A method and its application for targeted knock-in of human coagulation factor VII and VIII encoding genes at porcine coagulation factor VII and VIII gene sites.

Abstract

The present invention relates to a method and application for targeted knock-in of human coagulation factor VII and VIII coding genes at pig coagulation factor VII and VIII gene loci, and belongs to the field of gene editing technology. The present invention provides a group of sgRNAs for targeted knock-in of human coagulation factor coding genes at pig coagulation factor gene loci. Targeting the specific sites of the first intron of pig coagulation factor VII coding gene F7 and pig coagulation factor VIII coding gene F8, sgRNA and targeting vectors are designed respectively, and human coagulation factor FVII and FVIII protein coding genes are site-specifically knocked in, and human coagulation factor FVII protein expression is initiated by the endogenous promoter of pig F7 gene, and human coagulation factor FVIII protein expression is initiated by the endogenous promoter of pig F8 gene. The expression level is equivalent to the physiological level, and will not have a significant impact on the health status of the prepared gene-edited pigs, and is used for large-scale production of human coagulation factor FVII and FVIII protein products.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and in particular to a method and application of targeted knock-in of human coagulation factor VII and VIII coding genes at porcine coagulation factor VII and VIII gene loci. Background Art

[0002] Coagulation factors are a general term for a large class of substances in plasma and tissues that directly participate in coagulation. Most of them are proteins synthesized by the liver and secreted into the plasma, which are essential for coagulation after bleeding. During the coagulation process, different coagulation factors are activated in a certain order, and the coagulation function is finally achieved through the coagulation cascade reaction of the intrinsic and exogenous coagulation pathways (the "coagulation waterfall" theory).

[0003] Coagulation factor deficiency leads to coagulation dysfunction, resulting in hemophilia and other bleeding diseases. Clinically, replacement therapy for missing coagulation factors through exogenous infusion is currently an effective means of treating hemophilia. Among them, coagulation factor VIII (FVIII) is a key factor in the intrinsic coagulation pathway. Hemophilia A caused by its deficiency accounts for 80% to 85% of human hemophilia patients, so there is a large demand for therapeutic FVIII. In addition, for some patients who receive exogenous infusion of coagulation factors for treatment, the corresponding coagulation factor antibodies are produced in the body, which reduces the treatment effect and increases the risk of treatment. For such patients, coagulation factor VII (FVII), a key factor involved in the exogenous coagulation pathway, is the preferred alternative drug. FVII is also widely used in the treatment of traumatic bleeding, so there is also a large demand for FVII in clinical practice.

[0004] At present, human coagulation factor products used for treatment are mainly derived from human plasma, and the source of raw materials is relatively limited; pig plasma coagulation factor products were also used directly in the early days, but pig coagulation factors are not exactly the same as human coagulation factors; with the help of genetic engineering technology, foreign countries have recombinant human FVII and FVIII proteins expressed by Chinese hamster ovary cells (CHO cells) cultured in vitro, as well as recombinant pig FVIII protein products, but due to the low protein expression level and incomplete post-translational modification of the protein, which affects secretion, protein activity and half-life, coupled with high technical barriers, complex production processes, small output and high costs, there is currently a lack of domestically produced products. Therefore, it is necessary to develop new and efficient methods for preparing human FVII and FVIII. In recent decades, the technology of using genetically modified animals or plants as bioreactors to produce human functional proteins is expected to provide a new source for the production of human coagulation factors. For example, through transgenic technology, human FVII or FVIII proteins are expressed in the mammary glands of mammals such as sheep or rabbits using mammary gland-specific expression vectors. Mammary bioreactors have limitations. On the one hand, there is a great deal of randomness in the integration of target genes into the animal genome, resulting in unstable results and large individual differences in the expression level of target proteins. On the other hand, there are great differences in protein processing and modification systems between species and tissues, which affect the coagulation factor properties of target proteins such as activity, immunogenicity and pharmacokinetics. At the same time, the target protein produced by mammary bioreactors only accounts for a very small proportion of the total protein secreted by the mammary gland, which increases the difficulty of purifying the target protein. By knocking the functional protein into the endogenous site of the animal genome and expressing it in situ, a more complete target protein with post-translational modification can be obtained. Although sheep and cattle can also be used to develop blood bioreactors, the risk of zoonoses is higher (such as brucellosis, prion infection, tuberculosis, etc.). In comparison, pigs are more similar to humans in terms of physiology, metabolism and protein post-translational modification systems, which is convenient for large-scale breeding and breeding, and has a low risk of zoonoses. At present, it has been reported that pigs are used as blood bioreactors to produce human albumin by knocking the human serum albumin coding sequence into the porcine albumin gene site. The use of pigs as blood bioreactors to produce human coagulation factors has yet to be developed.

[0005] In addition, as an ideal xenotransplantation donor, pigs are expected to solve the problem of donor organ shortage in human organ transplantation. Solving the incompatibility between human and pig organs has long been a key issue in this field, among which the incompatibility of the coagulation system is an important aspect. In the past, research mainly focused on the problem of immune rejection, and the coagulation aspect mainly expressed thrombomodulin. With the deepening of research, the humanization of functional proteins between pigs and humans has received more and more attention, and the humanization of coagulation factors is an important part of it. The construction of a humanized pig model that only expresses human coagulation factors but not pig coagulation factors is of great value for improving the effect of xenotransplantation, especially liver xenotransplantation (most coagulation factors are synthesized by the liver). For example, it has been reported that the human FVII and human albumin expression sequences were knocked into the pig FVII gene (F7) site for humanized modification (Li L, Meng H, Zou Q, et al. Establishment of gene-edited pigs expressing human blood-coagulation factor VII and albumin for bioartificial liver use [J]. J Gastroenterol Hepatol, 2019, 34 (10): 1851-1859.). However, due to the additional knock-in of the human albumin expression sequence, the humanized modification of human FVII was not completely simulated, and the pig FVII protein may be expressed. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method and application for effectively cutting the target site by targeted knock-in of human coagulation factor VII and VIII coding genes at the porcine coagulation factor VII and VIII gene sites.

[0007] To achieve the above object, the technical solution adopted by the present invention is:

[0008] First, a group of sgRNAs that target and knock in human coagulation factor coding genes at the porcine coagulation factor gene locus.

[0009] The set of sgRNAs includes a first sgRNA that targets and knocks in a human coagulation factor VII encoding gene at a porcine coagulation factor VII gene site, and a second sgRNA that targets and knocks in a human coagulation factor VIII encoding gene at a porcine coagulation factor VIII gene site;

[0010] The nucleotide sequence of the first sgRNA is shown in SEQ ID NO: 2, and the nucleotide sequence of the second sgRNA is shown in SEQ ID NO: 5.

[0011] The accession number of the porcine coagulation factor VII gene on NCBI is NC_010453, and the accession number of the porcine coagulation factor VIII gene on NCBI is NC_010461. The sgRNA of the present invention effectively performs site-specific cleavage on the porcine coagulation factor VII gene site and the porcine coagulation factor VIII gene site.

[0012] In a second aspect, the present invention also provides an expression vector for expressing the sgRNA.

[0013] Furthermore, the nucleotide sequence of the expression vector expressing the first sgRNA is shown as SEQ ID NO: 18, and the nucleotide sequence of the expression vector expressing the second sgRNA is shown as SEQ ID NO: 19.

[0014] In the third aspect, a targeting vector is provided for targeted knock-in of a human coagulation factor encoding gene at a porcine coagulation factor gene locus using CRISPR / Cas9 gene editing technology, and the nucleotide sequence of the targeting vector for targeted knock-in of a human coagulation factor FVII encoding gene at a porcine coagulation factor VII gene locus is shown in SEQ ID NO: 16; the nucleotide sequence of the targeting vector for targeted knock-in of a human coagulation factor VIII encoding gene at a porcine coagulation factor VIII gene locus is shown in SEQ ID NO: 17.

[0015] In a fourth aspect, the present invention provides the use of the sgRNA, the expression vector and the targeting vector in preparing pig fetal fibroblasts for targeted knock-in of human coagulation factor encoding genes.

[0016] In a fifth aspect, the present invention provides a method for preparing pig fetal fibroblasts with targeted knock-in of a gene encoding a human coagulation factor, wherein the sgRNA expression vector and the targeting vector are co-transfected into pig fetal fibroblasts and cultured.

[0017] Furthermore, the sgRNA targeting recognition site is within the first intron of the porcine coagulation factor encoding gene, the positive chain nucleotide sequence of the sgRNA targeting recognition site of the porcine coagulation factor VII gene site is shown in SEQ ID NO: 8, and the antisense chain nucleotide sequence is shown in SEQ ID NO: 9; the positive chain nucleotide sequence of the sgRNA targeting recognition site of the porcine coagulation factor VIII gene site is shown in SEQ ID NO: 14, and the antisense chain nucleotide sequence is shown in SEQ ID NO: 15.

[0018] In a specific embodiment of the present invention, the preparation method comprises the following steps:

[0019] S1: Take 5 to 15 μg, preferably 10 μg, of the sgRNA expression vector and the targeting vector, and mix them to obtain a mixed plasmid;

[0020] S2: transfecting the mixed plasmids in step S1 into porcine fetal fibroblasts, and electroporating to obtain electroporated cells;

[0021] S3: The cells electroporated in step S2 are cultured into monoclonal cells to obtain porcine fetal fibroblasts with targeted knock-in of the gene encoding the human coagulation factor.

[0022] Further, in step S1, 10 μg of the sgRNA expression vector with a nucleotide sequence as shown in SEQ ID NO: 18 and the targeting vector with a nucleotide sequence as shown in SEQ ID NO: 16 were mixed to obtain a mixed plasmid 1; 10 μg of the sgRNA expression vector with a nucleotide sequence as shown in SEQ ID NO: 19 and the targeting vector with a nucleotide sequence as shown in SEQ ID NO: 17 were mixed to obtain a mixed plasmid 2.

[0023] The porcine fetal fibroblasts with targeted knock-in of the human coagulation factor encoding gene obtained by culturing the mixed plasmid 1 are porcine fetal fibroblasts with targeted knock-in of the human coagulation factor VII encoding gene at the porcine coagulation factor VII gene site;

[0024] The porcine fetal fibroblasts with targeted knock-in of the gene encoding human coagulation factor obtained by culturing the mixed plasmid 2 are porcine fetal fibroblasts with targeted knock-in of the gene encoding human coagulation factor VIII at the porcine coagulation factor VIII gene site.

[0025] Furthermore, the parameters of the electroporation in step S2 are: 1350 V, 30 ms and 1 pulse.

[0026] Furthermore, the density of cells in the culture dish in step S3 is 50 to 5000 cells / dish. Preferably, the cell density after electroporation of mixed plasmid 1 in step S2 is 3000 to 5000 cells / dish, and the cell density after electroporation of mixed plasmid 2 in step S2 is 50 to 100 cells / dish.

[0027] Furthermore, in step S3, the cells are cultured with a high-glucose DMEM medium containing fetal bovine serum.

[0028] Furthermore, the concentration of fetal bovine serum in step S3 is 15% (v / v).

[0029] Furthermore, the culture condition in step S3 is culture in an incubator at 38.5° C. and 5% CO 2 .

[0030] Furthermore, the concentration of puromycin in the culture medium in step S3 is 0.3-1 μg / mL, preferably 1 μg / mL.

[0031] Furthermore, the culturing time in step S3 is 8 to 12 days.

[0032] Furthermore, in step S3, puromycin is added to the culture medium for screening of the electrotransformed cells prepared by the mixed plasmid 1.

[0033] In a sixth aspect, the present invention provides a porcine fetal fibroblast cell with a targeted knock-in of a gene encoding a human coagulation factor, which is prepared by the preparation method.

[0034] In a seventh aspect, the present invention provides the use of the porcine fetal fibroblasts in preparing gene-edited pigs with targeted knock-in of human coagulation factor encoding genes.

[0035] In an eighth aspect, the present invention provides a method for preparing a gene-edited pig with targeted knock-in of a gene encoding a human coagulation factor, wherein the nucleus of the pig fetal fibroblast is transplanted into an enucleated oocyte, fused to form a recombinant embryo, and the recombinant embryo is transplanted into a sow, and after pregnancy and birth, the gene-edited pig is obtained.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] The present invention targets the specific sites of the first intron of the porcine coagulation factor VII encoding gene F7 and the porcine coagulation factor VIII encoding gene F8, respectively, designs sgRNA and targeting vectors, knocks in human coagulation factor FVII and FVIII protein encoding genes at a fixed point, starts the expression of human coagulation factor FVII protein with the endogenous promoter of the porcine F7 gene, and starts the expression of human coagulation factor FVIII protein with the endogenous promoter of the porcine F8 gene, and the expression level is equivalent to the physiological level, and will not have a significant impact on the health status of the prepared gene-edited pigs. The genes are used for large-scale production of human coagulation factor FVII and FVIII protein products, and at the same time, the porcine endogenous coagulation factor encoding genes are blocked due to the knocked-in human coagulation factor encoding genes and cannot be expressed. Moreover, humanization of single human FVII and FVIII proteins as well as humanization of two proteins can be achieved. The model can also be mated with pigs humanized with other functional proteins (such as serum albumin) to obtain a pig model with more functional proteins humanized at the same time. This is a more flexible and ideal humanization modification scheme for various functional proteins such as coagulation factors, and can be used to improve xenotransplantation-related gene modification. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The target site sequences and sgRNAs of pig F7 and F8 genes are shown in Figure 1. A is the target site sequence and sgRNA of F7 gene, and B is the target site sequence and sgRNA of F8 gene.

[0039] Figure 2is the target site cleavage effect mediated by sgRNA. Among them, A is pF7-sgRNA-1; B is pF7-sgRNA-2; C is pF8-sgRNA-0; D is pF8-sgRNA-1; E is pF8-sgRNA-2; F is the base difference between the pF8-sgRNA-0 target site sequence (pig F8) and the corresponding human FⅧ protein coding sequence (human F8).

[0040] Figure 3 Schematic diagram of the precise targeting principle of the pig F7 gene locus.

[0041] Figure 4 Schematic diagram of the precise targeting principle of the pig F8 gene locus.

[0042] Figure 5 The results of cloned pig genotype identification are shown in Figure 1. A is the genotype identification of the F7 locus; B is the genotype identification of the F8 locus.

[0043] Figure 6 Sanger sequencing confirmed the knock-in of the human FVII protein coding gene at the pig F7 site. A is the Sanger sequencing peak diagram of the knock-in of the human FVII protein coding gene at the cloned pig target site; B is the comparison result of the protein sequence corresponding to the knock-in sequence of the sequencing result and the human FVII protein sequence.

[0044] Figure 7 Sanger sequencing confirmed the knock-in of the human FVIII protein coding gene at the pig F8 site. A is the Sanger sequencing peak graph of the knock-in of the human FVIII protein coding gene at the cloned pig target site; B is the comparison result of the protein sequence corresponding to the knock-in sequence of the sequencing result and the human FVIII protein sequence. DETAILED DESCRIPTION

[0045] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific examples. Other materials, reagents, etc. used in the examples, unless otherwise specified, can be obtained from commercial sources.

[0046] Example 1 Design of pig F7 and F8 gene target site-specific sgRNA

[0047] The sequence information of porcine coagulation factor FVII protein encoding gene F7 (NCBI accession number: NC_010453) and coagulation factor FVIII protein encoding gene F8 (NCBI accession number: NC_010461) were obtained from the porcine reference genome (Sscrofa11.1) in NCBI, and the vicinity of the start codon ATG was used as the target site to design specific sgRNAs and test whether the designed sgRNAs were effective. Sequencing was performed to verify whether the target site sequence was consistent with the reference sequence, and the sequencing results were used as the standard.

[0048] 1. Design sgRNA

[0049] like Figure 1 As shown in A, two sgRNA sequences of the porcine FVII protein encoding gene F7 were designed, namely pF7-sgRNA-1 and pF7-sgRNA-2. Figure 1 As shown in B, three sgRNA sequences of porcine FVIII protein encoding gene F8 were designed, namely pF8-sgRNA-0, pF8-sgRNA-1 and pF8-sgRNA-2.

[0050] The sgRNA sequences and their corresponding target sequences are shown in Tables 1 and 2.

[0051] Table 1

[0052]

[0053] Table 2

[0054]

[0055]

[0056] 2. Construction of sgRNA expression vector

[0057] (1) Use the PX330 plasmid (brand: Addgene, catalog number: #42230, containing the nucleic acid sequence of the SpCas9 effector protein and the U6 promoter) as a blank vector, cut it with the restriction endonuclease BpiI, and use it as the digestion vector backbone. Prepare a 50 μL digestion reaction system: 10×Fast Digest buffer (brand: Thermo Scientific, catalog number: B64) 5 μL, BpiI (brand: Thermo Scientific, catalog number: FD1014) 2 μL, PX330 plasmid 5 μg, add double distilled water (ddH2O) to make up to 50 μL; incubate the digestion at 37°C for 2 h, purify and recover the digested fragments, and obtain the PX330 digestion vector backbone.

[0058] (2) Synthesize two complementary primers specific to the target site, add 4 additional bases to the 5' end of the sequence shown in Table 2 to complement the sticky end of the PX330 digested vector backbone; the additional base at the 5' end of the sense strand in Table 2 is 5'-CACC-3', which is used as the forward primer; the additional base at the 5' end of the antisense strand in Table 2 is 5'-AAAC-3', which is used as the reverse primer. Take 5 μL of each forward primer and reverse primer with a concentration of 4 μM, mix, and anneal. The annealing procedure is: heat at 98°C for 10 minutes, cool naturally to room temperature (25°C), and obtain annealing products (double-stranded DNA fragments containing sticky ends).

[0059] (3) Clone the annealing product of step (2) into the PX330-cut vector backbone of step (1).

[0060] Mix 0.5 μL of the PX330-cut vector backbone from step (1), 2 μL of the annealing product from step (2), and 2.5 μL of Solution I (Takara), and incubate at 16° C. for 2 h to obtain a ligation product.

[0061] (4) Each ligation product (5 μL) of step (3) was transformed into 100 μL of E. coli DH5α competent cells, incubated on ice for 30 min, and heat-shocked at 42°C for 45 s to obtain transformed E. coli DH5α cells. The transformed E. coli DH5α cells were spread on LB agar plates supplemented with ampicillin (100 μg / mL), cultured at 37°C for 12 h, and a single colony was picked and cultured in liquid LB medium supplemented with ampicillin (100 μg / mL) at 37°C for 8 h to obtain screened and cultured E. coli DH5α cells. The cultured Escherichia coli DH5α cells were lysed, screened, and extracted and purified to obtain 5 PX330-sgRNA expression vectors (the pF7-sgRNA-1, pF7-sgRNA-2, pF8-sgRNA-0, pF8-sgRNA-1, and pF8-sgRNA-2 sequences in Table 1 were respectively inserted into the PX330 plasmid, i.e., the sequence GGGTCTTCGAGAAGACCT in the original PX330 vector was replaced with the positive chain sequence corresponding to Table 2, to obtain PX330-sgRNA expression vectors expressing the pF7-sgRNA-1, pF7-sgRNA-2, pF8-sgRNA-0, pF8-sgRNA-1, and pF8-sgRNA-2 sequences in Table 1, respectively).

[0062] (5) The sequences of the five PX330-sgRNA expression vectors prepared in step (4) were verified to be correct by sequencing.

[0063] 3. Testing sgRNA

[0064] Test the cutting effect of the sgRNA designed in step 1 by transfection.

[0065] (1) Porcine fetal fibroblasts (PFF) were cultured in PFF medium (high-glucose modified Eagle's medium (DMEM) supplemented with 15% v / v fetal bovine serum) in a 38.5°C, 5% CO2 incubator until the confluence reached 80%, and the PFF cells were then digested and collected.

[0066] (2) Invitrogen TM Neon TMThe transfection system was used to transfect the PFF cells treated in step (1) with the five PX330-sgRNA expression vectors constructed in step 2 to obtain transfected PFF cells. Each group of cells was 2.5×10 5 The mass of each PX330-sgRNA expression vector was 5 μg, and the electroporation parameters were: 1350 V, 30 ms and 1 pulse. The transfected cells were plated in a 24-well plate, fresh PFF medium was added, and cultured in a 38.5°C, 5% CO2 incubator for 48 h.

[0067] (3) Collect the PFF cells cultured in step (2), extract the genome, and perform PCR amplification using the extracted genome as a template to obtain a fragment (PCR product) within the range of the sgRNA target site.

[0068] PCR reaction was performed using 2×Rapid Taq Master Mix (Cat. No.: P222-02, brand: Vazyme), and the PCR reaction system was: 2×Rapid Taq Master Mix 10 μL, 0.2 μL of upstream primer at a concentration of 10 μM, 0.2 μL of downstream primer at a concentration of 10 μM, 1.5 μL of extracted genomic template, 8.1 μL of ultrapure water, and a total volume of 20 μL. The PCR reaction conditions were: 95°C for 3 min; [95°C for 15 s, 55°C for 15 s, 72°C for 10 s] for 36 cycles; 72°C for 5 min; and 12°C insulation.

[0069] The forward primer of the F7 site is: CCGACCGGGAAAGTCAACAGAC, and the reverse primer of the F7 site is: CACTTGGTACCGGAGTCAGGA; the forward primer of the F8 site is: TCGTGCTAATGCTGCTGTCA, and the reverse primer of the F8 site is: AGACCCTCTAGACACGCCTT.

[0070] (4) The fragment (PCR product) within the sgRNA target site range obtained in step (3) is subjected to Sanger sequencing (first generation gene sequencing), and whether the target site is cut is determined based on the sequencing peak graph, thereby determining the sgRNA that effectively cuts the double-stranded DNA at the target site.

[0071] like Figure 2 A and Figure 2 As shown in B, pF7-sgRNA-1 has no double peaks produced by cleavage and has no cleavage activity, while pF7-sgRNA-2 has obvious cleavage double peaks and effectively mediates target site cleavage. Figure 2 C, 2D and Figure 2As shown in E, pF8-sgRNA-1 has no obvious double peaks produced by cleavage, while pF8-sgRNA-0 and pF8-sgRNA-2 have obvious cleavage double peaks, effectively mediating target site cleavage, where the pF8-sgRNA-0 target site is located in the first exon, and the pF8-sgRNA-2 target site is located in the first intron.

[0072] Example 2 Design of targeting vectors for porcine F7 and F8 loci

[0073] When the human coagulation factor coding sequence expression element is site-specifically knocked into the pig endogenous site, a targeting vector is required to provide a repair template for homologous recombination after CRISPR / Cas9 (a gene editing technology) cuts the double-stranded DNA.

[0074] 1. If Figure 3 As shown, the nucleotide sequence of the targeting vector for the F7 site of the porcine FVII protein encoding gene is shown in SEQ ID NO: 16, which consists of the left homology arm of the F7 site, the human full-length FVII protein encoding gene (including the start codon and the end stop codon, CCDS database accession number: CCDS9528.1), the transcription termination tailing signal (PolyA, Figure 3 The loxP-PGK-Puro-PA-loxP protein is composed of a puromycin (PA) independently expressed, a puromycin (Puro) selection tag (loxP-PGK-Puro-PA-loxP), the right end of the F7 site and a diphtheria toxin A chain (DTA) selection tag (PGK-DTA-pA, used for negative selection and killing of transgenic cells to prevent transgenic rather than homologous recombination).

[0075] 2. If Figure 4 As shown, the nucleotide sequence of the targeting vector for the F8 site of the porcine FⅧ protein encoding gene is shown in SEQ ID NO: 17, which consists of the left homology arm of the F8 site, the human full-length FⅧ protein encoding gene (including the start codon and the end stop codon, CCDS database accession number: CCDS35457.1), the transcription termination tailing signal (PolyA, Figure 4 PA in the middle), the right end arm of the F8 site and the expression DTA screening tag.

[0076] Since the FⅧ protein coding sequence itself is relatively long (>7kb), the targeting vector is relatively large, so the Puro screening tag was removed. On the one hand, a large vector affects the plasmid copy number, yield, and transfection efficiency; on the other hand, the exogenous Puro tag also needs to be removed in subsequent pig model applications.

[0077] Example 3 Gene modification of pig somatic cells, site-specific knock-in of human FVII or FVIII expression elements

[0078] 1. Experimental Methods

[0079] 1. Site-directed knock-in of human FVII expression element:

[0080] (1) Take 10 μg each of the PX330-sgRNA expression vector expressing pF7-sgRNA-2 prepared in Example 1 (the nucleotide sequence is shown in SEQ ID NO: 18) and the porcine F7 locus targeting vector prepared in Example 2, mix them, and obtain an F7 mixed plasmid.

[0081] (2) The F7 mixed plasmid from step (1) was transfected into PFF cells (5×10 5 ), the electroporation method was the same as in Example 1 to obtain electroporated cells.

[0082] (3) The cells after electroporation in step (2) were plated at a low density (3000-5000 cells / dish) in a 10 cm culture dish, and cultured in a high-glucose DMEM medium supplemented with 15% (v / v) fetal bovine serum in a 38.5°C, 5% CO2 incubator, and 1 μg / mL of puromycin was added to the culture medium for selection. After 8-12 days of culture, the single cell grew into a clone-like state, and a cloned cell derived from a single cell was obtained.

[0083] (4) Pick up the cloned cells derived from the single cell in step (3) and continue to culture them in a 24-well plate until the cells fill the culture wells. The culture conditions are the same as in step (3).

[0084] (5) For the cells cultured in step (4), three quarters of the cells were plated on a 24-well plate and continued to be cultured until the wells were full. The culture conditions were the same as those in step (3). The remaining quarter of the cells were lysed, and their genome was extracted as a template. PCR amplification was used to identify whether the target sequence (human full-length FVII protein encoding gene + PolyA + Puro screening tag fragment) was accurately integrated into the pig genome target site, and human FVII knock-in cells were obtained and frozen for future use.

[0085] The PCR reaction was carried out using the method of step 3 of Example 1, wherein the PCR reaction conditions were: 95°C for 3 min; [95°C for 15 s, 55°C for 15 s, 72°C for 2 min] for 36 cycles; 72°C for 5 min; and 12°C for insulation. The PCR primer sequences are shown in Table 3. The cells are diploid and have a pair of homologous chromosomes. Monoallelic knock-in indicates heterozygote, and biallelic knock-in indicates homozygote. In Tables 3 and 4, F7-pure / heterozygous refers to the identification of whether one chromosome of the two homologous chromosomes is knocked in (heterozygous / monoallelic knock-in) or both chromosomes are knocked in (homozygous / biallelic knock-in)

[0086] Table 3

[0087]

[0088]

[0089] 2. Site-directed knock-in of human FⅧ expression element:

[0090] (1) Take 10 μg each of the PX330-sgRNA expression vector expressing pF8-sgRNA-0 prepared in Example 1 and the targeting vector for the porcine F8 locus prepared in Example 2, mix them, and obtain F8 mixed plasmid 0. Replace pF8-sgRNA-0 with pF8-sgRNA-2 (nucleotide sequence as shown in SEQ ID NO: 19), and keep other conditions unchanged to obtain F8 mixed plasmid 1.

[0091] (2) According to the method of steps (2) to (5) in the method of site-directed knock-in of human FVII expression element in this embodiment, human FVII knock-in cells were prepared. Since the targeting vector of the porcine F8 locus does not contain the Puro screening tag, puromycin was not added to the culture medium for screening, and the electroporated cells were plated in a 10 cm culture dish at a density of 50 to 100 cells / dish. The PCR primer sequences are shown in Table 4.

[0092] Table 4

[0093]

[0094] 2. Experimental Results

[0095] Table 5 shows the statistics of cell clones edited at the F7 and F8 gene loci. Since the F8 locus is located on the X chromosome, the male cells used for screening cells have only a single X chromosome, so only monoallelic knock-in cells can be obtained in the end, and no biallelic knock-in cells can be obtained.

[0096] Table 5

[0097]

[0098] When human FⅧ knock-in cells were prepared using the PX330-sgRNA expression vector containing pF8-sgRNA-0, the expected human FⅧ knock-in cells were not successfully obtained. Further analysis revealed that the sequence of the designed pF8-sgRNA-0 target site differed only by 2 bases from the corresponding human FⅧ protein coding sequence ( Figure 2 F), therefore pF8-sgRNA-0 can not only cut the pig F8 gene target site, but also cut the targeting vector, resulting in the failure to obtain the target modified cell clones. Therefore, the PX330-sgRNA expression vector containing pF8-sgRNA-2 was used to prepare human FⅧ knock-in cells and frozen for later use.

[0099] Example 4 Obtaining a pig model of humanized FVII or FVIII protein by somatic cell nuclear transfer

[0100] 1. Experimental Methods

[0101] The human FVII knock-in cells (numbered #1, #2 and #3) and human FVIII knock-in cells (numbered #77, #106 and #165) obtained in Example 3 were used as donor cells for somatic cell nuclear transplantation.

[0102] Under the micromanipulator, the donor cells were injected into the perivitelline space of the enucleated porcine mature oocytes, and fused and activated by electrical activation using an ECM2001 (BTX) cell fusion electroporator (parameters: 120V / mm, 30μsec, 2pulses) to obtain recombinant embryos.

[0103] The recombinant embryos were transplanted into the oviducts of sow recipients (about 200 recombinant embryos were transplanted into each sow recipient). A total of 767 recombinant embryos were transplanted, of which 3 sow recipients successfully became pregnant and gave birth to 11 cloned piglets (Table 6).

[0104] A small piece of cloned piglet ear tissue was taken and genomic DNA was extracted as a template for PCR amplification (the PCR amplification steps were the same as those in Example 3) to identify the genotypes of the F7 and F8 target sites. The obtained PCR amplification products were further sequenced by Sanger to confirm that the target site had knocked in the human FVII or FVIII protein encoding gene.

[0105] 2. Experimental Results

[0106] like Figure 5 A and Figure 5 As shown in B, a total of 3 cloned piglets numbered 451-5, 306-3 and 306-7 are positive model pigs with human FVII knock-in; a total of 7 cloned piglets numbered 451-1, 451-3, 451-7, 451-9, 306-1, 306-5 and 306-9 are positive model pigs with human FVIII knock-in, and the 010-1 cloned pig is a wild-type pig. Figure 6 A. Figure 6 B. Figure 7 A and Figure 7 As shown in B, the Sanger sequencing results confirmed that the target site accurately knocked into the human FVII or FVIII protein coding sequence.

[0107] Table 6 Statistics of cloned pigs obtained by somatic cell nuclear transplantation

[0108]

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A group of sgRNAs for knocking in human coagulation factor coding genes at the porcine coagulation factor gene locus, characterized in that: The set of sgRNAs includes a first sgRNA that targets and knocks in a human coagulation factor VII encoding gene at a porcine coagulation factor VII gene site, and a second sgRNA that targets and knocks in a human coagulation factor VIII encoding gene at a porcine coagulation factor VIII gene site; The nucleotide sequence of the first sgRNA is shown in SEQ ID NO: 2, and the nucleotide sequence of the second sgRNA is shown in SEQ ID NO:

5.

2. An expression vector for expressing the sgRNA according to claim 1, characterized in that: The expression vector is an expression vector that expresses the first sgRNA or an expression vector that expresses the second sgRNA.

3. The expression vector according to claim 2, characterized in that The nucleotide sequence of the expression vector expressing the first sgRNA is shown in SEQ ID NO: 18, and the nucleotide sequence of the expression vector expressing the second sgRNA is shown in SEQ ID NO:

19.

4. A targeting vector for knocking in a human coagulation factor coding gene at the porcine coagulation factor gene locus using CRISPR / Cas9 gene editing technology, characterized in that: The nucleotide sequence of the targeting vector for targeted knock-in of the human coagulation factor FVII encoding gene at the porcine coagulation factor VII gene site is shown in SEQ ID NO: 16; the nucleotide sequence of the targeting vector for targeted knock-in of the human coagulation factor VIII encoding gene at the porcine coagulation factor VIII gene site is shown in SEQ ID NO:

17.

5. Use of the sgRNA according to claim 1, the expression vector according to claim 2 or 3, and the targeting vector according to claim 4 in preparing porcine fetal fibroblasts for targeted knock-in of a gene encoding a human coagulation factor.

6. A method for preparing porcine fetal fibroblasts with targeted knock-in of human coagulation factor encoding genes, characterized in that: The expression vector according to claim 2 or 3 and the targeting vector according to claim 4 are co-transfected into porcine fetal fibroblasts and cultured.

7. The preparation method according to claim 6, characterized in that: The sgRNA targeting recognition site is in the first intron of the porcine coagulation factor encoding gene. The positive chain nucleotide sequence of the sgRNA targeting recognition site of the porcine coagulation factor VII gene site is shown in SEQ ID NO: 8, and the antisense chain nucleotide sequence is shown in SEQ ID NO: 9; the positive chain nucleotide sequence of the sgRNA targeting recognition site of the porcine coagulation factor VIII gene site is shown in SEQ ID NO: 14, and the antisense chain nucleotide sequence is shown in SEQ ID NO:

15.

8. A porcine fetal fibroblast cell with targeted knock-in of a gene encoding a human coagulation factor, characterized in that: The product is prepared by the preparation method according to claim 6 or 7.

9. Use of the porcine fetal fibroblasts according to claim 8 in the preparation of gene-edited pigs with targeted knock-in of human coagulation factor encoding genes.

10. A method for preparing a gene-edited pig with targeted knock-in of a gene encoding a human coagulation factor, characterized in that: The nucleus of the porcine fetal fibroblast described in claim 8 is transplanted into an enucleated oocyte, fused to form a recombinant embryo, and the recombinant embryo is transplanted into a sow. After pregnancy and birth, the gene-edited pig is obtained.

Images