands appeared in the engineered strain YX1 when the primer pair FpccB1 / RpccB1 and FectD / RectD were used for PCR amplification, while the target bands appeared in the original strain S. spinosa, indicating that the pccB1 and ectD genes in the YX1 genome had been successfully knocked out. The primer pair F ermE / R nasA During PCR amplification, 1.8 kbP ermE + nasA The target fragment indicates that the nasA gene has been successfully overexpressed, and the construction of the engineering strain YX1 is finally completed (see the principle Figure 2 ).

[0085] Saccharopolyspora spinosa YX1 was deposited in the China Center for Type Culture Collection on January 12, 2023, with the deposit number CCTCC NO: M 2023079.

[0086] (IV) Transcriptional analysis of the spn gene cluster in the YX1 genetically engineered strain

[0087] In order to investigate the reasons for the difference in the production of spinosad between the wild-type Saccharopolyspora spinosa and the YX1 engineered strain, primer pairs (Table 1) were designed to detect the transcription levels of some spn family genes related to the synthesis of spinosad. The spn family genes are key genes that directly regulate the synthesis of spinosad in Saccharopolyspora spinosa. They can catalyze the conversion of polyketide synthase products to aglycones and the modification of macrolides, which directly affect the biosynthesis of spinosad. The results of qRT-PCR showed that the transcription level of the spn gene in YX1 was significantly increased compared with the wild type. This indicates that the transcription level of spn genes in YX1 is significantly increased and stimulates the increase in the biosynthesis of spinosad (see the qRT-PCR analysis figure). Figure 4 ).

[0088] (V) Effects of genome rearrangement and continuous gene editing on the growth and development of S. spinosa

[0089] (1) Impact on strain growth curve

[0090] The activated engineered strain YX1 and the original strain were transferred into the synthetic fermentation medium in equal amounts, and samples were taken every 48 hours to measure the bacterial OD 600 The value was measured (the measured value was between 0.4 and 0.8 to ensure the accuracy of the measurement result, otherwise the sample was diluted), and the sampling period was 14 days. Figure 5 As shown, the engineered strain YX1 has obvious logarithmic phase, stable phase and decline phase. Compared with the original strain, the growth rate in the logarithmic phase is faster and the total biomass is higher.

[0091] (2) Effect on mycelium morphology

[0092] The activated engineered strain YX1 and the original strain were transferred into the synthetic fermentation medium in equal amounts, and the bacterial liquid on the second and fourth days was observed by scanning electron microscopy. After the samples were fixed with 2.5% glutaraldehyde and dehydrated with different concentrations of ethanol (30%, 50%, 70%, 90%, 95% and 100%), the mycelial morphology of the engineered strain YX1 and the original strain S. spinosa was observed using a cold field emission scanning electron microscope SU8010. The results are shown in Figure 2. Figure 6 As shown, the mycelium morphology of the engineered strain YX1 is thicker than that of the original strain.

[0093] (VI) Analysis of the biosynthetic capacity of spinosad in the engineered strain YX1

[0094] The activated engineered strain YX1 and the original strain were transferred into the synthetic fermentation medium in equal amounts, and the fermentation broth cultured to the 10th day was taken for the detection of the production of spinosad. The specific operation steps are as follows: 500 μL of the fermentation broth cultured to the 10th day was placed in a 1.5 mL Ep tube, and an equal volume of acetone was added to mix, and then extracted at 30 ° C for 48 h; centrifuged at 12000 r / min for 10 minutes, and the supernatant (containing spinosad) was taken; after filtering through a 0.22 μm microporous filter membrane, the spinosad content in the supernatant can be determined using an Agilent 1290 ultra-high performance liquid chromatography system. The relevant parameters used for the HPLC1290 instrument are: chromatographic column model (ZORBAXSB-C18), column temperature: room temperature, mobile phase: phase A is ddH2O, phase B is methanol, flow rate: 1.0 mL / min, sample volume: 20 μL, detection wavelength: 250 nm. The spinosad peak area was calculated using the instrument's own analysis software, and the peak was identified by mass spectrometry using LC-MS / MS to determine whether it was spinosad.

[0095] See Figure 7 , HPLC Angilent 1290 test results are shown in the figure. At about 18 minutes, there is a chromatographic peak with a significant change in peak area and a maximum absorption wavelength of 250nm. The Thermo LTQ ion hydrazine liquid chromatography-mass spectrometer identification results ( Figure 8 ) further confirmed that the chromatographic peaks were standard spinosad A and D with mass-to-charge ratios of 732 and 746. After software analysis, the average peak area of ​​the engineered strain YX1 at 18 minutes was 47278.9, while the average peak area of ​​the original strain at this time was 12376.7. Finally, the spinosad production of the engineered strain YX1 was 3.82 times higher than that of the original strain.

[0096] Table 1 Information on strains, plasmids and primers involved in the embodiments of the present invention

[0097]

[0098]

Claims

1. An engineered strain for synthesizing spinosad by continuous gene editing through genome rearrangement, characterized in that: Its taxonomic name is Saccharopolyspora fusion FusantSaccharopolyspora spinosa )YX1, deposited in the China Center for Type Culture Collection on January 12, 2023, with the deposit number CCTCC NO: M 2023079.

2. Use of the engineered strain for synthesizing spinosad with continuous gene editing after genome rearrangement according to claim 1 in the production of biosynthetic spinosad.

Images