Cinnamyl alcohol dehydrogenase gene of Gymnomitrion rotundifolium and its application

By cloning the cinnamol dehydrogenase gene HmnCAD3 from the pine leaf naked capsule and successfully expressing its protein, the shortcomings in the study of lignin biosynthesis pathway in primitive terrestrial plants were solved, effective catalysis of the lignin monomer biosynthesis pathway, and its role in plant response to stress was revealed.

CN118667779BActive Publication Date: 2025-06-17HEBEI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410583381.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-11
Publication Date
2025-06-17
Estimated Expiration
2044-05-11

AI Technical Summary

Technical Problem

The prior art studies on the biosynthesis pathways of lignin in primitive terrestrial plants with few studies, especially the cinnamon alcohol dehydrogenase (CAD) gene, which has affected the understanding of the evolutionary mechanisms of early terrestrial plants.

Method used

The cinnamol dehydrogenase gene HmnCAD3 was cloned from the bryophyte round leaf naked capsule, and the protein encoded by HmnCAD3 was successfully obtained through phylogenetic analysis, recombinant expression vector, host cell construction and heterologous expression. This protein exhibits good catalytic activity in the lignin monomer biosynthesis pathway and plays a role in plants' fight against salicylic acid hormone, drought and low temperature stress.

Benefits of technology

The discovery of HmnCAD3 provides an important genetic resource for exploring the evolution of lignin in early terrestrial plants. Its catalytic performance is superior to other CAD members, has a significant contribution to lignin monomer biosynthesis, and plays a role in plants in coping with multiple stress conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004834750260000061
    Figure BDA0004834750260000061
  • Figure BDA0004834750260000062
    Figure BDA0004834750260000062
  • Figure HDA0004834750270000011
    Figure HDA0004834750270000011
Patent Text Reader

Abstract

The present invention belongs to the field of genetic engineering, and particularly relates to a cinnamon alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion obtusatum and its application. The nucleotide sequence of the cinnamon alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion obtusatum is shown as SEQ ID NO.1, and the amino acid sequence of the protein encoded by it is shown as SEQ ID NO.2. Through phylogenetic analysis, although the cinnamon alcohol dehydrogenase encoded by HmnCAD3 of the present invention belongs to the three types of CAD members, its catalytic performance is significantly better than that of other three types of CAD members, and it shows good catalytic activity for five cinnamaldehyde substrates in the lignin monomer biosynthesis pathway, namely p-hydroxycinnamaldehyde, caffealdehyde, coniferaldehyde, 5-OH coniferaldehyde and sinapaldehyde. In addition, experiments show that HmnCAD3 plays a certain role in the processes of plant resistance to hormones, drought and low temperature stress. The discovery of HmnCAD3 of the present invention is of great significance for exploring the evolution of lignin in early terrestrial plants in the future.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to a cinnamyl alcohol dehydrogenase gene of Gymnomitrion rotundifolium and its application. Background Art

[0002] Bryophytes are the earliest terrestrial plants, and their origin can be traced back to 520 million years ago at the earliest. They are considered to be a transitional group in the evolution from early aquatic plants to vascular plants after entering the land. When plants first landed from the aquatic environment, they faced numerous challenges, such as the loss of buoyancy support in water, direct sunlight of ultraviolet rays, drought, grazing by animals, and invasion by pathogenic bacteria. To resist these stresses and adapt to the complex terrestrial environment, plants have evolved their own lignin biosynthesis pathway.

[0003] The appearance of lignin is an important sign of the evolution from aquatic plants to terrestrial plants. Lignin is a complex macromolecular structure formed by the cross-linking and polymerization of three lignin monomers, namely p-hydroxyphenyl cinnamyl alcohol, coniferyl alcohol, and sinapyl alcohol, and is divided into p-hydroxyphenyl lignin subunit (H lignin subunit), guaiacyl lignin subunit (G lignin subunit), and syringyl lignin subunit (S lignin subunit).

[0004] Cinnamyl alcohol dehydrogenase (CAD) is a key enzyme involved in the last step of the biosynthesis of three lignin monomers. It can reduce cinnamaldehyde compounds to cinnamyl alcohol compounds and plays an important role in the biosynthesis of three lignin subunits. CAD is a multigene family. A plant may contain multiple CAD subtypes. In phylogenetic analysis, CAD members are usually divided into four categories. One category contains true CAD members with generally good catalytic activity. Some CAD members in the second category have catalytic functions. CAD members in the third category have no catalytic activity or extremely weak catalytic activity. CAD members in the fourth category have good catalytic activity.

[0005] Higher angiosperms have a complete lignin biosynthesis pathway, but in primitive terrestrial plants, bryophytes, relatively few studies have been conducted on this pathway. Summary of the Invention

[0006] The purpose of the present invention is to provide a cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion rotundifolium and its application.

[0007] The present invention adopts the following technical solutions:

[0008] The present invention provides a cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion rotundifolium, and its nucleotide sequence is as shown in SEQ ID NO.1.

[0009] The protein encoded by the above-mentioned cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion rotundatum has an amino acid sequence as shown in SEQ ID NO. 2.

[0010] The present invention also provides a recombinant expression vector and a host cell containing the above-mentioned cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion rotundatum.

[0011] The present invention also provides a method for soluble expression of the above-mentioned cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion rotundatum, specifically as follows:

[0012] The cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion rotundatum is constructed onto the prokaryotic expression vector pET32a(+), and then it is co-transformed with the pTf16 molecular chaperone into BL21(DE3) competent cells for heterologous expression. It is expressed as a protein under the induction of isopropyl-β-D-thiogalactoside and arabinose, and the solubility of this protein is good.

[0013] The present invention also provides the application of the protein encoded by the above-mentioned cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion rotundatum in the reaction of catalyzing aldehyde substrates to generate corresponding alcohol compounds.

[0014] Preferably, the substrate is five cinnamaldehyde substrates in the lignin monomer biosynthesis pathway, namely p-hydroxycinnamaldehyde, caffealdehyde, coniferyl aldehyde, 5-OH coniferyl aldehyde, and sinapaldehyde.

[0015] The present invention also provides the application of the above-mentioned cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnomitrion rotundatum in plant resistance to salicylic acid hormone, drought stress or low temperature stress.

[0016] Preferably, the plant is a bryophyte.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] The present invention first clones the cinnamyl alcohol dehydrogenase gene HmnCAD3 from the bryophyte Gymnomitrion rotundatum. HmnCAD3 is involved in the biosynthesis of lignin monomers in Gymnomitrion rotundatum, and its discovery is of great significance for exploring the evolution of lignin in early terrestrial plants in the future.

[0019] Through phylogenetic analysis, although the cinnamyl alcohol dehydrogenase encoded by HmnCAD3 of the present invention belongs to the three types of CAD members, its catalytic performance is significantly better than that of the other three types of CAD members (generally, the three types of CAD members have no catalytic activity or extremely weak catalytic activity towards cinnamaldehyde substrates). It shows good catalytic activity towards the five cinnamaldehyde substrates in the lignin monomer biosynthesis pathway, namely p-hydroxycinnamaldehyde, caffealdehyde, coniferyl aldehyde, 5-OH coniferyl aldehyde, and sinapaldehyde. In addition, experiments show that HmnCAD3 plays a certain role in the processes of plant resistance to hormones, drought, and low temperature stress. Brief Description of the Drawings

[0020] Figure 1 Phylogenetic tree constructed for Example 1

[0021] Figure 2 Agarose gel electrophoresis results after amplification of the full-length sequence of HmnCAD3

[0022] Figure 3 Results of monoclonal positive verification after constructing HmnCAD3 into the TA / Blunt-Zero blunt vector

[0023] Figure 4 Results of monoclonal positive verification after constructing HmnCAD3 into the prokaryotic expression vector pET32a(+) Figure 5 SDS-PAGE gel diagram of the protein after extraction and purification after co-transforming pET32(+)-HmnCAD3 and the molecular chaperone pTf16 into BL21(DE3) for expression; where, M: protein Marker; 1: purified HmnCAD3 protein

[0024] Figure 6 Detection results of HPLC injection after enzymatic reactions of pET32a(+) negative control protein and HmnCAD3 using p-hydroxycinnamaldehyde, caffealdehyde, coniferyl aldehyde, 5-OH coniferyl aldehyde, and sinapaldehyde as substrates respectively. Among them, A: using p-hydroxycinnamaldehyde as the substrate and p-hydroxycinnamyl alcohol as the product standard; B: using caffealdehyde as the substrate and caffeol as the product standard; C: using coniferyl aldehyde as the substrate and coniferyl alcohol as the product standard; D: using 5-OH coniferyl aldehyde as the substrate and 5-OH coniferyl alcohol as the product standard; E: using sinapaldehyde as the substrate and sinapyl alcohol as the product standard

[0025] Figure 7 Changes in the relative expression levels of HmnCAD3 at different time periods after treating Gymnomitrion obtusum with 100 μM SA, 20% polyethylene glycol (PEG6000), and low temperature environment respectively Detailed Description of the Invention

[0026] The following examples are used to further illustrate the present invention in detail, in order to have a better understanding of the present invention, but do not constitute a limitation to the present invention

[0027] p - Hydroxycinnamaldehyde, caffealdehyde, 5 - hydroxyconiferyl aldehyde, sinapaldehyde, p - hydroxycinnamyl alcohol, caffeyl alcohol, and 5 - hydroxyconiferyl alcohol used in the following examples were all synthesized in the laboratory. Coniferyl aldehyde, coniferyl alcohol, and sinapyl alcohol were purchased from Aladdin Reagent (Shanghai) Co., Ltd. Reduced coenzyme II tetrasodium (NADPH) was purchased from Coolaber Biotechnology Co., Ltd. Other kits, restriction enzymes, vectors, competent cells, culture media, nucleic acid and protein gels, reagents, etc. can all be purchased through commercial channels.

[0028] Example 1 Construction of Phylogenetic Tree

[0029] The transcriptome database of Gymnomitrion rotundifolium was analyzed, and gene sequences were input into the NCBI (http: / / www.ncbi.nlm.nih.gov / ) website for function prediction. A possible cinnamyl alcohol dehydrogenase gene was screened out and named HmnCAD3. Its nucleotide sequence is shown in SEQ ID NO.1. The open reading frame (ORF) of this sequence consists of 1077 bases and encodes 359 amino acids. The amino acid sequence encoded by it is shown in SEQ ID NO.2.

[0030] The amino acid sequences of cinnamyl alcohol dehydrogenase (CAD) in other plant species were searched in the NCBI website. The amino acid sequence of cinnamyl alcohol dehydrogenase encoded by HmnCAD3 was aligned with the CAD amino acid sequences in other species using DNAMAN v9.0.1 software to analyze the domain of HmnCAD3. The phylogenetic tree was constructed by the neighbor - joining method using MAGE 11.0.11 software, and the phylogenetic relationship between the cinnamyl alcohol dehydrogenase encoded by HmnCAD3 and the homologous enzymes in other species was analyzed. As Figure 1 shown, the phylogenetic tree is divided into four major clusters, and each cluster corresponds to a class of CAD members, that is, the CAD members in the phylogenetic tree are divided into four categories. It can be seen that the cinnamyl alcohol dehydrogenase encoded by HmnCAD3 clusters with three classes of CAD (multiple CAD members with no or weak substrate catalytic activity), showing a relatively close phylogenetic relationship. Therefore, from the perspective of evolutionary analysis, the cinnamyl alcohol dehydrogenase encoded by HmnCAD3 belongs to the three classes of CAD.

[0031] Example 2 Cloning of HmnCAD3

[0032] (1) RNA Extraction and cDNA Synthesis

[0033] Weigh 100 mg of Gymnomitrion rotundifolium and place it in a pre - cooled mortar. Grind it thoroughly until it becomes a white powder, and quickly transfer it into a sterile and enzyme - free centrifuge tube pre - cooled with liquid nitrogen. According to the operating steps in the instruction manual, use a polysaccharide - polyphenol plant total RNA extraction kit to extract the RNA of Gymnomitrion rotundifolium.

[0034] Using the RNA of *Gymnomitrion rotundifolium* as a template, the first strand of cDNA was synthesized by reverse transcription using an RNA reverse transcription kit, and the reaction conditions were carried out according to the kit instructions.

[0035] (2) Amplification of the full-length sequence of HmnCAD3

[0036] Primers HmnCAD3-F and HmnCAD3-R were designed using Primer Premier5 software. Using the reverse-transcribed cDNA as a template, the full-length sequence of HmnCAD3 was amplified with a high-fidelity DNA polymerase (Takara).

[0037] The amplification primer HmnCAD3-F was 5’GCAGCGGTCTGGGATAAT 3'; HmnCAD3-R was 5'TGCTGAGGCTCCTATCCACT 3'.

[0038] The amplification system was as follows:

[0039] 1 μL of cDNA, 1 μL of HmnCAD3-F, 1 μL of HmnCAD3-R, 12.5 μL of high-fidelity DNA polymerase, and 9.5 μL of ddH2O.

[0040] The PCR amplification program was as follows:

[0041] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 53°C for 15 s, extension at 72°C for 30 s, 35 cycles of amplification; extension at 72°C to complete for 10 min; incubation at 4°C.

[0042] After the PCR program was completed, the amplification products were detected by agarose gel electrophoresis, and the band positions were observed. The results were as Figure 2 shown. By comparing with the agarose gel electrophoresis Marker, a bright band (the target band) was visible at about 1203 bp.

[0043] (3) Ligation of blunt-ended vector and transformation of DH5α competent cells

[0044] The target band was recovered using a gel extraction kit. The following components were added to ligate the PCR product to the TA / Blunt-Zero blunt-ended vector (Vazyme):

[0045] 1 μL of 5×TA / Blunt-Zero Cloning Mix, 1 - 4 μL of PCR product, and ddH2O was added to 5 μL.

[0046] After allowing the components to react at room temperature for 5 min, immediately transform them into DH5α competent cells. After adding LB liquid medium and shaking for activation, spread them on LB solid medium (Amp 100 μg / mL), and place the culture dish upside down in a 37 °C incubator for overnight culture of monoclonal colonies. Pick monoclonal colonies into LB liquid medium (Amp 100 μg / mL) and culture them with shaking at 37 °C for 3 - 4 h. Using the bacterial solution as a template, perform monoclonal positive verification by PCR with rTaq DNA polymerase (Takara).

[0047] The amplification system is as follows:

[0048] 10×PCR Buffer (Mg 2+ plus) 2 μL, 2.5 mM dNTP Mixture 2 μL, rTaq 0.2 μL, HmnCAD3 - F 1 μL, HmnCAD3 - R 1 μL, ddH2O 11.8 μL, Template 2 μL.

[0049] The PCR amplification program is as follows:

[0050] Pre - denature at 95 °C for 5 min; denature at 95 °C for 30 s, anneal at 53 °C for 30 s, extend at 72 °C for 2 min, and perform 35 cycles of amplification; extend at 72 °C for 10 min to complete; incubate at 4 °C.

[0051] After the PCR program is completed, perform agarose gel electrophoresis on the amplification products. The results of monoclonal positive verification are as Figure 3 shown. By comparing with the agarose gel electrophoresis Marker, a bright single band is observed. Sequence the bacterial solution. After correct sequencing, obtain the full - length cDNA sequence of HmnCAD3, and name the recombinant blunt - end vector TA / Blunt - HmnCAD3.

[0052] Example 3 Construction of the prokaryotic expression vector of HmnCAD3

[0053] Based on the information of the restriction enzyme sites on HmnCAD3 and the pET32a(+) prokaryotic expression vector, select two restriction enzyme sites, BamHI and KpnI. Design primers HmnCAD3 - pET32a - F and HmnCAD3 - pET32a - R with restriction enzyme sites, and perform PCR amplification using the extracted TA / Blunt - HmnCAD3 plasmid as a template to obtain the HmnCAD3 ORF sequence with restriction enzyme sites.

[0054] The amplification primers are as follows:

[0055] HmnCAD3 - pET32a - F: 5'GGGGTACCATGGTGAACTCGTTGATTGG 3';

[0056] HmnCAD3-pET32a-R: 5'CGGGATCCTTATAATTCGTGCAGAGTGT 3'.

[0057] The amplification system is as follows:

[0058] 1 μL of cDNA, 1 μL of HmnCAD3-pET32a-F, 1 μL of HmnCAD3-pET32a-R, 12.5 μL of high-fidelity DNA polymerase, 9.5 μL of ddH2O.

[0059] The PCR amplification program is as follows:

[0060] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 53°C for 15 s, extension at 72°C for 30 s, with 35 cycles of amplification; extension at 72°C for 10 min to complete; incubation at 4°C.

[0061] Electrophorese the above PCR products using agarose gel, and use a gel extraction kit to extract the target band.

[0062] Extract the pET32a(+) plasmid, and use a restriction enzyme (Takara) to digest the pET32a(+) plasmid and the gel-extracted product of HmnCAD3ORF with restriction enzyme sites. The digestion system is shown in Table 1:

[0063] Table 1. Digestion system

[0064]

[0065] Digest at 37°C for 3.5 h, and perform gel extraction on the digested product.

[0066] Ligate the gel-extracted product of HmnCAD3ORF after digestion and the gel-extracted product of pET32a(+) after digestion using T4 ligase (Takara). The ligation system is as follows:

[0067] Table 2. Ligation system

[0068]

[0069] Ligate overnight at 16°C. Transform the ligation product into DH5α competent cells. After adding LB liquid medium and shaking for activation, spread it on LB solid medium (Amp 100 μg / mL), and invert the culture dish and incubate it overnight in a 37°C incubator to culture monoclonal colonies. Pick monoclonal colonies into LB liquid medium (Amp 100 μg / mL), shake and culture at 37°C for 3 - 4 h. Use the bacterial liquid as a template and perform PCR with rTaq DNA polymerase for monoclonal positive verification.

[0070] The amplification system is as follows:

[0071] 10×PCR Buffer (Mg 2+ plus) 2 μL, 2.5 mM dNTP Mixture 2 μL, rTaq 0.2 μL, HmnCAD3-pET32a-F 1 μL, HmnCAD3-pET32a-R 1 μL, ddH2O 11.8 μL, Template 2 μL.

[0072] The PCR amplification procedure is as follows:

[0073] Pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing at 53 °C for 30 s, extension at 72 °C for 2 min, 35 cycles of amplification; extension at 72 °C for 10 min to complete; incubation at 4 °C.

[0074] The PCR product bands were observed by agarose gel electrophoresis, and the monoclonal positive verification results are as Figure 4 shown. By comparing with the agarose gel electrophoresis Marker, a bright single band was observed. The positive clone bacterial solution was sequenced for verification. After correct sequencing, the bacteria were stored. The prokaryotic expression vector construction was completed and named pET32a(+)-HmnCAD3.

[0075] Example 4 Expression of HmnCAD3

[0076] (1) Transform 2 μL of pET32a(+)-HmnCAD3 plasmid into BL21(DE3) competent cells containing the pTf16 chaperone. The transformation method and activation are the same as those for DH5α competent cells. The activated bacterial solution was spread on LB solid medium (Amp 100 μg / mL, Cm 30 μg / mL), and the culture dish was inverted and cultured overnight at 37 °C for monoclonal colonies. Single colonies were picked into LB liquid medium (Amp 100 μg / mL, Cm 30 μg / mL) and cultured with shaking at 37 °C for 3 - 4 h until it became turbid. Using the bacterial solution as a template, rTaq DNA polymerase PCR was used for monoclonal positive verification.

[0077] The amplification system is as follows:

[0078] 10×PCR Buffer (Mg 2+ plus) 2 μL, 2.5 mM dNTP Mixture 2 μL, rTaq 0.2 μL, HmnCAD3-pET32a-F 1 μL, HmnCAD3-pET32a-R 1 μL, ddH2O 11.8 μL, Template 2 μL.

[0079] The PCR amplification procedure is as follows:

[0080] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 2 min, amplification for 35 cycles; extension at 72°C for 10 min to complete; incubation at 4°C.

[0081] Observe the PCR product bands by agarose gel electrophoresis. The bacterial liquid with a single target band is the positive clone bacterial liquid.

[0082] (2) Inoculate the positive clone bacterial liquid into 4 mL of LB liquid medium (Amp 100 μg / mL, Cm 30 μg / mL), and activate it by shaking overnight at 37°C. Then add it to 200 mL of LB liquid medium (Amp 100 μg / mL, Cm 30 μg / mL, 0.5 mg / mL arabinose) at a ratio of 1:100 and culture it by shaking at 37°C until the OD 600 value is about 0.6.

[0083] (3) Add IPTG to 0.5 mM in 200 mL of the bacterial liquid, and culture it by shaking at a low speed at 16°C overnight to induce protein expression.

[0084] (4) Centrifuge to collect the bacterial cell precipitate, wash the bacterial cells twice with pre-cooled Solution 1 (20 mM Tris-HCl, 500 mM NaCl, pH 8.0), resuspend the bacterial cells, ultrasonically disrupt the bacterial cells on ice, centrifuge the disrupted bacterial cell solution at 4°C and 12,000 rpm for 20 min, and collect the supernatant.

[0085] (5) Filter and balance the Ni-NTA column twice with pre-cooled Solution 1 at 4°C. Add the disrupted supernatant to the balanced Ni-NTA column and filter at 4°C, discard the filtrate. Add 20 mL of pre-cooled Solution 2 (20 mM Tris-HCl, 500 mM NaCl, 10 mM imidazole, pH 8.0) to the Ni-NTA column to wash the miscellaneous proteins in the column, discard the filtrate. Add 4 mL of pre-cooled Solution 3 (20 mM Tris-HCl, 500 mM NaCl, 250 mM imidazole, pH 8.0) to the Ni-NTA column to elute the target protein with His-tag, and collect the filtrate.

[0086] (6) Fill the 30 kDa ultrafiltration tube with pre-cooled Solution 1, centrifuge at 2100 rcf for 5 min to balance the ultrafiltration tube, discard the filtrate and the solution in the ultrafiltration tube, and repeat this step. Add the purified target protein in portions to the balanced ultrafiltration tube, centrifuge at 4°C and 2100 rcf for 15 min, and discard the filtrate. Fill the ultrafiltration tube with Solution 1 for buffer exchange, centrifuge at 4°C and 2100 rcf for 15 min, discard the filtrate, repeat this step and centrifuge multiple times until the protein solution in the ultrafiltration tube is concentrated to an appropriate volume.

[0087] (7) The absorbance of the protein was detected at a wavelength of 562 nm using a BCA Protein Concentration Assay Kit (Beyotime), and the concentration of the target protein was calculated.

[0088] (8) An equal volume of 2× Loading buffer was added to the protein sample, and the sample was boiled in water for 5 min. 15 μL of the protein sample was loaded into the wells of a protein SDS-PAGE gel. The voltage was set at 100 V. When the sample ran to the junction of the stacking gel and the separating gel, the voltage was changed to 120 V.

[0089] (9) After electrophoresis, the gel was stained with Coomassie Brilliant Blue staining solution and decolorized after 2 h. The results of SDS-PAGE electrophoresis were as Figure 5 shown. An obvious protein band was observed at approximately 58 kDa, which was the HmnCAD3 protein.

[0090] Example 5 Detection of HmnCAD3 protease activity

[0091] Using p-hydroxycinnamaldehyde, caffealdehyde, coniferyl aldehyde, 5-OH coniferyl aldehyde, and sinapaldehyde as substrates respectively, the enzyme activity reaction system was: 100 mM KPB Buffer (pH 7.0), 1 mM NADPH, 0.2 mM substrate, 1 μg of HmnCAD3 protein, and the reaction volume was 100 μL. The reaction with HmnCAD3 protein was used as the experimental group, and at the same time, the reaction of the pET32a(+) empty vector protein was used as a negative control under the same reaction system. After mixing all components, they were incubated in a 37 °C water bath for 30 min, and 10 μL of glacial acetic acid was added to terminate the reaction. Ethyl acetate was added for extraction twice, the two ethyl acetate phases were collected and evaporated to dryness, 100 μL of methanol was added for reconstitution, and high performance liquid chromatography (HPLC) was used for analysis. The HPLC elution system was: injection volume 20 μL; flow rate 0.8 mL / min; detection wavelength 280 nm; mobile phase A was 0.5% aqueous acetic acid solution, and mobile phase B was acetonitrile. Elution conditions: 0 - 18 min, gradient elution of B phase from 5% to 25%; 18.01 - 28 min, isocratic elution of B phase at 5%.

[0092] The results of HPLC analysis were as Figure 6 shown. Compared with the peak emergence times of each product standard, there was no product peak in the control group, indicating that the pET32a(+) empty vector protein did not catalyze the formation of products, while product peaks appeared in the experimental group respectively, indicating that the HmnCAD3 protein could catalyze p-hydroxycinnamaldehyde, caffealdehyde, coniferyl aldehyde, 5-OH coniferyl aldehyde, and sinapaldehyde to form the corresponding products.

[0093] Example 6 Response of HmnCAD3 to stress

[0094] To test whether HmnCAD3 is involved in stress resistance, the following three stress treatments were set up respectively:

[0095] (1) Spraying 100 μM salicylic acid (SA) on *Gymnomitrion obtusatum* for hormone stress treatment;

[0096] (2) Spraying 20% polyethylene glycol (PEG6000) solution on *Gymnomitrion obtusatum* to simulate drought stress;

[0097] (3) Placing *Gymnomitrion obtusatum* in a 4 °C incubator for low-temperature culture to simulate cold stress.

[0098] Plant samples were collected at 0 h, 6 h, 12 h, 24 h, 36 h, 48 h, and 72 h after each stress treatment, quickly frozen with liquid nitrogen, and stored at -80 °C for later use.

[0099] RNA was extracted from each of the above collected samples, and 1 μg of RNA was reverse transcribed into cDNA. Quantitative real-time PCR (qPCR) primers HmnCAD3-QF and HmnCAD3-QR were designed. The gene sequence of Elongation factor 1α in *Gymnomitrion obtusatum* was selected as the internal reference gene, and qPCR primers EF1α-QF and EF1α-QR were designed. qPCR was performed using ChamQ universal SYBR qPCR Master Mix (Servicebio).

[0100] The qPCR primer sequences are as follows:

[0101] HmnCAD3-QF: 5'ACAGAGGTGGGTTCAAATG 3';

[0102] HmnCAD3-QR: 5'TATCTTCAGGACATACCGCT 3';

[0103] EF1α-QF: 5'ATTGTGCCGTTCTCATCATC 3';

[0104] EF1α-QR: 5'CAAAAGGAATCTTCTCGGGA 3'.

[0105] The qPCR reaction system is as follows:

[0106] 2×Universal Blue SYBR Green qPCR Master Mix 5 μL, 10 μM HmnCAD3-QF 1 μL, 10 μM HmnCAD3-QR 1 μL, cDNA 1 μL, ddH2O 2 μL.

[0107] The qPCR procedure is as follows:

[0108] Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, 40 cycles of reaction; melting curve: 95°C for 10 s, 65°C for 60 s, 97°C for 1 s, 1 cycle of reaction.

[0109] The qPCR experiment was repeated three times for each plant sample, and the relative expression levels of the HmnCAD3 gene in the samples at each time point were calculated using the 2 –ΔΔCt method. As Figure 7 shown, the expression level of HmnCAD3 reached the highest 48 h after spraying SA; the expression level of HmnCAD3 reached the highest 24 h after spraying polyethylene glycol (PEG6000) solution; the expression level of HmnCAD3 reached the highest 48 h after low-temperature stress treatment.

[0110] Thus, it can be seen that HmnCAD3 can respond to SA, drought, and low-temperature stress, especially more significantly to low-temperature stress treatment. The above results indicate that HmnCAD3 may be involved in the defense processes of plants against hormones, drought, and low-temperature stress.

Claims

1. A cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnocarpus rotundifolia, the nucleotide sequence of which is shown in SEQ ID NO.

1.

2. The protein encoded by the cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnocarpus rotundifolia according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. A recombinant expression vector comprising the cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnocarpus rotundifolia according to claim 1. 4 . A host cell comprising the cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnocarpus rotundifolia according to claim 1 .

5. The soluble expression method of the cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnocarpus rotundifolia according to claim 1, characterized in that: The cinnamyl alcohol dehydrogenase gene HmnCAD3 from Gymnocarpus rotundifolia was constructed into the prokaryotic expression vector pET32a (+), and then co-transformed with the pTf16 molecular chaperone into the BL21(DE3) competent cell for heterologous expression, and expressed into protein under the induction of isopropyl-β-D-thiogalactoside and arabinose.

6. Use of the protein encoded by the cinnamyl alcohol dehydrogenase gene HmnCAD3 of Gymnocarpus rotundifolia according to claim 1 in catalyzing a reaction of aldehyde substrates to generate corresponding alcohol compounds, wherein the aldehyde substrate is any one of p-hydroxycinnamaldehyde, caffealdehyde, coniferyl aldehyde, 5-OH coniferyl aldehyde or sinapyl aldehyde.