Gtf2a1 intron region snp molecular marker related to egg production of chicken and application thereof
By detecting SNP sites in the intron region of the chicken GTF2A1 gene and constructing the H2 haplotype, the problem of screening SNP sites associated with chicken egg production traits in existing technologies has been solved, enabling efficient breeding of high-producing chicken breeds and improving reproductive performance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SHANDONG AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-06-25
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies have difficulty effectively screening for GTF2A1 gene SNP sites that are significantly associated with chicken egg production traits, especially since there have been no reports of associations with precocious sexual maturity and high egg production, resulting in slow progress in improving chicken reproductive performance.
A combination of SNP molecular markers in the intron region of the GTF2A1 gene is provided, including first and second molecular markers. By detecting the genotypes of SNP1, SNP2, SNP3 and SNP4 sites, an H2 haplotype is constructed. PCR amplification and sequencing are performed using specific primer pairs to identify laying hens with early onset of laying and high egg production traits.
By detecting SNP sites in the intron region of the GTF2A1 gene in chickens, high-producing egg-laying chicken breeds can be bred easily and quickly, improving the accuracy and efficiency of breeding and significantly improving the reproductive performance of chickens.
Smart Images

Figure CN118638931B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetics, specifically to a method related to chicken egg production. GTF2A1 SNP molecular markers in gene intron regions and their applications. Background Technology
[0002] my country boasts a diverse array of local chicken breeds and abundant genetic resources, but a common problem is their low reproductive performance, particularly egg production. Egg production performance in chickens includes age at first laying, weight at first laying, initial egg weight, and egg quantity. Reproductive traits such as egg production are low-heritability traits, and improving them through traditional quantitative genetics breeding methods often results in slow genetic progress. However, with the rapid development of molecular biology detection techniques and various statistical methods, a large number of effective molecular markers have been discovered, making marker-assisted selection a reality in chicken genetic breeding.
[0003] Single nucleotide polymorphisms (SNPs) are a type of molecular genetic marker. An SNP refers to a polymorphism in the DNA sequence caused by a mutation in a single nucleotide base at the genomic level. Numerous reports indicate that SNP technology has enormous potential in poultry breeding. With the maturation of SNP technology, the application of SNP marker breeding techniques can significantly improve breeding efficiency and promote the development of the poultry breeding industry. However, the total number of SNPs is vast; in the human genome, the total number of SNPs is approximately over 3 million (Rocha). et al (2006). Chickens have a mutation rate 6 to 7 times that of humans. Therefore, how to screen out SNP molecular markers that are significantly associated with egg production traits in chickens from a large number of SNPs is a current technical challenge.
[0004] GTF2A1 (General Transcription Factor IIA Subunit 1) is a subunit of transcription factor IIA (TFIIA). The protein encoded by this gene is a component of the RNA polymerase II transcription mechanism. It interacts with other TFIIA subunits to help form a stable transcription complex, playing a crucial role in transcriptional activation. Eukaryotic polymerases cannot recognize and bind to promoters independently; instead, a pre-initiation complex is formed between the basic transcription factor and the promoter. GTF2A1 directly contacts the DNA sequence upstream of TATA-containing DNA, regulating the interaction between TATA-binding proteins and activators, DNA, and other general transcription factors—a necessary process for eukaryotic polymerase transcription. Studies have found that… GTF2A1 and CLSPN Genes influence the function of the ovary and uterus in hens, and these two factors may be candidate genes for egg production. However, current research on chickens... GTF2A1Reports on gene SNP loci are limited, and the reported SNP loci are only associated with cumulative egg production at 21-40 weeks of age (EN21-40). However, chickens exhibiting both precocious puberty and high egg production traits show significant correlations. GTF2A1 No gene SNP sites have been reported yet. Summary of the Invention
[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a method related to chicken egg production. GTF2A1 SNP molecular markers in gene intron regions and their applications.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A first aspect of the present invention provides a method related to chicken egg production. GTF2A1 Combinations of molecular markers for SNPs in intron regions of genes, including first and second molecular markers;
[0008] The nucleotide sequence of the first molecular marker is shown in SEQ ID NO.1, which includes SNP1 and SNP2 sites. The 112th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP1 site, and its base is A or G; the 821st base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP2 site, and its base is T or C.
[0009] The nucleotide sequence of the second molecular marker is shown in SEQ ID NO.2, which includes SNP3 and SNP4 sites. The 291st base from the 5' end of the sequence shown in SEQ ID NO.2 is the SNP3 site, and its base is G or A; the 294th base from the 5' end of the sequence shown in SEQ ID NO.2 is the SNP4 site, and its base is C or T.
[0010] The specific nucleotides marked as the first molecule are as follows:
[0011] a tgtgacatgatgatgaaaga ctgctgcagc cataatctgt cctgaacatt gaaactgggcactgaaattg
[0012] ctaaggacat ccccttagaa ttgtatcatg aagggcagaaa / gagaaatgta catgagccct
[0013] ctgctggaaa gctgaatact tcacacctca aatgtttatg gaggtccata ccaacagact
[0014] gtagccttgt ctggcatga father gctataactt father tgcaactttt
[0015] cccatttgtt tatttcagga gcctcttaac agtgaagatg atgtgagtga tgaggaagga
[0016] caagaactgt ttgatacaga aaatgttgtt gtgtgtcagt atgataaggt aaaataca
[0017] acagaatgca aagaatctaa tttctcttat tacttcaagt cacaattttt aagtgatgaa
[0018] atatccttgt gtgactgtct agtataggta gatctgtaag ggttataatg tgaatgttaa
[0019] tgtaagtact accagtcatg tagtaggaag gtttttttt tggtttttt tttgttgttg
[0020] ttgattata tcagaaacgt tagtttgga acagttaatg agagttacga gagacctcag
[0021] aacaacagta aggaaagcta gttgggagct actaaagctg agcaagagca actactctga
[0022] aatcctcacc ctctgaaaaa aacttgaat tagtaggga gactgtccat cttgtaactc
[0023] taggccacg tgttcactta ccaaccacc actgctcagt ttgttttcat aaaatgcaaa
[0024] aacaatagct cagatgttct gaacagagtt / cctctcttgca cagtatgtgc atcagcaggt
[0025] gcctttggca catgagaggg gggcaaacag gtagcaatgc tcacaaagag catcccaccg
[0026] cccgtctgag atctgtccct tgagagagaa aatggtggct ttatatggtc aagggatgat
[0027] tgttttttga atcctagtga aacttagtct
[0028] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, represented by "n" in the sequence listing.
[0029] The specific nucleotides for the second molecular marker are as follows:
[0030] acctcgaatgtcttggagaacagcgactgatgagaatttatttatctgcctttgggata
[0031] agtgaatgcagaaaacctattctaagttttgcttgtttttctgttattttggaagtggta
[0032] ttactactatctggctcagtcagtaaggggagatcatatttcttataatcaggatgttat
[0033] gtactctagccagtaatgaagtttaaatcctttcagtagcagagggcaatttctcatggt
[0034] tcctctgcagtgaggaaagggaggattttcaaaaaataactgcagttagacg / actc / tgaagt
[0035] agaaaaacctttggagaaatccatctccctatatgagtcaaggacttaatgcatattttt
[0036] gtgtttggaactatgtgaactgcattaaaatttaatttccataagatagaatcattaccc
[0037] attgagagtccttggatttctctgctaatcagctgtcctgagagaaaaaataagtcattc
[0038] tgtgagcagtcagtatgctgtgtgcatatattcacttgaaagaattgtgttatttggaac
[0039] tggaaatatagatcatttgtagaataaagaaaagtgcaaacctgattgctgctccttgt
[0040] Note: The nucleotides in bold shaded areas in the sequence are SNP sites, represented by "n" in the sequence listing.
[0041] A second aspect of the present invention provides the above-described... GTF2A1 Application of SNP molecular marker combinations in intron regions of genes in chicken genetic breeding.
[0042] In the above applications, chicken genetic breeding includes the selection and breeding of laying hens with early onset of egg production, high total egg production at 43 weeks of age, and the longest consecutive laying period.
[0043] Furthermore, in the above applications, individuals with the AG or GG genotype at SNP1, the TC or CC genotype at SNP2, the AA or GA genotype at SNP3, and the CT or CC genotype at SNP4 exhibited laying traits such as early onset of egg production, a higher total number of eggs laid by 43 weeks of age, and a longer consecutive laying period.
[0044] A third aspect of the present invention provides a method for detecting the above. GTF2A1 Primer pairs for SNP molecular marker combinations in gene intron regions include: primer pair A for detecting the first molecular marker and primer pair B for detecting the second molecular marker;
[0045] The nucleotide sequences of primer pair A are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. Details are as follows:
[0046] GTF2A1-1-F: 5'-ATGTGACATGATGATGATGAAAG-3'; (SEQ ID NO. 3)
[0047] GTF2A1-1-R: 5'- GAATCCTAGTGAAACTTAGTCT-3'. (SEQ ID NO.4)
[0048] The nucleotide sequences of primer pair B are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. Details are as follows:
[0049] GTF2A1-2-F: 5'-ACCTCGAATGTCTTGGA-3'; (SEQ ID NO.5)
[0050] GTF2A1-2-R: 5'-CTGATTGCTGCTCCTTGT-3'. (SEQ ID NO.6)
[0051] A fourth aspect of the present invention provides a method for detecting the above-mentioned... GTF2A1 A kit for combining SNP molecular markers in gene intron regions, the kit containing primer pair A shown in SEQ ID NO.3 and SEQ ID NO.4 and primer pair B shown in SEQ ID NO.5 and SEQ ID NO.6.
[0052] In a fifth aspect, the invention provides the application of the primer pairs and / or kits in the assisted breeding of laying hen breeds; wherein the laying hen breed has laying traits such as early onset of egg production, high total egg production at 43 weeks of age, and longest consecutive laying days.
[0053] A sixth aspect of the present invention provides a method for identifying egg-laying traits in laying hens, comprising the following steps:
[0054] Using the genomic DNA of the laying hen to be tested as a template, PCR amplification was performed using primer pair A shown in SEQ ID NO.3 and SEQ ID NO.4 to obtain amplification product A; PCR amplification was performed using primer pair B shown in SEQ ID NO.5 and SEQ ID NO.6 to obtain amplification product B; amplification product A and amplification product B were sequenced, and the egg production trait of the laying hen was identified based on the sequencing results.
[0055] Specifically, if the sequencing result of amplification product A corresponds to the sequence shown in SEQ ID NO.1 where the 112th base from the 5' end is G and the 821st base is C; and the sequencing result of amplification product B corresponds to the sequence shown in SEQ ID NO.2 where the 291st base from the 5' end is A and the 294th base is C, then it is identified as having the egg-laying traits of early onset of laying, high total number of eggs laid at 43 weeks of age, and longest consecutive laying days.
[0056] A seventh aspect of the present invention provides a method utilizing the above-described... GTF2A1 A method for using SNP molecular marker combinations in intron regions of genes to assist in the breeding of laying hen breeds includes the following steps:
[0057] Increase the proportion of H2 haplotypes in chicken breeding populations;
[0058] The H2 haplotype is GCAT, meaning that the base at SNP1 is G, the base at SNP2 is C, the base at SNP3 is A, and the base at SNP4 is T.
[0059] The beneficial effects of this invention are:
[0060] (1) This invention relates to chicken chromosome 5. GTF2A1 Four SNP loci, 5_41037360, 5_41038069, 5_41044660, and 5_41044663, were detected in the 4th and 7th and 8th intron regions of the gene. Detecting these four molecular markers associated with egg production is not only a simple and quick method, but also helps in the selection of high-producing egg-laying chicken breeds, providing valuable assistance for breeding work.
[0061] (2) By performing linkage disequilibrium analysis on the four SNP loci 5_41037360, 5_41038069, 5_41044660 and 5_41044663, haplotypes composed of the above four SNP loci that are significantly associated with the age of first laying, total number of eggs laid at 43 weeks of age and the longest consecutive laying days were obtained, which improved the accuracy of the results and can be used for breeding practices of chickens with precocious puberty and high egg production. Attached Figure Description
[0062] Figure 1 : GTF2A1 Gene expression in ovarian tissues, specifically Hy-Line Brown chicken ovarian tissues and Zaozhuang Sunzhi chicken ovarian tissues, with different letters indicating significant differences (P<0.05).
[0063] Figure 2 : GTF2A1 Gene expression in ovarian tissues of Sunzhi chickens (peak egg production) and Sunzhi chickens (late egg production), with different letters indicating significant differences (P<0.05).
[0064] Figure 3 Manhattan plot of genome-wide association analysis under the MLM model for egg production traits.
[0065] Figure 4 Linkage diagram of the 5_41037360 locus and its neighboring SNPs in Langya chicken. Detailed Implementation
[0066] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0067] This invention uses the chicken bGalGal1.mat.broilerGRCg7b reference genome. GTF2A1 Using the gene DNA sequence (Gene ID: 423389) as a reference, in chickens GTF2A1 Four SNP loci associated with chicken egg production were detected in the 4th and 7th and 8th intron regions of the gene, namely:
[0068] SNP1 site: physical location 5_41037360, corresponding to the sequence shown in SEQ ID NO.1, where the 112th base from the 5' end has a polymorphism of A or G.
[0069] SNP2 site: physical location 5_41038069, corresponding to the sequence shown in SEQ ID NO.1, where the 821st base from the 5' end has a T or C polymorphism.
[0070] SNP3 site: physical location 5_41044660, corresponding to the 291st base from the 5' end of the sequence shown in SEQ ID NO.2, which has a polymorphism of G or A.
[0071] SNP4 site: physical location 5_41044663, corresponding to the 294th base from the 5' end of the sequence shown in SEQ ID NO.2, which has a C or T polymorphism.
[0072] This invention has found that the above four SNP loci are significantly associated with egg production traits such as age at first laying, total number of eggs laid at 43 weeks of age, and longest consecutive laying days in chickens. These loci can be used in breeding practices for chickens with precocious puberty and high egg production.
[0073] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.
[0074] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein:
[0075] The Langya chickens used in this embodiment of the invention are from Shandong Jihua Poultry Breeding Co., Ltd.; the Zaozhuang Sunzhi chickens are from Dong Sunzhi Chicken Breeding Technology Co., Ltd.; the Jining Hundred-Day Chickens are from Jining Datang Hundred-Day Chicken Breeding Co., Ltd.; and the Hy-Line Brown chickens are from Shandong Longsheng Agricultural and Animal Husbandry Group Co., Ltd.
[0076] Example 1: Chicken GTF2A1 Gene expression characterization analysis
[0077] 1. Test method:
[0078] Five Hy-Line Brown hens and ten Zaozhuang Sunzhi hens (five at peak egg production and five at the end of egg production) were randomly selected to obtain ovarian tissue for use. GTF2A1 Gene expression characterization analysis.
[0079] Chickens provided by NCBI GTF2A1 Using the gene mRNA sequence (GenBank No. NM_001031207.3) as a reference, primers for real-time quantitative expression of this gene were designed:
[0080] 5′-AACACAAACCCCGTGCCTAA -3′ is the upstream primer sequence, named [GTF2A1-F]; 5′-GCCATCTACAGCCTTGGACT -3′ is the downstream primer sequence, named [GTF2A1-R].
[0081] GTF2A1 The gene real-time quantitative PCR reaction system is 20 μL, and the components are shown in Table 1:
[0082] Table 1: Quantitative PCR Amplification System
[0083]
[0084] The quantitative real-time PCR reaction program was as follows: 95℃ pre-denaturation for 30s; 95℃ for 10s, 60℃ for 30s, with a cycle count of 40; melting curve: 95℃ for 15s, 65℃ for 60s, 95℃ for 1s.
[0085] 2. Test Results:
[0086] In order to investigate GTF2A1 We compared the gene expression characteristics. GTF2A1 Gene expression in the ovarian tissues of Hy-Line Brown and Zaozhuang Sunzhi chickens, results are as follows: Figure 1 As shown, GTF2A1 The gene was expressed in the ovarian tissues of Hy-Line Brown chickens and Zaozhuang Sunzhi chickens, and the expression level in the ovarian tissues of Zaozhuang Sunzhi chickens was significantly higher than that in the ovarian tissues of Hy-Line Brown chickens (P<0.05).
[0087] We further compared GTF2A1 The expression of the gene in the ovarian tissue of Zaozhuang Sunzhi chickens during peak and late laying periods was studied, and the results were as follows: Figure 2 As shown, GTF2A1 The gene was expressed in the ovarian tissue of Zaozhuang Sunzhi chickens (both during peak and late egg production), and the expression level in the ovarian tissue of Zaozhuang Sunzhi chickens at the late egg production stage was significantly higher than that at the peak egg production stage (P<0.05).
[0088] The above results indicate that GTF2A1The expression level of a gene is related to the egg production performance of chickens, and high expression of this gene is detrimental to egg production.
[0089] Example 2: Chicken GTF2A1 Identification and analysis of SNP markers associated with genes and egg production traits in chickens
[0090] 1. Test method:
[0091] 1194 Langya chickens with production performance records were selected, and GWAS analysis was performed using a general linear model for three egg production traits: age at first laying (AFE), total number of eggs laid at 43 weeks of age (E43), and longest consecutive laying days (LCS).
[0092] 2. Test Results:
[0093] GWAS analysis of egg production traits in Langya chickens revealed signals on chromosome 5 associated with age at first laying, longest consecutive laying period, and total egg production at 43 weeks of age. Figure 3 Further analysis revealed that the significant locus associated with AFE (age at onset of labor) was located at 37.846 Mb-42.21 Mb of GGA5. Figure 3 A), the significant locus of E43 (total egg production at 43 weeks of age) is located at position GGA5 at 37.607Mb-45.03Mb. Figure 3 B), the significant LCS (longest consecutive days of production) site is located at 40.733Mb-43.659Mb at GGA5. Figure 3 C), taking the intersection of the locations of the three significant loci for the traits, the results showed that the four most significant loci were all located in GTF2A1 Genetically, the following polymorphisms were observed: SNP1: Physical position 5_41037360, corresponding to the 112th base from the 5' end of the sequence shown in SEQ ID NO.1, exhibiting either A or G polymorphism. SNP2: Physical position 5_41038069, corresponding to the 821st base from the 5' end of the sequence shown in SEQ ID NO.1, exhibiting either T or C polymorphism. SNP3: Physical position 5_41044660, corresponding to the 291st base from the 5' end of the sequence shown in SEQ ID NO.2, exhibiting either G or A polymorphism. SNP4: Physical position 5_41044663, corresponding to the 294th base from the 5' end of the sequence shown in SEQ ID NO.2, exhibiting either C or T polymorphism. Among these, position 5_41037360 was the most significant. P The value is 4.32E-10.
[0094] Example 3: Association analysis of four SNPs with egg production traits
[0095] 1. Test method:
[0096] 1327 Langya chicken hens were selected as experimental subjects. All chickens were hatched in the same batch and raised in the same pen and environment during the brooding and rearing stages, with uniform lighting and feeding management methods.
[0097] Hens were housed individually. The age at first laying, weight at first laying, initial egg weight, and total egg production at 43 weeks of age were measured and recorded. The longest consecutive laying period for each hen was also recorded. After recording, blood samples were collected from all hens via the subwing vein, anticoagulated with EDTA, and stored at -20°C for subsequent genomic DNA extraction.
[0098] Low-depth resequencing was used to determine the genotypes of the four SNP loci of Langya chickens selected in Example 2, and the genotype data of the corresponding SNP loci were obtained; the genotype data of Langya chickens were correlated with the egg production data of Langya chickens.
[0099] 2. Test Results:
[0100] The results are shown in Table 2.
[0101] Table 2: Association analysis of four significant SNPs in the Langya chicken population
[0102]
[0103] Note: The values in the table are the least squares mean ± standard error of AFE (age at first laying), BW (weight at first laying), E43 (number of eggs laid at 43 weeks of age), and LCS (longest consecutive laying). P < 0.05 indicates a significant difference.
[0104] The results showed that locus 5_41037360 was associated with age at labor ( P =0.000002), weight at delivery ( P =0.004574), total egg production at 43 weeks of age ( P =1.50E-10) and the longest consecutive production days ( P =9.12E-10) The effect of the dominant allele was significantly different, with individuals of the A, AG and GG genotypes corresponding to younger age at first egg and higher egg production; the 5_41038069 locus was associated with age at first egg ( P =0.000002), weight at delivery ( P =0.004574), total egg production at 43 weeks of age ( P =1.50E-10) and the longest consecutive production days ( P =9.12E-10) The effect of the dominant allele was significantly different. Individuals with the T, TC and CC genotypes corresponded to younger age at first egg and higher egg production. The 5_41044660 locus was associated with age at first egg ( P =0.000002), weight at delivery (P =0.004574), total egg production at 43 weeks of age ( P =1.50E-10) and the longest consecutive production days ( P =9.12E-10) The effect difference was significant, with the dominant allele being G. Individuals with the AA and GA genotypes corresponded to a smaller age at first egg and a higher number of eggs laid; the 5_41044663 locus was associated with a significantly different age at first egg ( P =0.000002), weight at delivery ( P =0.004574), total egg production at 43 weeks of age ( P =1.50E-10) and the longest consecutive production days ( P The effect of 9.12E-10 was significant, with the dominant allele being C. Individuals with the CT genotype corresponded to a smaller age at first laying and a higher number of eggs laid.
[0105] Example 4: Linkage Disequilibrium Analysis of Four SNPs
[0106] 1. Test method:
[0107] The four SNP loci selected in Example 2 were used to perform linkage disequilibrium analysis in a Langya chicken population using SHEsis software.
[0108] 2. Test Results:
[0109] The results are as follows Figure 4 As shown, D′ is greater than 99% at all four loci, indicating linkage between them. Therefore, grouping these four SNP loci into haplotypes is more accurate than association analysis of individual SNPs.
[0110] Example 5: Haplotype construction and joint analysis of four SNPs
[0111] 1. Haplotype and diploid frequency distribution analysis:
[0112] Based on the whole-genome resequencing results of three breeds—Langya Chicken, Jining Hundred-Day Chicken, and Zaozhuang Sunzhi Chicken—the four SNP loci (5_41037360, 5_41038069, 5_41044660, and 5_41044663) in each individual were arranged in ascending order of physical location. After separating the alleles at each locus and combining them, seven haplotypes were constructed. After removing haplotypes with a frequency less than 0.001, three haplotypes—ATGC, GCAT, and GTGC—were obtained. In Langya Chicken, Jining Hundred-Day Chicken, and Zaozhuang Sunzhi Chicken, ATGC and GCAT were the dominant haplotypes (Table 3).
[0113] Table 3: Frequency distribution of each haplotype in the three populations
[0114]
[0115] Allele and genotype frequency distribution characteristics of two dominant haplotypes and their haplotype combinations (diplotypes) in the Langya chicken population were analyzed, and the results are shown in Table 4-5.
[0116] Table 4: Haplotype frequency analysis of four SNPs in the Langya chicken population
[0117]
[0118] Table 5: Diplotype frequency analysis of four SNPs in the Langya chicken population
[0119]
[0120] As shown in the table above, H1H1 (ATGC / ATGC) and H1H2 (ATGC / GCAT) are the dominant diploid types in the Langya chicken population.
[0121] 2. Association analysis of four SNP diploid types with egg production trait
[0122] Association analysis was performed on SNPs diploids in the Langya chicken population with laying traits such as age at first laying (AFE), body weight at first laying (BW), egg weight at first laying (EW), number of eggs laid at 43 weeks (E43), and maximum consecutive laying count (LCS). The results are shown in Table 6.
[0123] Table 6: Association analysis of four SNPs diploid types with egg production in Langya chicken population
[0124]
[0125] Note: The values in the table are the least squares mean ± standard error of AFE (age at first laying), BW (weight at first laying), E43 (number of eggs laid at 43 weeks), and LCS (longest consecutive laying). P < 0.05 indicates a significant difference.
[0126] The results showed that the diploid types constructed from the four SNP loci were significantly associated with age at first laying, body weight at first laying, number of eggs laid at 43 weeks of age, and maximum consecutive laying count (P = 0.000002; P = 0.005156; P = 1.51E-10; P = 8.32E-10). In Langya chickens, individuals with diploid types H2H2 (GCAT / GCAT) and H1H2 (ATGC / GCAT) corresponded to a younger age at first laying and a higher number of eggs laid. Increasing the proportion of the H2 haplotype in the breeding population helps to advance the sexual maturity time of the flock and increase the number of eggs laid.
[0127] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.
Claims
1. A detection method related to egg production in chickens GTF2A1 The application of primer pairs combining SNP molecular markers in gene intron regions in chicken genetic breeding is characterized by, The GTF2A1 The molecular marker combination of SNPs in gene intron regions includes a first molecular marker and a second molecular marker; The nucleotide sequence of the first molecular marker is shown in SEQ ID NO.1, which includes SNP1 and SNP2 sites. The 112th base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP1 site, and its base is A or G; the 821st base from the 5' end of the sequence shown in SEQ ID NO.1 is the SNP2 site, and its base is T or C. The nucleotide sequence of the second molecular marker is shown in SEQ ID NO.2, which includes SNP3 and SNP4 sites. The 291st base from the 5' end of the sequence shown in SEQ ID NO.2 is the SNP3 site, and its base is G or A; the 294th base from the 5' end of the sequence shown in SEQ ID NO.2 is the SNP4 site, and its base is C or T. The chicken genetic breeding refers to the selection of laying hens that start laying early, have a high total egg production at 43 weeks of age, and have the longest consecutive laying days. Individuals with the AG or GG genotype at SNP1, the TC or CC genotype at SNP2, the AA or GA genotype at SNP3, and the CT or CC genotype at SNP4 exhibit the following egg-laying traits: early onset of egg production, high total egg production at 43 weeks of age, and the longest consecutive laying period. The primer pairs include: primer pair A for detecting the first molecular marker and primer pair B for detecting the second molecular marker; The nucleotide sequences of primer pair A are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively; The nucleotide sequences of primer pair B are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.
2. A method for identifying egg-laying traits in laying hens, characterized in that, Includes the following steps: Using the genomic DNA of the laying hen to be tested as a template, PCR amplification was performed using primers shown in SEQ ID NO.3 and SEQ ID NO.4 (A) to obtain amplification product A; PCR amplification was performed using primers shown in SEQ ID NO.5 and SEQ ID NO.6 (B) to obtain amplification product B; amplification product A and amplification product B were sequenced, and the egg production traits of the laying hen were identified based on the sequencing results. If the sequencing result of amplification product A corresponds to the sequence shown in SEQ ID NO.1 where the 112th base from the 5' end is G and the 821st base is C; and the sequencing result of amplification product B corresponds to the sequence shown in SEQ ID NO.2 where the 291st base from the 5' end is A and the 294th base is C, then it is identified as having the egg-laying traits of early onset of laying age, high total number of eggs laid at 43 weeks of age, and longest consecutive laying days.
Citation Information
Patent Citations
Molecular marking method for three mutation sites in 5 'regulation region of chicken DHCR24 gene and application of molecular marking method in chicken breeding
CN117004695A
Chicken WHAMM gene SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in character breeding for eggs
CN117721212A