A method for preparing DNA nanoparticles based on DNA complementary hybridization selection and magnetic separation

Abstract

This invention involves the self-assembly of DNA molecules with divalent metal ions to obtain DNA / metal nanoparticles; coating the surface of the DNA / metal nanoparticles with a polyelectrolyte layer to obtain DNA / metal@LBL nanoparticles; and growing SiO2 on the surface of the DNA / metal@LBL nanoparticles to obtain stable DNA / Fe@LBL@SiO2 particles. A set of DNA double-stranded molecules with complementary base fragments is used. One base fragment is immobilized on the surface of the DNA / Fe@LBL@SiO2 nanoparticles to form addressable DNA / Fe@LBL@SiO2-ssDNA nanoparticles. The other complementary base fragment is immobilized on the surface of magnetic beads to form trapping magnetic beads. The trapping magnetic beads and the addressing DNA nanoparticles are selected by specific base pairing of base fragment primers, and the downstream hybridization products can be separated magnetically, ultimately achieving the separation objective.

Description

Technical Field

[0001] This invention belongs to the field of synthetic biology materials science, specifically relating to a DNA nanoparticle based on DNA complementary hybridization selection and magnetic separation and its preparation method. Background Technology

[0002] DNA, the genetic material of living organisms, possesses extremely high storage density and serves as a natural carrier of various life genetic and disease information. Due to its unique base sequence, high-density storage capacity, and ease of manipulation, DNA is widely used in biotechnology, such as disease diagnosis and DNA information storage. However, current technologies for randomly capturing and reading specific DNA sequences suffer from low efficiency, indexing difficulties, and poor positioning accuracy. Furthermore, rapidly, conveniently, and accurately reading specific DNA from a DNA library remains a significant challenge. Currently, the most common method for random DNA reading platforms is polymerase chain reaction (PCR). Each DNA sequence is designed with a specific complementary PCR primer strand. When a specific DNA sequence needs to be read, the corresponding primer strand is added to the DNA library for retrieval and amplification, followed by sequencing to read the data. This method requires complex experimental procedures, and interference between primers and target DNA sequences may exist, making it difficult to achieve high-precision random access to large-scale data storage. Real-time effectiveness also needs further improvement. In view of this, we developed a DNA nanoparticle based on DNA complementary hybridization selection and magnetic separation and its preparation method, which realizes the stable storage of DNA in the particles and utilizes complementary base pairing to select DNA particles and downstream magnetic separation. Summary of the Invention

[0003] The purpose of this invention is to develop a DNA nanoparticle based on DNA complementary hybridization selection and magnetic separation, and a method for preparing the same, which achieves stable storage of DNA in the nanoparticle and utilizes complementary base pairing to select the DNA nanoparticle and downstream magnetic separation.

[0004] The technical solution adopted in this invention is as follows:

[0005] A method for preparing DNA nanoparticles based on DNA complementary hybridization selection and magnetic separation includes the following steps:

[0006] 1) Prepare a DNA molecule solution of 1-100 μM / L with enzyme-free water, and prepare a divalent metal ion salt solution of 1-20 mM / L with enzyme-free water; mix the DNA molecule solution and the divalent metal ion salt solution evenly in deionized water, incubate in a 95℃ metal bath for 0.5-3 h, and then cool naturally to room temperature to obtain a DNA / metal nanoparticle solution;

[0007] 2) Add polycationic electrolyte to DNA / metal nanoparticle solution and react at room temperature for 10-60 min. Then add polyanionic electrolyte and continue to react at room temperature for 10-60 min to coat the surface of DNA / metal nanoparticles with polyelectrolyte layer to obtain DNA / metal@LBL nanoparticle solution.

[0008] 3) Add ammonium chloride trimethoxysilane (TMAPS) and tetraethyl orthosilicate (TEOS) to the DNA / metal@LBL nanoparticle solution, and react in a shaker at room temperature and 100-700 rpm for 3-7 days to facilitate the growth of a silica layer on the surface of the DNA / metal@LBL nanoparticles, thus obtaining a DNA / Fe@LBL@PDA@SiO2 particle solution; then add a silanized ssDNA and grow it directly onto the surface of the DNA / Fe@LBL@SiO2 nanoparticles to form addressable DNA / Fe@LBL@SiO2-ssDNA nanoparticles;

[0009] 4) The DNA / Fe@LBL@SiO2-ssDNA nanoparticle solution was purified by centrifugation and washing with ultrapure water to separate the purified DNA / Fe@LBL@SiO2-ssDNA nanoparticles, which are the addressable DNA nanoparticles. They were dispersed in water for later use.

[0010] 5) Amino-modified ssDNA' is covalently attached to the surface of carboxylated magnetic beads (MB) through the condensation reaction of amino and carboxyl groups, forming MB-ssDNA', also known as capture magnetic beads.

[0011] 6) After mixing the addressing DNA nanoparticles and capturing magnetic beads in a salt ion buffer, the mixture is placed in a shaker and reacted at 27°C and 100-700 rpm for 1-5 hours; finally, a hybrid of addressing DNA nanoparticles and capturing magnetic beads is formed. 7) The hybridization pattern is separated from the solution using a magnet, and the DNA nanoparticles are selectively obtained.

[0012] The DNA molecules include, but are not limited to, one or more modified or unmodified double-stranded DNA molecules, single-stranded DNA molecules, and circular DNA molecules.

[0013] The divalent metal ions include, but are not limited to, divalent iron ions, divalent copper ions, and divalent zinc ions;

[0014] The polycationic electrolyte includes, but is not limited to, polyallylamine hydrochloride, polyethyleneimine, and polydimethyldiallyl ammonium chloride;

[0015] The polyanionic electrolyte includes, but is not limited to, poly(4-styrenesulfonic acid), polyacrylic acid, and sodium polystyrenesulfonate;

[0016] The ssDNA and ssDNA' have 20-50 complementary bases, meaning that these two single strands can form 20-50 base pairs, and the selection of DNA particles is achieved through complementary base pairing.

[0017] The centrifugal washing process involves a rotation speed of 8000–12000 rpm, a duration of 5–20 min, and 3–6 cycles.

[0018] A DNA nanoparticle based on base fragment primer selection and magnetic separation, and its preparation method, are achieved by the above-mentioned preparation method and separation process.

[0019] The preparation method and separation technology described above can be applied in the field of storage.

[0020] The significant advantages of this invention are:

[0021] This invention discloses a DNA nanoparticle based on DNA complementary hybridization selection and magnetic separation, and its preparation method. This technology is simple, efficient, environmentally friendly, and widely applicable. It avoids the cumbersome and time-consuming PCR amplification steps of traditional methods and overcomes the DNA crosstalk and loss problems caused by primer amplification, achieving non-destructive and efficient separation of target DNA nanoparticles. Furthermore, the separation method is convenient, independent of bulky and expensive instruments, and has high commercial value. This invention provides a new approach for non-destructive random access to DNA-based databases, and plays a significant guiding role in solving problems encountered by traditional DNA storage platforms, such as low storage unit density, complex preparation, and difficulties in selective separation. Attached Figure Description

[0022] Figure 1 A represents the preparation process of addressable DNA particles, B represents the preparation process of trapping magnetic beads, and C represents the separation diagram of addressable DNA nanoparticles.

[0023] Figure 2 TEM (B) diagram of addressing DNA particles (A) and capturing magnetic beads.

[0024] Figure 3 TEM images: TEM images of addressing DNA particles (A) and capturing magnetic beads (B), and hybrids of addressing DNA particles and capturing magnetic beads after magnetic sorting (C). Detailed Implementation

[0025] To make the content of this invention easier to understand, the technical solution of this invention will be further described below with reference to specific embodiments, but this invention is not limited thereto.

[0026] The MES buffer used in this invention was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.

[0027] The carboxylated magnetic bead microspheres of this invention were purchased from Jiangsu Xianfeng Nanomaterials Technology Co., Ltd.

[0028] Therefore, the DNA sequence was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0029] Example 1

[0030] A DNA nanoparticle based on DNA complementary hybridization selection and magnetic separation and its preparation method (illustration shown in figure) Figure 1 As shown, Figure 1 A represents the preparation process of addressable DNA nanoparticles. Figure 1 B represents the preparation process of the magnetic beads. Figure 1 C is a schematic diagram of DNA nanoparticle selection and separation, which includes the following steps:

[0031] 1) Design and artificially synthesize the DNA oligonucleotide chain with the sequence shown below, whose DNA sequence is shown in SEQ ID NO.1:

[0032] 5'-AAGCTTCCAAACTGTGTGGCAAACAAACCCAACCAATTCACCGTGCGGTGACT GCTTCAGCGCTCTGGCAACACAAGAGTCGCATCTTGGAGAGCTATCGGCATCGCG GCATTATAGACACTTAGCGGCTATGGCTACGA-3';

[0033] Prepare a 5 μM / L DNA oligonucleotide chain solution using enzyme-free water; prepare a 20 mM FeCl2·4H2O solution using enzyme-free water; prepare a 1 mg / ml PAH solution using deionized water; prepare a 1 mg / ml PSS solution using deionized water; dilute ammonium trimethoxysilane (TMAPS) and ethyl silicate (TEOS) 100 times with deionized water.

[0034] 2) Mix 4.2 μL of DNA oligonucleotide chain solution (5 μM) with 1.8 μL of FeCl2·4H2O solution (20 mM / L) in 44 μL of deionized water until homogeneous. Incubate in a 95℃ metal bath for 3 h, then allow to cool naturally to room temperature to obtain a DNA / Fe nanoparticle solution, which serves as the template motif. Add 2.5 μL of LPAH solution (1 mg / ml) to the obtained DNA / Fe nanoparticle solution and react at room temperature for 30 min. Then add 5 μL of LPS solution (1 mg / ml) and continue reacting at room temperature for another 30 min to coat the template motif with a polyelectrolyte layer, thereby making the template more stable. This yields a DNA / Fe@(PAH / PSS)1 nanoparticle solution, also known as DNA / Fe@LBL nanoparticle solution. Add 4 μL of [unclear text - possibly a specific ingredient or solution] to the obtained DNA / Fe@(PAH / PSS)1 nanoparticle solution. TMAPS solution and 8 μL TEOS were placed in a shaker and reacted for 3 days at room temperature and 418 rpm to grow a SiO2 layer on the surface of DNA / Fe@(PAH / PSS)1 nanoparticles, resulting in DNA / Fe@(PAH / PSS)1@SiO2 biomimetic mineralized DNA particle solution, also known as DNA / Fe@LBL@SiO2 nanoparticles.

[0035] 3) Obtaining silanized ssDNA: Add 50 μL of 3'-terminal amino DNA (SEQ ID NO.2);

[0036] SEQ ID NO.3:

[0037] TGTTGCGCGATCAGCCAAGCATACTAACTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT NH2C6 solution (25 μM / L) was mixed with 1 μL of propyl 3-(triethoxysilane)isocyanate (ICPTES, 404 mM / L) and 1 μL of triethylamine (TEA, 7.2 mM / L), and then reacted at 28 °C and 500 rpm for 12 h to obtain silane-modified ssDNA.

[0038] 4) Then, 2 μL of the silane-modified ssDNA prepared in 3) was added to the 50 μL DNA / Fe@(PAH / PSS)1@SiO2 mixture in 2) and the mixture was grown at room temperature with shaking at 418 rpm for 48 h to obtain addressable DNA / Fe@(PAH / PSS)1@SiO2-ssDNA nanoparticles, which are the addressable DNA nanoparticles. Finally, the particles were washed and purified twice with ultrapure water by centrifugation at 8000-12000 rpm for 10 min.

[0039] The morphology of the purified addressable DNA nanoparticles was observed using transmission electron microscopy (TEM). Results are shown below. Figure 2A. As can be observed from the figure, this invention has successfully prepared micron-sized, uniformly sized addressed DNA nanoparticles.

[0040] 5) Obtain the capture magnetic beads. Disperse the carboxylated magnetic beads (0.15 mg) in 180 μL of MES buffer, add 10 μL of 5 M / L NaCl solution, mix thoroughly, add 20 μL of 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC, 0.3 M / L), and shake in a metal bath at 500 rpm and 28 °C for 30 min; then add 40 μL of N-hydroxysuccinimide (NHS, 0.3 M / L) and continue the reaction for 30 min; add 6 μL of 100 μM amino-modified ssDNA' (SEQ ID NO.3);

[0041] SEQ ID NO.3:

[0042] CAGTTAGTATGCTTGGCTGATCGCGCAACATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT NH2C6, continue the reaction for 10 h. After 10 h, MB-ssDNA', also known as magnetic capture beads, is obtained. The product is magnetically washed three times with water and dispersed in 200 μL of water for later use.

[0043] The morphology of the purified captured magnetic beads was observed using transmission electron microscopy (TEM). Results are shown below. Figure 2 B. Uniform trapping magnetic beads with a size of 100-200 nm can be observed in the figure.

[0044] 6) Separation of DNA Nanoparticles: 100 μL of addressing DNA nanoparticles and 1 μL of capturing magnetic beads were mixed in a salt ion buffer (an aqueous solution containing 5 mM / L MgCl2) and reacted in a shaker at 27°C and 400 rpm for 1.5 h. The ssDNA on the surfaces of the capturing magnetic beads and the addressing DNA nanoparticles has 30 complementary bases. Therefore, a hybrid of addressing DNA nanoparticles and capturing magnetic beads was formed. The hybrid was placed on a magnetic rack and allowed to stand for 5 minutes, then separated from the solution by magnetic force, ultimately achieving the selective acquisition of DNA nanoparticles.

[0045] Observation of addressing DNA nanoparticles before separation using transmission electron microscopy (TEM) Figure 3 A) and capturing magnetic beads ( Figure 3 The state of B). The hybridization complex after separation was observed using transmission electron microscopy (TEM). Figure 3 C). From Figure 3 We can see that the captured magnetic beads can selectively hybridize to the surface of the addressed DNA nanoparticles, forming a hybridization complex, and then be separated by magnetic force to obtain the DNA nanoparticles.

[0046] In summary, this invention discloses a DNA nanoparticle based on DNA complementary hybridization selection and magnetic separation, and its preparation method. DNA molecules are self-assembled with divalent metal ions to obtain DNA / metal nanoparticles; a polyelectrolyte layer is coated onto the surface of the DNA / metal nanoparticles using a layer-by-layer assembly technique to obtain DNA / metal@LBL nanoparticles; SiO2 is grown on the surface of the DNA / metal@LBL nanoparticles to obtain stable DNA / Fe@LBL@SiO2 particles. A set of DNA double-stranded molecules with complementary base fragments is used. One base fragment is covalently fixed to the surface of the DNA / Fe@LBL@SiO2 nanoparticles to form addressable DNA / Fe@LBL@SiO2-ssDNA nanoparticles, also known as addressable DNA nanoparticles. The other complementary base fragment is covalently fixed to the surface of magnetic beads to form trapping magnetic beads. The trapping magnetic beads and the addressable DNA nanoparticles are selected by specific base pairing of base fragment primers. The downstream hybridization products can be separated magnetically, ultimately achieving the selective separation of DNA nanoparticles. This invention provides a new approach to achieving non-destructive random access to DNA-based databases, and plays an important guiding role in solving problems encountered by traditional DNA storage platforms, such as low storage unit density, complex synthesis, and difficulties in random indexing and sorting.

[0047] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A method for preparing addressable DNA nanoparticles and trapping magnetic beads based on DNA complementary hybridization selection and magnetic separation, characterized in that: Includes the following steps: 1) DNA molecules are self-assembled with ferrous ions to obtain DNA / metal nanoparticles; 2) DNA / metal@LBL nanoparticles were obtained by coating a polyelectrolyte layer on the surface of DNA / metal nanoparticles using a layer-by-layer assembly technique; 3) A silica layer is grown on the surface of DNA / metal@LBL nanoparticles to obtain DNA / Fe@LBL@SiO2 nanoparticles, resulting in stable DNA particles; 4) Subsequently, a silanized ssDNA was added and directly grown onto the surface of DNA / Fe@LBL@SiO2 nanoparticles to form addressable DNA / Fe@LBL@SiO2-ssDNA nanoparticles, also known as addressable DNA nanoparticles; amino-modified ssDNA' was covalently added to the surface of carboxylated magnetic beads through the condensation reaction of amino and carboxyl groups to form trapping magnetic beads. 5) ssDNA and ssDNA' have 20-50 complementary bases. The selection of addressable DNA nanoparticles is achieved through complementary base pairing. The hybridization products are separated by magnetism, ultimately achieving the purpose of selectively separating DNA nanoparticles.

2. The preparation method according to claim 1, characterized in that: The specific steps are as follows: 1) Prepare a DNA molecule solution of 1~100 μmol / L with enzyme-free water, and prepare a divalent iron ion salt solution of 1~20 mM with enzyme-free water; mix the DNA molecule solution and the divalent metal ion salt solution evenly in deionized water, incubate in a 95 ℃ metal bath for 0.5~3 h, and then cool naturally to room temperature to obtain a DNA / metal nanoparticle solution; 2) Add polycationic electrolyte to DNA / metal nanoparticle solution and react at room temperature for 10-60 min. Then add polyanionic electrolyte and continue to react at room temperature for 10-60 min to coat the surface of DNA / metal nanoparticles with polyelectrolyte layer to obtain DNA / metal@LBL nanoparticle solution. 3) Add ammonium chloride trimethoxysilane and ethyl silicate to the DNA / metal@LBL nanoparticle solution, and place it in a shaker to react at room temperature and a speed of 100-700 rpm for 3-7 days to facilitate the growth of a silica layer on the surface of the DNA / metal@LBL nanoparticles, so as to obtain DNA / Fe@LBL@SiO2 particle solution. 4) Subsequently, a silanized ssDNA was added and directly grown onto the surface of DNA / Fe@LBL@SiO2 nanoparticles to form addressable DNA / Fe@LBL@SiO2-ssDNA nanoparticles; the addressable DNA / Fe@LBL@SiO2-ssDNA nanoparticle solution was purified by centrifugation and washing with ultrapure water to separate the purified addressable DNA / Fe@LBL@SiO2-ssDNA nanoparticles, which are the addressable DNA nanoparticles; the amino-modified ssDNA' was covalently attached to the surface of carboxylated magnetic beads through the condensation reaction of amino and carboxyl groups to form MB-ssDNA', also known as capture magnetic beads.

3. The preparation method according to claim 1, characterized in that: Step 5) involves separation via magnetism, and the specific steps are as follows: (a) Addressable DNA nanoparticles and trapping magnetic beads were mixed in a salt ion buffer and reacted in a shaker at 27 °C and 100-700 rpm for 1-5 h; finally, a hybrid of addressable DNA nanoparticles and trapping magnetic beads was formed. (b) The hybrids are separated from the solution by a magnet, and the addressable DNA nanoparticles are selectively obtained.

4. The preparation method according to claim 1 or 2, characterized in that: The DNA molecules include one or more modified or unmodified double-stranded DNA molecules, single-stranded DNA molecules, and circular DNA molecules.

5. The preparation method according to claim 2, characterized in that: Step 2) The polycationic electrolyte includes any one of polyallylamine hydrochloride, polyethyleneimine, and polydimethyldiallyl ammonium chloride.

6. The preparation method according to claim 2, characterized in that: Step 2) The polyanionic electrolyte includes any one of poly(4-styrenesulfonic acid), polyacrylic acid, and sodium polystyrenesulfonate.

7. The preparation method according to claim 2, characterized in that: Step 4) The centrifugal washing speed is 8000~12000 rpm, the duration is 5~20 min, and the number of times is 3-6.

8. An application of addressable DNA nanoparticles and trapping magnetic beads based on DNA complementary hybridization selection and magnetic separation in the field of DNA storage, characterized in that, The DNA nanoparticles and trapping magnetic beads are prepared by the method described in any one of claims 1-7.

Images