Proteins for display on the surface of Zymomonas mobilis

Abstract

The present application discloses a protein for surface display of Zymomonas mobilis. The protein can promote the fusion of a target protein with an expression construct by constructing an expression construct, thereby promoting the display of the target protein on the cell surface of Zymomonas mobilis. The protein provides a new tool for Zymomonas mobilis to fuse heterologous enzymes to express on its cell membrane surface, thereby reducing the amount of commercial enzymes used in the process of producing industrial ethanol using starch as a raw material, and reducing production costs.

Description

Technical Field

[0001] The present application relates to the technical field of surface display of Zymomonas mobilis, and in particular to a protein used for surface display of Zymomonas mobilis. Background Art

[0002] The principle of surface display technology is to connect the gene sequence of the target protein with the gene sequence of the carrier protein and then introduce it into the Zymomonas mobilis cells for expression. The carrier protein can carry the target protein for simultaneous or fusion expression and localize it on the glycosylphosphatidylinositol (GPI) on the surface of the bacteria, thereby realizing the surface display of the target protein. Bacterial surface display technology has been successfully applied to the preparation of recombinant bacterial vaccines, whole cell adsorbents, whole cell catalysts, diagnostic cell solid phase reagents, and biosensors.

[0003] At present, bacteria commonly used for surface display mainly include Escherichia coli, lactic acid bacteria, Xanthomonas, Pseudomonas putida, Bacillus, Zymomonas mobilis, etc. Carrier proteins used in bacterial surface display systems include extracellular membrane proteins, cell surface appendages, lipoproteins, virulence factors, cell membrane pore proteins or cell wall-related proteins, such as OmpA, LamB, OmpC, OmpX and OmpS.

[0004] Zymomonas mobilis is a species of the genus Zymomonas. It is a bacterium that converts glucose and fructose into ethanol through the ED metabolic pathway. Because its pyruvate decarboxylase and alcohol dehydrogenase genes can be efficiently expressed, its ethanol fermentation ability is very outstanding. At the same time, the nutritional requirements for the growth of Z.mobilis are relatively simple. These advantages make Z.mobilis have broad application prospects in the field of industrial production.

[0005] Therefore, developing technology that can display targeted proteins on the surface of Z. mobilis can provide technical support for expanding the substrate range of Z. mobilis and improving its application value. Summary of the invention

[0006] The present application provides a carrier protein. The carrier protein can promote the fusion of the target protein with the expression construct by constructing an expression construct, thereby promoting the display of the target protein on the bacterial surface of Zymomonas mobilis. The carrier protein can increase the way in which Zymomonas mobilis expresses heterologous genes outside the cell membrane. The carrier protein provides a new tool for Zymomonas mobilis to fuse heterologous enzymes to express on its cell membrane surface, thereby reducing the amount of commercial enzymes used in the process of producing industrial ethanol using starch, cellulose, etc. as raw materials, and reducing production costs.

[0007] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0008] In a first aspect, the embodiment discloses a carrier protein for surface display of Zymomonas mobilis, wherein the carrier protein is shown in SEQ ID NO:1.

[0009] In the second aspect, the embodiment discloses a DNA molecule encoding the carrier protein described in the first aspect, as shown in SEQ ID NO:2.

[0010] In a third aspect, the embodiment discloses an expression construct encoding a fusion protein, which is applied to the surface display of Zymomonas mobilis. The expression construct comprises a first nucleotide sequence encoding for expressing the carrier protein described in the first aspect and a second nucleotide sequence encoding for expressing a target protein; wherein the first nucleotide sequence is shown in SEQ ID NO:2.

[0011] In the fourth aspect, the embodiment discloses an expression construct encoding a fusion protein, which is applied to the surface display of Zymomonas mobilis. In some embodiments, the expression construct is a nucleotide sequence formed by sequentially connecting LacUV5 promoter, SEQ ID NO:2, TEV Linker and SEQ ID NO:3. In some embodiments, the expression construct is a nucleotide sequence formed by sequentially connecting LacUV5 promoter, SEQ ID NO:2, TEV Linker, SEQ ID NO:3 and 6×His tag. In some embodiments, the expression construct is a nucleotide sequence formed by sequentially connecting D6, SEQ ID NO:2, TEV Linker and SEQ ID NO:3. In some embodiments, the expression construct is a nucleotide sequence formed by sequentially connecting E6, LacUV5 promoter, SEQ ID NO:2, TEV Linker and SEQ ID NO:3. In some embodiments, the expression construct is a nucleotide sequence formed by sequentially connecting K6, LacUV5 promoter, SEQ ID NO:2, TEV Linker and SEQ ID NO:3. In some embodiments, the expression construct is a nucleotide sequence formed by connecting KKR2, LacUV5 promoter, SEQ ID NO: 2, TEV Linker and SEQ ID NO: 3 in sequence. In some embodiments, the expression construct is a nucleotide sequence formed by connecting D6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag in sequence. In some embodiments, the expression construct is a nucleotide sequence formed by connecting E6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag in sequence. In some embodiments, the expression construct is a nucleotide sequence formed by connecting K6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag in sequence. In some embodiments, the expression construct is a nucleotide sequence formed by connecting KKR2, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag in sequence. In some embodiments, the expression construct is a nucleotide sequence formed by sequentially connecting R6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker and SEQ ID NO: 3. In some embodiments, the expression construct is a nucleotide sequence formed by sequentially connecting R6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag.

[0012] In a fifth aspect, the embodiments disclose a recombinant vector, which includes a basic vector and the expression construct described in the third aspect inserted into the basic vector.

[0013] In a sixth aspect, the embodiments disclose a recombinant Zymomonas mobilis, comprising the expression construct described in the third aspect.

[0014] In a seventh aspect, the embodiments disclose a fusion protein encoded by the expression construct described in the third aspect.

[0015] In an eighth aspect, the embodiment discloses a method for displaying a fusion protein on the surface of Zymomonas mobilis. The method comprises: expressing the fusion protein of the seventh aspect in Zymomonas mobilis; and fixing the fusion protein to the surface of the Zymomonas mobilis. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Plate hydrolysis circles of recombinant Zymomonas mobilis carrying different expression constructs.

[0017] Figure 2 The results of α-amylase activity of recombinant Zymomonas mobilis cell samples carrying different expression constructs are shown in the figure.

[0018] Figure 3 This is a diagram showing the Western Blot detection results of recombinant Zymomonas mobilis cell samples carrying different expression constructs. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0020] The embodiment discloses a carrier protein for surface display of Zymomonas mobilis. The carrier protein is shown in SEQ ID NO:1.

[0021] The embodiment discloses a DNA molecule encoding the carrier protein, as shown in SEQ ID NO:2.

[0022] The embodiment discloses an expression construct encoding a fusion protein, which is applied to the surface display of Zymomonas mobilis, wherein the expression construct comprises a first nucleotide sequence encoding for expressing the carrier protein and a second nucleotide sequence encoding for expressing the target protein; wherein the first nucleotide sequence is as shown in SEQ ID NO:2.

[0023] The term "construct" refers to a recombinant genetic molecule comprising one or more isolated nucleic acid sequences from different sources. Thus, a "construct" is a chimeric nucleic acid molecule in which nucleic acid sequences from two or more different sources are assembled into a single nucleic acid molecule, and includes any construct containing: (1) nucleic acid sequences, including regulatory and coding sequences found in nature (i.e., at least one nucleotide sequence is heterologous relative to at least one other nucleotide sequence); or (2) sequences encoding non-naturally linked functional RNA molecules or protein moieties; or (3) non-naturally linked promoter moieties. Representative "constructs" include any recombinant nucleic acid molecule, such as a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, bacteriophage, or linear or circular single-stranded or double-stranded DNA or RNA nucleic acid molecule, derived from any source, capable of genomic integration or autonomous replication, comprising a nucleic acid molecule to which one or more nucleic acid molecules have been operably linked. The constructs of the present invention generally include the necessary elements to direct the expression of the nucleic acid sequence of interest also contained in the construct. The invention relates to a construct that is a nucleic acid sequence that is operably connected to a nucleic acid sequence that is interested in or is derived from ... operably For the practice of the present invention, general compositions and methods for making and using constructs and Zymomonas mobilis cells are well known to those skilled in the art, see, for example, Molecular Cloning: A Laboratory Manual, 3rd Edition, Vols. 1, 2, and 3. JF Sambrook, DW Russell, and N. Irwin, Cold Spring Harbor Laboratory Press, 2000.

[0024] The terms "polynucleotide" or "nucleic acid" are used interchangeably herein to refer to a polymer of nucleotides, which may be mRNA, RNA, cRNA, cDNA or DNA. The term generally refers to a polymeric form of nucleotides (ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide) of at least 10 bases in length. The term includes single-stranded and double-stranded forms of DNA.

[0025] The term "encoding for" includes reference to nucleotides and / or amino acids that correspond to other nucleotides or amino acids in a transcriptional and / or translational sense.

[0026] The terms "protein" and "polypeptide" are used interchangeably and refer to any polymer of amino acids (dipeptides or peptides of higher order amino acids) linked by peptide bonds or modified peptide bonds. Polypeptides of less than about 10-20 amino acid residues are often referred to as "peptides". The polypeptides of the present invention may contain non-peptide components, such as carbohydrate groups. Carbohydrate and other non-peptide substituents may be added to the polypeptide by the cell producing the polypeptide, and may vary with the cell type. Polypeptides are defined herein according to their amino acid backbone structure; substituents such as carbohydrate groups are generally not specified, but may still be present.

[0027] A "fusion protein" is a hybrid protein expressed by a nucleic acid molecule comprising the nucleotide sequences of at least two genes. In this way, a fusion protein comprises at least two amino acid sequences that are not related to each other in nature.

[0028] The "target protein" refers to a protein used for display on the bacterial surface of Zymomonas mobilis, such as α-amylase (the encoding nucleotide sequence of which is shown in SEQ ID NO: 3).

[0029] In some embodiments, the expression construct further comprises a third nucleotide sequence encoding a charged peptide. Wherein, the third nucleotide sequence is connected to the upstream of the first nucleotide sequence. "Third nucleotide sequence" refers to a polypeptide with a positive or negative charge, which can be applied to a "fusion protein" to change its spatial structure, solubility or charge to promote its expression and display on the surface of the cell of Zymomonas mobilis. In some embodiments, the amino acid sequence of the third nucleotide sequence is selected from (D) x, (E) x, (K) x, (R) x or (KKRKKR) x, wherein X is an integer, such as 1, 2, 3, 4, 5, 6 or a greater value. In some embodiments, the third nucleotide sequence is selected from D6 (SEQ ID NO: 4), E6 (SEQ ID NO: 5), K6 (SEQ ID NO: 6), R6 (SEQ ID NO: 7) or KKR2 (SEQ ID NO: 8).

[0030] In some embodiments, the expression construct further comprises a fourth nucleotide sequence encoding a tag peptide. Wherein, the fourth nucleotide sequence is connected to the downstream of the second nucleotide sequence. The "tag peptide" can be connected to any protein by genetic engineering methods to form a fusion protein of the tag peptide and any protein. At this time, the tag peptide can be connected to either the N-terminus or the C-terminus of the protein. Such a tag peptide fusion protein with a tag peptide connected to the N-terminus or the C-terminus can be purified with high purity in one step using an antibody that specifically binds to the tag peptide of the present application. For example, the "tag peptide" can be a 6×His tag. Therefore, the fourth nucleotide sequence is selected from CACCATCATCATCATCAT, SEQ ID NO:9.

[0031] In certain embodiments, the expression construct further comprises a fifth nucleotide sequence encoding a connecting peptide. Wherein, the fifth nucleotide sequence is used to connect the first nucleotide sequence with the second nucleotide sequence. "Connecting peptide" means a molecule or molecule group (such as a monomer or polymer) that connects two molecules and is generally used to place two molecules in a desired configuration. In a specific embodiment, "connecting peptide" refers to an amino acid sequence connecting a carrier protein and a target protein, and a spacer function compatible with the spacing between the carrier protein and the target protein can be provided to allow the carrier protein to be displayed on the surface of lactic acid bacteria. In other embodiments, "connecting peptide" refers to a chemically connected peptide. In one embodiment, the carrier protein and the target protein are separated by a connecting peptide polypeptide. The connecting peptide polypeptide can be any length. The length of the connecting peptide polypeptide can be about 10-50 amino acids, or about 10-30 amino acids. The connecting peptide length and characteristics can be arbitrary, and can be customized for the protein of interest. Generally, "connecting peptide" is selected or designed to be a non-structured and flexible peptide. For example, an amino acid that does not form a specific secondary structure can be selected. Alternatively, an amino acid can be selected so that it does not form a stable tertiary structure. Alternatively, an amino acid connecting peptide can form a random coil. Such connecting peptides include, but are not limited to, synthetic peptides rich in Gly, Ser, Thr, Gln, Glu or other amino acids often associated with unstructured regions in natural proteins. In some embodiments, the connecting peptide can be, for example, VTTTSSNDTTTSEVTTDTSATTNTSTSSTTKKA, SEQ ID NO: 10. The connecting peptide polypeptide can also be (GGSGGGSGGGSG) x, where X is an integer, such as 1, 2, 3 or greater. Other examples include (GS) 5 or (GS) 10. In some embodiments, the fifth nucleotide sequence is selected from GAAAACCTGTATTTTCAGGGT, SEQ ID NO: 11. In some embodiments, the fifth nucleotide sequence is TEV Linker.

[0032] In some embodiments, the expression construct (Ex-construct-1) is a nucleotide sequence formed by sequentially connecting LacUV5 promoter, SEQ ID NO: 2, TEV Linker and SEQ ID NO: 3.

[0033] In some embodiments, the expression construct (Ex-construct-2) is a nucleotide sequence formed by sequentially connecting LacUV5 promoter, SEQ ID NO: 2, TEVLinker, SEQ ID NO: 3 and 6×His tag.

[0034] In some embodiments, the expression construct (Ex-construct-3) is a nucleotide sequence formed by sequentially connecting D6, SEQ ID NO: 2, TEVLinker and SEQ ID NO: 3.

[0035] In some embodiments, the expression construct (Ex-construct-4) is a nucleotide sequence formed by sequentially connecting E6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker and SEQ ID NO: 3.

[0036] In some embodiments, the expression construct (Ex-construct-5) is a nucleotide sequence formed by sequentially connecting K6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker and SEQ ID NO: 3.

[0037] In some embodiments, the expression construct (Ex-construct-6) is a nucleotide sequence formed by sequentially connecting KKR2, LacUV5 promoter, SEQ ID NO: 2, TEVLinker and SEQ ID NO: 3.

[0038] In some embodiments, the expression construct (Ex-construct-7) is a nucleotide sequence formed by sequentially connecting D6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag.

[0039] In some embodiments, the expression construct (Ex-construct-8) is a nucleotide sequence formed by sequentially connecting E6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag.

[0040] In some embodiments, the expression construct (Ex-construct-9) is a nucleotide sequence formed by sequentially connecting K6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag.

[0041] In some embodiments, the expression construct (Ex-construct-10) is a nucleotide sequence formed by sequentially connecting KKR2, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag.

[0042] In some embodiments, the expression construct (Ex-construct-11) is a nucleotide sequence formed by sequentially connecting R6, LacUV5 promoter, SEQ ID NO: 2, TEVLinker and SEQ ID NO: 3.

[0043] In some embodiments, the expression construct (Ex-construct-12) is a nucleotide sequence formed by sequentially connecting R6, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag.

[0044] The embodiment also discloses a recombinant vector, which includes a basic vector and the expression construct inserted into the basic vector.

[0045] Wherein, "basic vector" can be a plasmid, a viral vector, a phage or an artificial chromosome. Expression vector can also be an integrative vector or a non-integrative vector. An integrative vector can be a vector of a type that is integrated into the genome of a mobilizing Zymomonas cell as a whole. Alternatively, an integrative vector can also be a vector of a type that is integrated into the genome of a mobilizing Zymomonas cell by only a portion thereof (e.g., an expression unit). Expression vector can also be a DNA vector or an RNA vector (e.g., a retrovirus). "Basic vector" can also be a widely used expression vector. Examples of such expression vectors include pUC (e.g., pUC19, pUC18), pSTV, pBR (e.g., pBR322), pHSG (e.g., pHSG299, pHSG298, pHSG399, pHSG398), RSF (e.g., RSF1010), pACYC (e.g., pACYC177, pACYC184), pMW (e.g., pMW119, pMW118, pMW219, pMW218), pQE (e.g., pQE30), and derivatives thereof.

[0046] In one embodiment, the "basic vector" is pEZ15A. pEZ15A is obtained by referring to the method provided in "Yang S, Mohagheghi A, Franden MA, et al. Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars [J]. Biotechnol Biofuels, 2016, 9 (1): 189." To obtain pEZ15A encoding different genes (such as resistance genes), different marker genes can be inserted into it by referring to "Construction and Application of Plasmid pUC19-CM-D [J]. Anhui Agricultural Science, 2010, Public Methods, Issue 19".

[0047] Embodiments also disclose a recombinant Zymomonas mobilis, which is a Zymomonas mobilis comprising the expression construct. Wherein, "Zymomonas mobilis" refers only to strains of Zymomonas mobilis, such as Zymomonas mobilis ZM4 strains, ZM4-dCas12a strains (referenced to "Shen Wei: Construction and application of dual reporter gene system and CRISPR-Cas12a genome editing system of Zymomonas mobilis [D]. Hubei University; 2020." Method acquisition), ZM4-dCas12a-Dldh strain ("Shen W., Zhang J., Geng B., et al. Establishment and application of a CRISPR-Cas12a assisted genome editing system in Zymomonas mobilis [J]. Microb Cell Fact, 2019, 18 (1): 162 "), ZMNP strain (CN115806922A), HAP strain (CN115851569A).

[0048] The embodiments also disclose a fusion protein encoded by the expression construct.

[0049] The embodiment also discloses a method for displaying a fusion protein on the surface of Zymomonas mobilis, comprising: expressing the fusion protein in Zymomonas mobilis; and fixing the fusion protein to the surface of Zymomonas mobilis.

[0050] Hereinafter, the present application will be described in more detail through more specific embodiments, but the present application is not limited to these embodiments.

[0051] 1. Construction of expression constructs and recombinant vectors

[0052] Using the coding gene of the codon-optimized carrier protein as a template, PCR amplification was performed with F1 (SEQ ID NO: 12) and R1 (SEQ ID NO: 13) to obtain a first nucleotide sequence with a pEZ15A homology arm at the 5' end. Using the α-amylase gene encoding Geobacillus stearothermophilus as a template, PCR amplification was performed with F2 (SEQ ID NO: 14) and R2 (SEQ ID NO: 15) to obtain a second nucleotide sequence with a connecting peptide homology arm at the 5' end and a pEZ15A homology arm at the 3' end. Using the shuttle plasmid pEZ15A as a template, PCR amplification was performed with F3 (SEQ ID NO: 16) and R3 (SEQ ID NO: 17) to obtain a reverse amplification vector pEZ15A. Using seamless cloning technology, two segments of genes, the first nucleotide sequence with a pEZ15A homology arm at the 5' end and the second nucleotide sequence with a connecting peptide homology arm at the 5' end and a pEZ15A homology arm at the 3' end, were connected to the nucleotide sequence of the reverse amplification vector pEZ15A to form an expression construct (the expression construct is a nucleotide sequence formed by sequentially connecting the LacUV5 promoter, SEQ ID NO: 2, TEV Linker and SEQ ID NO: 3). The expression constructs provided in other embodiments were cloned in the same way.

[0053] The PCR amplification reaction system contained 50 μL of the following: 2 μL of upstream primer, 2 μL of downstream primer, 25 μL of 2×T8 High-Fidelity Master Mix (Beijing Qingke), 2-10 ng of template and the remainder of ddH2O. The PCR reaction steps included: pre-denaturation at 98°C for 3 min once; 31 cycles: denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C (set at 15 s / kb according to the fragment length); 1 final extension at 72°C for 6 min. The PCR amplification product was purified by gel recovery and stored at -20°C.

[0054] The expression constructs were cloned into the basic vector pEZ15A, and the reaction system was placed on ice for 5 minutes after configuration. The ligation product was transferred into 50 μL of susceptible E. coli DH5α, placed on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and 900 μL of LB medium was added, and cultured at 37°C and 220 rpm for 1 hour. The bacteria were collected by centrifugation at 5000 rpm for 5 minutes, the supernatant was discarded, 100 uL of sterile water was added, mixed evenly, and spread on LB plates with spectinomycin resistance and 1.5% starch. The seamless cloning reaction system includes 5 μL: 0.12 pM of the first nucleotide sequence with a pEZ15A homology arm at the 5' end, 0.12 pM of the second nucleotide sequence with a connecting peptide homology arm at the 5' end and a pEZ15A homology arm at the 3' end, 0.04 pM pEZ15A, 0.5 μL 10×Buffer4 (NEB), 0.5 UT5 Exonuclease (NEB), and the balance of ddH2O. Pick a single colony with a hydrolysis zone around it, use the primer pair 15A-F (SEQ ID NO: 18) and 15A-R (SEQ ID NO: 19) to perform colony PCR, extract plasmids from the verified positive colonies, verify by sequencing, and obtain a recombinant vector.

[0055] The colony PCR reaction system includes 0.25 μL upstream primer, 0.25 μL downstream primer, 5 μL 2×T5 Super PCR Mix (Beijing Qingke), 1 μL template (single colony diluted and mixed in 10 μL ddH2O), and 3.5 μL ddH2O. The colony PCR amplification program includes: 1 cycle: pre-denaturation at 98°C for 5 min; 24 cycles: denaturation at 98°C for 10 s, annealing at 55°C for 15 s, and extension at 72°C for 45 s; 1 cycle: final extension at 72°C for 3 min.

[0056] 2. Recombinant Zymomonas mobilis

[0057] In some embodiments, the recombinant Zymomonas mobilis is obtained by transferring the above-obtained recombinant vector into Zymomonas mobilis.

[0058] For example, ZM4-Δ0028 (Z. mobilis subsp. mobilis ZM4, ATCC3182, ATCC) frozen at -80°C and knocked out the ZMO0028 gene expressing the type IV restriction modification system (RM), which has a higher transformation efficiency, was quickly dissolved and resuspended with RMG5 (5% glucose, 1% yeast extract, 0.2% K2HPO4), cultured statically in a 30°C incubator to activate the strain, cultured overnight for 12 to 16 hours, transferred to RMG5 liquid culture medium and cultured statically in a 30°C incubator until OD600nm was about 0.3, and then centrifuged at 4°C and 5000 rpm for 10 min to collect the cells, washed with sterile water and 10% glycerol, and finally slowly resuspended with 10% glycerol to obtain the competent ZM4.

[0059] Add about 40μg of plasmid to 50μL competent ZM4-Δ0028, mix well and place on ice for 5min, transfer to a 1mm electroporation cup and electroporate for 5.0ms, the electroporation conditions are 200Ω, 25μF, 1.8kv. Transfer the liquid in the electroporation cup after electroporation to 1mL RMG5 medium (5% glucose, 1% yeast extract, 0.2% K2HPO4), incubate at 30℃ for 4-6h, evenly spread on RMG5 plates with spectinomycin resistance (100μg / mL spectinomycin), seal with sealing film and place in a 30℃ incubator for culture. Screen positive colonies and verify by colony PCR (colony PCR verification conditions are the same as above). Activate the verified positive colonies in RMG5 medium containing spectinomycin and preserve the bacteria with glycerol.

[0060] 3. Flat plate hydrolysis circle

[0061] Since the second nucleotide sequence encodes α-amylase, the carrier protein can be used to detect whether the target protein can be displayed on the surface of the mobilization fermentation protein bacteria and its display ability by whether the recombinant mobilization fermentation mononas can produce a hydrolysis circle on the plate and the size of the hydrolysis circle. The recombinant mobilization fermentation mononas were inoculated on the RMG5 plate containing 1.5% starch and cultured in a 30°C incubator for 24 hours. In addition, pEZ15A carrying the second nucleotide sequence was transferred to the mobilization fermentation mononas containing 1.5% starch RMG5 plate culture as a control.

[0062] The results are as follows Figure 1As shown, the control group (empty pEZ15A) had almost no hydrolysis circles, indicating that Zymomonas mobilis itself does not have the ability to produce hydrolysis circles on starch plates, while the recombinant strain displaying amylase on the cell surface has the ability to produce hydrolysis circles on starch plates. In addition, the recombinant Zymomonas mobilis carrying different expression constructs all showed hydrolysis circles of different sizes, indicating that these expression constructs can display α-amylase on the surface of Zymomonas mobilis.

[0063] 4. DNS method to detect enzyme activity

[0064] Recombinant Z. mobilis was cultured in RMG5 medium at 30℃ for 24h. The OD600 of recombinant Z. mobilis was measured by UV spectrophotometer. Then the OD600 was diluted to 1 with sterile water in a 2mL EP tube. In order to prevent the recombinant Z. mobilis from using the glucose produced by substrate decomposition during the experiment, it was first placed at 60℃ for 15 minutes for inactivation. The α-amylase displayed on the surface has strong heat resistance, and this short-term temperature will not affect its enzyme activity. Take 100μL substrate (1% soluble starch) and 100μL pH4.8 Buffer and add them to a 2mL EP tube, and add 100μL bacterial solution. React in a water bath for 5min, add 300μL DNS to terminate the reaction, boil for 5min, cool and transfer to an EP tube, and adjust the volume to 2mL. No bacterial solution was added to the control group before the reaction. After the reaction at 60℃, DNS was added to terminate the reaction and then bacterial solution was added, and it was directly boiled for 5min. Finally, the spectrophotometer was used to detect at a wavelength of λ=540nm, adjusted to zero, the control group was set to zero, the OD value of the experimental group (3 parallel samples) was detected, and the data was recorded. The enzyme activity was calculated according to the glucose standard curve.

[0065] like Figure 2 As shown, the α-amylases expressed by these expression constructs exhibited different enzymatic activities.

[0066] 4. Western Blot Detection

[0067] (1) Sample preparation: During the sampling process, the amount of cells was first controlled by OD600 to avoid differences between samples. The cells were disrupted by ultrasonic treatment (Φ3, 100W, 3s / 3s). The total protein concentration of the cell lysate was quantified by the Bradford method. The prepared sample was mixed with the loading buffer, placed in a metal bath at 105°C for 10 min, and then stored at -20°C for later use.

[0068] (2) SDS-PAGE gel electrophoresis

[0069] (3) Transfer: After electrophoresis, use Trans- The proteins were transferred from the gel to a methanol-activated PVDF membrane using the Semi-Dry (Bio-Rad Inc., USA) transfer system (25 V, 20 min).

[0070] (4) Blocking: After transfer, the PVDF membrane was blocked in 5% skim milk dissolved in PBST for one hour.

[0071] (5) Incubation with primary antibody: After blocking, add primary antibody (His-Tag Antibody, 1:5000, Proteintech Inc., China) to incubate the PVDF membrane and place it on a shaker at room temperature for 1 hour (or overnight on a shaker at 4°C). Then wash the membrane with PBST (PBS containing 0.05% Tween) for 5 minutes and repeat 3 times.

[0072] (6) Incubation with secondary antibody: Add secondary antibody (Peroxidase-conjugated goat anti-Mouse IgG, 1:5000, Proteintech Inc., China) to incubate the PVDF membrane and place it on a shaker at room temperature for 1 hour (or overnight on a shaker at 4°C). Then wash the membrane with PBST (PBS containing 0.05% Tween) for 5 minutes and repeat 3 times.

[0073] (7) Imaging: In a dark room, mix the ECL reagent in a 1:1 ratio (about 100 uL), use filter paper to slightly dry the PDVF membrane and place it on a glass plate, add an appropriate amount of developer on the protein surface, and use the AI600 imaging system (GE Inc., USA) for imaging analysis.

[0074] Since starch is a large molecule and cannot enter cells, the hydrolysis cycle shows that amylase is on the cell surface or is secreted. Figure 3 The Western blot test results shown in the figure show that there is fluorescence on the cell surface but not in the supernatant, indicating that the amylase is anchored on the cell surface rather than secreted into the supernatant, which once again shows that the carrier protein provided by the present application can promote the display of α-amylase on the surface of Zymomonas mobilis.

[0075] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. An expression construct encoding a fusion protein, which is applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting LacUV5 promoter, SEQ ID NO: 2, TEV Linker and SEQ ID NO:

3.

2. An expression construct encoding a fusion protein is applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag.

3. An expression construct encoding a fusion protein is applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting D6, SEQ ID NO: 2, TEV Linker and SEQ ID NO: 3 as shown in SEQ ID NO:

4.

4. An expression construct encoding a fusion protein is applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting E6 and LacUV5 promoters as shown in SEQ ID NO:5, SEQ ID NO:2, TEV Linker and SEQ ID NO:

3.

5. An expression construct encoding a fusion protein is applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting K6 and LacUV5 promoters as shown in SEQ ID NO: 6, SEQ ID NO: 2, TEV Linker and SEQ ID NO:

3.

6. An expression construct encoding a fusion protein, applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting KKR2, LacUV5 promoter, SEQ ID NO:2, TEV Linker and SEQ ID NO:3 as shown in SEQ ID NO:

8.

7. An expression construct encoding a fusion protein is applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting D6, LacUV5 promoter, SEQ ID NO:2, TEV Linker, SEQ ID NO:3 and 6×His tag as shown in SEQ ID NO:

4.

8. An expression construct encoding a fusion protein, applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting E6, LacUV5 promoter, SEQ ID NO:2, TEV Linker, SEQ ID NO:3 and 6×His tag as shown in SEQ ID NO:

5.

9. An expression construct encoding a fusion protein, applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting K6, LacUV5 promoter, SEQ ID NO:2, TEV Linker, SEQ ID NO:3 and 6×His tag as shown in SEQ ID NO:

6.

10. An expression construct encoding a fusion protein, applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting KKR2, LacUV5 promoter, SEQ ID NO: 2, TEV Linker, SEQ ID NO: 3 and 6×His tag as shown in SEQ ID NO:

8.

11. An expression construct encoding a fusion protein, applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting R6, LacUV5 promoter, SEQ ID NO:2, TEV Linker and SEQ ID NO:3 as shown in SEQ ID NO:

7.

12. An expression construct encoding a fusion protein, applied to the surface display of Zymomonas mobilis, wherein the expression construct is a nucleotide sequence formed by sequentially connecting R6, LacUV5 promoter, SEQ ID NO:2, TEV Linker, SEQ ID NO:3 and 6×His tag as shown in SEQ ID NO:

7.

13. A recombinant vector, comprising a basic vector and the expression construct according to any one of claims 1 to 12 inserted into the basic vector.

14. A recombinant Zymomonas mobilis comprising the expression construct according to any one of claims 1 to 12.

15. A fusion protein encoded by the expression construct of any one of claims 1 to 12.

16. A method for displaying a fusion protein on the surface of Zymomonas mobilis, comprising: Expressing the fusion protein of claim 15 in Zymomonas mobilis; and immobilizing the fusion protein to the surface of the Zymomonas mobilis.

Images