A strain of Bifidobacterium longum subspecies longum and its application in preventing, alleviating, regulating or treating diseases related to lipid metabolism

Abstract

The present invention discloses a strain of Bifidobacterium longum subspecies dipro-O. The Bifidobacterium longum subspecies ( Bifidobacterium longum subsp.longum ) dipro‑O has the ability to produce high BSH, lower cholesterol, metabolize tryptophan to produce indole‑3‑lactic acid, can effectively reduce body weight, significantly reduce the level of insulin resistance caused by a high-fat diet, reduce the expression of inflammatory cytokine TNF‑α, significantly reduce the level of total cholesterol (TC) and low-density lipoprotein (LDL) in the blood, and increase the level of high-density lipoprotein (HDL); improve the disorder of intestinal flora structure; at the same time, it can also play a role in improving other diseases related to lipid metabolism such as hyperlipidemia, thereby intervening in the host's weight, liver, intestinal health and blood lipid levels. In addition, pasteurized dipro‑O can also play a role in regulating lipid metabolism, further broadening the application range of this strain.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a strain of Bifidobacterium longum subspecies longum and an application thereof in preventing, alleviating, regulating or treating diseases related to lipid metabolism. Background Art

[0002] With the development of economy and the improvement of people's living standards, the dietary structure has also changed. The monitoring data of Chinese residents' nutrition and health status from 2015 to 2017 showed that the average daily energy intake of Chinese residents was 2007.4kcal, and the proportion of fat increased year by year. Since 2012, it has exceeded the upper limit of 20%-30% recommended by the dietary guidelines; excessive lipid intake leads to a disproportionate energy intake and consumption of individuals, and fat continues to accumulate in the body, leading to lipid metabolism disorders, which eventually manifest as obesity. In addition to obesity, excessive lipid intake can also lead to abnormal blood sugar / blood lipids. Long-term obesity will increase the risk of cardiovascular diseases (such as atherosclerosis), non-alcoholic fatty liver, hyperuricemia and other diseases; follow-up studies have shown that in people aged 40-59 (BMI ≥ 22.5), for every increase of 5 in BMI index, the risk of CVD death in the future will increase by 37%. Therefore, excessive lipid intake and secondary diseases will not only increase the cost of health care services for residents, but also increase the burden on the medical and health system. More importantly, this series of problems, when amplified, will have a negative impact on social and psychological issues, which is not conducive to social stability and development.

[0003] In response to these problems, the therapeutic drugs currently on the market have relatively single indications and large side effects: for example, the drug Oselita is only used for obesity, and its mechanism of action is to inhibit the activity of lipase in the gastrointestinal tract, reduce lipid absorption and thus control body weight, but it often leads to adverse reactions in the digestive tract, such as diarrhea, fecal incontinence, abdominal pain, etc.; Semaglutide, which has been very popular in recent years, has certain advantages in blood sugar control and weight loss, but the effect is drug-dependent. It has a good effect on blood sugar and weight control when administered, but it is very easy to rebound after stopping the drug, and the drug also has side effects, common gastrointestinal adverse reactions such as nausea, vomiting, and rare heart rate acceleration, cholelithiasis, etc. So for now, although there are drugs that can target different indications in clinical practice, each of them has not been widely promoted due to its limitations and side effects, and there is a large market demand that has not been met. Although major pharmaceutical companies still have new drugs undergoing clinical trials, because their targeted mechanism of action has not yet escaped the scope of drugs, it is difficult to expect these drugs that have not yet been approved for clinical use to get rid of the side effects and continuous use limitations of current drugs.

[0004] From ancient times to the present, the relationship between microorganisms and health has always been a topic of concern to humans. The intestine is the organ with the highest concentration of microorganisms in the human body, with more than a thousand species totaling about 10 14In recent years, studies have gradually revealed that changes in the content of specific intestinal flora are related to the occurrence of metabolic diseases such as obesity, type II diabetes, hyperlipidemia and non-alcoholic fatty liver disease. Probiotics are a class of living microorganisms that are beneficial to the human body when their number is sufficient. Rebuilding intestinal microbial homeostasis by supplementing probiotics is the most direct and effective way. Clinical trials have shown that probiotics can participate in human metabolism and immune response. For example, supplementing probiotics (mixed lactobacillus and bifidobacterium) can significantly reduce fasting blood sugar and insulin resistance index in patients with type II diabetes; supplementing probiotics (Lactobacillus rhamnosus GG and Bifidobacterium animalis subsp. lactis Bb-12) in children with severe acute malnutrition can improve the imbalance of intestinal flora in children and significantly reduce the incidence of diarrhea. In recent years, as the relationship between specific microorganisms and diseases has become increasingly clear, the role of probiotics (or in combination with prebiotics and postbiotics) in restoring the balance of intestinal flora and maintaining healthy homeostasis has shown its potential as a substitute for drugs. Due to its own characteristics, it has natural advantages over drugs. Research related to probiotics has grown rapidly since the beginning of the 21st century. Based on the current research results and the future development trend of the probiotic field, some scholars have proposed the concept of "probiotic drugs (Probacine)", using live bacteria as drugs to "add" to the health of the host and "subtract" from the disease, maintaining intestinal homeostasis and body health. The introduction of this academic concept means that probiotics may gradually increase their proportion in disease treatment in the future, from health products to complementary therapies, to being on par with drugs, and finally to alternative drugs, to achieve worry-free treatment of diseases. However, at this stage, the research on probiotic intervention in lipid metabolism is relatively limited. For example, the patent CN116814501B mentioned that the long subspecies of Bifidobacterium longum BL36 can reduce the weight of mice on a high-fat diet for 8 weeks (the weight gain percentage is 25% lower than that of the control group), but the strain did not analyze the weight change under obesity conditions, nor was it verified in other lipid metabolism-related disease models; another example is the patent CN116286551B mentioned a long subspecies of Bifidobacterium infantis NKUFB3-14, which can reduce the weight of mice when treated with bacteria for 8 weeks, but similar to BL36, the experiment is carried out simultaneously with the bacteria treatment and high-fat diet modeling, so the weight of the mice did not exceed 32g by the end of the experiment, and the obesity of the mice was relatively low, so the significance was relatively limited, and the hypoglycemic effect of the strain was limited to fasting blood sugar, so the ability to control postprandial blood sugar was not very clear. In summary, the intervention effect of existing probiotics or their preparations on lipid metabolism-related diseases caused by a high-fat diet is still very limited, and its effect still needs to be further improved.Therefore, how to provide a probiotic preparation with good effects and no adverse reactions during the treatment process has become a problem that needs to be solved urgently by those skilled in the art. Summary of the invention

[0005] Purpose of the invention: In view of the shortcomings of the prior art, the purpose of the present invention is to provide a strain of Bifidobacterium longum subspecies longum and its application in lowering blood lipids and weight or improving lipid metabolism-related diseases.

[0006] Technical solution: In order to solve the above technical problems, the present invention provides a strain of Bifidobacterium longum subsp. longum dipro-O, which was deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration on December 25, 2023, with the deposit number: CGMCC No.29383.

[0007] The Bifidobacterium longum subsp. longum dipro-O described in the present invention can produce bile salt hydrolase, and the diameter of its bile salt hydrolysis ring is 15-35 mm; the strain can utilize tryptophan metabolism to produce indole-3-lactic acid, and the content of the produced indole-3-lactic acid is 5000-25000 ng / ml; the strain can directly reduce the level of cholesterol in the culture medium, and the proportion of reducing cholesterol is 10%-100%.

[0008] The present invention also includes products containing the Bifidobacterium longum subsp. longum dipro-O, and the products include fermented products, foods, health products, medicines or feeds.

[0009] The fermented product comprises the fermentation supernatant, fermentation precipitate or bacterial suspension of Bifidobacterium longum subsp. longum dipro-O.

[0010] The dosage forms of the product include powder, capsule, tablet, pill, film-coated agent, aerosol, granule, liquid, liposome, transdermal agent, suppository or lyophilized powder injection.

[0011] Wherein, the product also includes a protective agent, a functional auxiliary agent / or an auxiliary additive, a drug carrier and / or a pharmaceutical excipient.

[0012] The present invention also includes the use of the Bifidobacterium longum subsp. longum dipro-O and the product in preparing products for preventing, alleviating, regulating or treating diseases related to lipid metabolism.

[0013] Wherein, the lipid metabolism related diseases include obesity, diabetes, non-alcoholic fatty liver disease, hyperlipidemia or hyperuricemia.

[0014] The present invention also includes that the product for regulating lipid metabolism prepared by Bifidobacterium longum subsp. longum dipro-O is a product having at least one of the following effects:

[0015] 1) Products that can reduce body weight;

[0016] 2) Products that improve blood sugar levels;

[0017] 3) Products that improve intestinal immunity;

[0018] 4) Products that can improve blood lipid metabolism disorders;

[0019] 5) Products that can improve liver tissue damage induced by a high-fat diet;

[0020] 6) Products that improve the intestinal barrier;

[0021] 7) Products that can improve intestinal flora structure disorders.

[0022] The product having the effect of reducing body weight is specifically a product having the effect of reducing weight gain caused by a high-fat diet.

[0023] The product having the effect of improving blood sugar is specifically a product having the effect of regulating elevated blood sugar caused by a high-fat diet.

[0024] Among them, the product with the ability to improve intestinal immunity is specifically a product with the ability to regulate TNF-α levels in the intestine.

[0025] The product having the function of improving blood lipid metabolism disorders is specifically a product having the function of reducing the content of total cholesterol TC, total triglyceride TG, low-density lipoprotein LDL-C in the blood and increasing the content of high-density lipoprotein cholesterol HDL-C in the blood.

[0026] Among them, the product capable of improving liver tissue damage caused by a high-fat diet is specifically a product capable of improving aspartate aminotransferase and hepatocyte fatty degeneration.

[0027] Among them, the product with improved intestinal barrier function specifically increases the expression of intestinal barrier genes mTff3, Muc2, and ZO-1 in the intestine.

[0028] Among them, the product with the function of improving the disorder of intestinal flora structure is specifically a product that regulates the β diversity and genus level changes of intestinal flora. Among them, the application includes treatment with Bifidobacterium longum subspecies dipro-O to reduce the expression of inflammatory cytokine TNF-α in the colon of high-fat diet-induced obese mice, while promoting intestinal barrier repair and maintaining the expression of related genes mTff3, Muc2 and ZO-1.

[0029] Among them, the application includes reducing the level of aspartate aminotransferase in the blood of high-fat diet-induced hyperlipidemia model mice by treating with Bifidobacterium longum subspecies dipro-O, while reducing the fat vacuoles of the mice and the degree of inflammatory cell aggregation.

[0030] The high-fat diet modeled obese mice include a HFD-induced high-fat diet obese mouse model or an ASHF-induced hyperlipidemia mouse model.

[0031] Beneficial effects: Compared with the prior art, the present invention has the following advantages: the Bifidobacterium longum subsp. longum dipro-O used in the present invention has the ability to produce high BSH, reduce cholesterol, metabolize tryptophan to produce indole-3-lactic acid, can effectively reduce body weight, significantly reduce the level of insulin resistance caused by a high-fat diet, reduce the expression of inflammatory cytokine TNF-α, significantly reduce the level of total cholesterol (TC) and low-density lipoprotein (LDL) in the blood, and increase the level of high-density lipoprotein (HDL); improve the disorder of intestinal flora structure; and at the same time, it can also play an improving role in other diseases related to lipid metabolism such as hyperlipidemia, thereby performing health intervention on the host's weight, liver, intestinal health and blood lipid levels. In addition, pasteurized dipro-O can also play the role of regulating lipid metabolism, further broadening the application scope of the strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 To analyze the ability to produce bile salt hydrolase (BSH); Bifidobacterium longum subsp. longum dipro-O has a stronger ability to produce BSH (dipro-O: d = 24.5 mm, BPL1: d = 21.5 mm);

[0033] Figure 2The results of the cholesterol-lowering ability test are shown in Figure 2. The dipro-O of Bifidobacterium longum subsp. longum has a stronger cholesterol-lowering ability (mean dipro-O: 19.93%, BPL1: 9.1%).

[0034] Figure 3 The ability of dipro-O to metabolize tryptophan to produce indole-3-lactic acid (ILA) was analyzed; Bifidobacterium longum subsp. longum dipro-O had a stronger ability to produce BSH (the average ILA production capacity of dipro-O was 11110.3 ng / mL, and the average ILA production capacity of BPL1 was 2782.29 ng / mL);

[0035] Figure 4 is the weight growth rate of mice fed a high-fat diet; the weight growth rate of high-fat diet obese mice treated with Bifidobacterium longum subsp. longum dipro-O was lower and slower (dipro-O group: 54.898%, reference bacteria BPL1 group: 60.154%, PBS group: 100.01%);

[0036] Figure 5 This is an OGTT experiment in a high-fat diet mouse model; Bifidobacterium longum dipro-O can significantly reduce the insulin resistance level of high-fat diet model mice (compared with the PBS group, there were significant differences at 30 minutes, 60 minutes, and 90 minutes. At 30 minutes, there was a significant difference between the dipro-O group and the reference bacteria BPL1 group);

[0037] Figure 6 Liver slices were prepared for mice fed a high-fat diet; both live Bifidobacterium longum subsp. longum dipro-O and pasteurized Bifidobacterium longum subsp. longum dipro-O improved lipid accumulation and inflammatory cell aggregation in the liver, and significantly reduced the liver NAS score used to analyze hepatocyte fatty degeneration, hepatocyte ballooning, and intralobular inflammation;

[0038] Figure 7 Serum AST levels in mice modeled for high-fat diet;

[0039] Figure 8The changes of total cholesterol (TC), triglycerides (TG) and high-density lipoprotein (HDL) in the blood of mice modeled with a high-fat diet; compared with the BPL1 group, treatment with Bifidobacterium longum subsp. longum dipro-O can significantly reduce the total cholesterol level in the blood of obese mice modeled with a high-fat diet, and significantly increase the high-density lipoprotein (HDL) level in the blood compared with the PBS group. At the same time, compared with the PBS group, the triglyceride levels in the blood of mice in the dipro-O and Inactivedipro-O groups were significantly reduced;

[0040] Fig. 9 The expression of intestinal barrier-related genes in mice induced by high-fat diet; Bifidobacterium longum subsp. longum dipro-O treatment can reduce the expression of inflammatory cytokine TNF-α in the colon of obese mice induced by high-fat diet, and promote the expression of genes related to intestinal barrier repair and maintenance (mTff3, Muc2, ZO-1);

[0041] Fig.10 This is the analysis result of intestinal flora based on 16S rRNA sequencing of feces of mice induced by high-fat diet. The results show that the content of Clostridium in mice increased after dipro-O treatment.

[0042] Fig.11 Bifidobacterium longum subsp. longum dipro-O can effectively reduce liver lipid accumulation in the ASHF-induced hyperlipidemia mouse model; according to the slice data, it can be seen that the mice in the dipro-O group had fewer fat vacuoles, lower inflammatory cell aggregation, and significantly lower NAS scores than the PBS group;

[0043] Fig.12 Intervention with Bifidobacterium longum subsp. longum dipro-O in the ASHF diet-induced hyperlipidemia mouse model can significantly reduce the level of aspartate aminotransferase (AST) in the blood;

[0044] Fig.13 Intervention with Bifidobacterium longum subsp. longum dipro-O in the ASHF-induced hyperlipidemia mouse model can significantly reduce the levels of total cholesterol (TC) and low-density lipoprotein (LDL) in the blood. DETAILED DESCRIPTION

[0045] The present invention is described in detail below in conjunction with the accompanying drawings and embodiments.

[0046] Example 1 Screening and microbiological identification of strain dipro-O

[0047] Bifidobacterium longum subsp. longum dipro-O was isolated from the feces of healthy children and was identified by MALDI-TOF, 16SrRNA sequencing and whole genome sequencing. The strain identification results were consistent with the MALTI-TOF results at the species level, both of which were Bifidobacterium longum subsp. longum.

[0048] Bifidobacterium longum subsp. longum dipro-O was deposited in the General Microbiology Center of China Culture Collection Administration on December 25, 2023, with the deposit number: CGMCC No.29383.

[0049] The results of whole genome sequencing showed that the genome of the dipro-O strain was a circular chromosome, did not contain plasmids, and contained a total of 8 rRNAs, including 4 23S and 4 16S; as well as 55 tRNAs and one tmRNA.

[0050] dipro-O 16s rRNA sequence:

[0051] 5' → 3'

[0052]

[0053]

[0054] The antibiotic resistance of dipro-O strain was analyzed according to the "National Food Safety Standard - Safety Evaluation Procedure for Food Bacteria (Draft for Comments)". The results are as follows: dipro-O is sensitive to kanamycin, streptomycin, tetracycline, erythromycin, clindamycin, chloramphenicol, vancomycin and other antibiotics, and the conclusion is that it meets the national requirements;

[0055] When conducting functional experiments, the glycerol-preserved bacteria of Bifidobacterium longum subsp. longum dipro-O were taken out from the -80°C refrigerator, thawed in a 37°C water bath, and 20 μL was spread on an MRS (MRS broth + 0.5 g / L cysteine) plate, and cultured anaerobically at 37°C for 48 h; then, an inoculation loop was used for streaking to pass the culture, and after 48 h of culture, single clones were picked and cultured in MRS broth liquid culture medium supplemented with 0.5 g / L cysteine ​​for expansion, and then subsequent experiments could be carried out.

[0056] Example 2 Experiment on the ability of dipro-O to produce bile salt hydrolase (BSH)

[0057] The experiment used BSH screening plates: MRS solid medium (MRS solid medium + 0.5g / L cysteine) + 0.37g / L CaCl2 (calcium chloride) + 5g / L sodium taurodeoxycholate (TDCA); a 6mm drug-susceptibility paper was placed in the center of the BSH screening plate, and the Bifidobacterium longum subspecies dipro-O in the logarithmic growth phase was adjusted to OD600 = 0.5, and washed twice with PBS buffer (Procell, 10mM, pH7.2-7.4, product number: PB180327), then resuspended with 500μL PBS, 10μL of the resuspension was dropped on the drug-susceptibility paper, and the hydrolysis ring diameter was measured after anaerobic culture at 37°C for 48h.

[0058] Comparative Example 1 BPL1 Bile Salt Hydrolase (BSH) Production Capacity Test

[0059] The same BSH screening plate as in Example 1 was used, and a 6 mm drug-susceptibility paper was placed in the center of the BSH screening plate. BPL1 (ADM, USA, Bifidobacterium CECT8145) in the logarithmic growth phase was adjusted to OD600 = 0.5, washed twice with PBS, and then resuspended with 500 μL PBS buffer. 10 μL of the resuspension was dropped on the drug-susceptibility paper, and the hydrolysis ring diameter was measured after anaerobically culturing at 37°C for 48 h.

[0060] like Figure 1 In Example 2, the diameter of the hydrolysis ring of dipro-O is d=24.5 mm, and the diameter of the hydrolysis ring of BPL1 in Comparative Example 1 is d=21.5 mm. Using the size of the hydrolysis ring to compare the BSH production capacity of each strain, it can be found that the BSH production capacity of dipro-O is 13.95% higher than that of BPL1.

[0061] Example 3 Dipro-O cholesterol-lowering ability test

[0062] The long bifidobacterium dipro-O in the logarithmic growth phase was adjusted to OD600 = 2.5, and inoculated into a freshly prepared MRS broth liquid medium containing 0.3% (w / v) porcine bile salt and 0.1 g / L cholesterol (soluble in anhydrous ethanol, Sigma-Aldrich) with 0.5 g / L cysteine ​​at an inoculation ratio of 2%, and incubated at 37° C. for 24 hours. Then centrifuged at 4° C., 4000 g for 15 minutes, and the cholesterol level in the supernatant was detected using a cholesterol level detection kit (E-BC-K109-M), and a blank culture medium without bacteria but cultured in parallel was used as a control.

[0063] Comparative Example 2 BPL1 cholesterol-lowering ability experiment

[0064] The BPL1 strain in the logarithmic growth phase was adjusted to OD600 = 2.5, and inoculated into a freshly prepared MRS broth liquid medium containing 0.3% (w / v) bile salts and 0.1 g / L cholesterol (soluble in anhydrous ethanol, Sigma-Aldrich) supplemented with 0.5 g / L cysteine ​​at an inoculation ratio of 2%, and incubated at 37° C. for 24 hours. Then, the culture was centrifuged at 4° C., 4000 g for 15 minutes, and the cholesterol level in the supernatant was detected using a cholesterol level detection kit, and a blank culture medium without bacteria but cultured in parallel was used as a control.

[0065] Results Figure 2 In Example 3, the cholesterol content in the culture supernatant of dipro-O was reduced by 20.07%; compared with the cholesterol-lowering ability of BPL1 in Comparative Example 2 (13.67%), the cholesterol-lowering ability of dipro-O was 46.82% higher than that of BPL1, which is stronger than BPL1; this Example 3 proves that dipro-O has the ability to lower cholesterol, which proves from another perspective that dipro-O has the potential of being a probiotic for reducing fat and weight.

[0066] Example 4 Detection of tryptophan metabolism ability of dipro-O

[0067] The exponentially growing dipro-O was enriched and cultured using MRS broth liquid culture medium supplemented with 0.5 g / L cysteine, then washed once with PBS, adjusted to OD600 = 2.5, and then inoculated at an inoculation ratio of 2% in M9 culture medium containing 0.12 g / L tryptophan and cultured at 37°C for 48 h. The production of indole derivatives was then detected using a high performance liquid chromatography system (Waters Corporation, USA, model Waters 2498).

[0068] Comparative Example 3: Detection of tryptophan metabolism ability of BPL1

[0069] BPL1 in the exponential growth phase was enriched and cultured using MRS liquid culture medium supplemented with 0.5 g / L cysteine, then washed once with PBS, adjusted to OD600 = 2.5, and then inoculated at an inoculation ratio of 2% in M9 culture medium containing 0.12 g / L tryptophan and cultured at 37°C for 48 h. The production of indole derivatives was then detected using a high performance liquid chromatography system (Waters Corporation, USA, model Waters 2498).

[0070] The results of Example 4 and Comparative Example 3 are shown in Figure 3Dipro-O mainly metabolizes to produce indole-3-lactic acid (ILA), with an average output of 11110.3 ng / ml. The tryptophan metabolite of BPL1 is mainly ILA, with an average output of 2782.29 ng / mL. Dipro-O is 400% of the ILA output of BPL1 (2782.29 ng / mL), indicating that dipro-O has a strong ability to produce ILA.

[0071] Example 5 dipro-O can effectively reduce the body weight of high-fat diet-induced obesity (DIO) animal models

[0072] Eight-week-old male C57BL / 6J mice were used and divided into a negative control (NC) group, a high-fat control (PBS) group, and an experimental (dipro-O) group. The mice were fed a 60% kcal fat high-fat mouse diet (Dyets, catalog number: HF60) for 10 weeks to establish an obesity model. Subsequently, Bifidobacterium longum dipro-O was used for intragastric administration. The intragastric administration method was as follows: the exponential growth period live bacteria of Bifidobacterium longum dipro-O were subjected to anaerobic fermentation at 37°C, the fermentation broth was centrifuged, and the broth was resuspended in PBS buffer, and the OD600 was adjusted to 2.5. Each mouse was intragastricly administered with 200 μL, about 1*10 9 CFU bacterial count was measured for 9 weeks. The NC group and the high-fat control group were gavaged with the same dose of PBS buffer. The mice were weighed once a week. After 9 weeks, the relevant indicators of the mice in the probiotic group with biological effects were analyzed and measured: the total cholesterol (TC) / triglyceride (TG) / high-density lipoprotein (HDL) levels in the blood were measured using a Catic dry biochemical analyzer, and the aspartate aminotransferase (AST) level in the serum was detected using an Elirit aspartate aminotransferase (AST / GOT) colorimetric test kit (#E-BC-K236-S). The liver tissue was sectioned to analyze the liver fat accumulation.

[0073] Comparative Example 4 Analysis of the weight loss ability of the reference strain BPL1 in the high-fat diet-induced obesity (DIO) animal model Eight-week-old male C57BL / 6J mice were fed with a 60% kcal fat high-fat mouse diet (Dyets, Cat. No.: HF60) for 8 weeks of obesity modeling, and then BPL1 was used for gavage treatment. The gavage treatment method was as follows: the exponential growth phase live bacteria of BPL1 were subjected to anaerobic fermentation at 37°C, the fermentation broth was centrifuged and resuspended in PBS buffer, and OD600 was adjusted to 2.5. Each mouse was gavaged with 200 μL, about 1*10 9CFU count for 9 weeks; mice were weighed once a week, and relevant indicators of mice were analyzed and measured after 9 weeks: total cholesterol (TC) / triglyceride (TG) / high-density lipoprotein (HDL) levels in blood were measured using a Catic dry biochemical analyzer, serum aspartate aminotransferase (AST) levels were detected using an Elirit aspartate aminotransferase (AST / GOT) colorimetric test kit (#E-BC-K236-S), and liver tissue was sliced ​​to analyze liver fat accumulation;

[0074] The results of Example 5 and Comparative Example 4 are as follows Figure 4 : The body weight of mice in the PBS group increased by 100.01% compared with the body weight on the first day of gavage, the body weight of mice in the dipro-O group increased by 54.90% compared with the body weight on the first day of gavage, and the body weight of mice in the reference strain BPL1 group increased by 60.15% compared with the body weight on the first day of gavage. It can be concluded that dipro-O has a better ability to control the body weight of mice under high-fat diet conditions than the reference strain BPL1, and can effectively reduce the gain of body weight.

[0075] Example 6: Dipro-O intervention reduces insulin resistance in DIO animal models

[0076] At 19 weeks after high-fat modeling of mice and oral gavage with Bifidobacterium longum dipro-O according to the method of Example 5, oral glucose tolerance test (OGTT) was performed: blood was collected from the tail tip of mice after fasting for 12 hours, and the blood glucose level was detected using Roche Zhihang blood glucose meter, and then the mice were gavaged with 20% glucose solution at a dose of 1 g / kg, and the blood glucose levels were detected at 30, 60, 90, and 120 minutes after gavage.

[0077] Comparative Example 5 Analysis of oral glucose tolerance of BPL1 in DIO animal model

[0078] At 19 weeks after the mouse hyperlipidemia model was established and the BPL1 strain was gavaged according to the method of Example 5, an oral glucose tolerance test (OGTT) was performed: blood was collected from the tail tip of the mice after fasting for 12 hours, and the blood glucose level was detected using a Roche Zhihang blood glucose meter. The mice were then gavaged with 20% glucose solution at a dose of 1 g / kg, and the blood glucose levels were detected at 30, 60, 90, and 120 minutes after gavage.

[0079] Example 7 Inactive dipro-O intervention reduces insulin resistance in DIO animal models

[0080] According to the method of Example 5, mice were modeled with high fat. After 10 weeks, the mice were treated with pasteurized dipro-O (Inactive dipro-O) by gavage for 9 weeks. Inactive dipro-O was obtained by bathing dipro-O in a 70°C water bath for 30 minutes. At the end of the 19th week, an oral glucose tolerance test (OGTT) was performed: blood was collected from the tail tip of mice after fasting for 12 hours, and the blood glucose level was tested using a Roche Zhihang blood glucose meter. Then, the mice were treated with 20% glucose solution by gavage at a dose of 1 g / kg. The blood glucose levels were tested at 30, 60, 90, and 120 minutes after gavage.

[0081] The results of Examples 6, 7 and Comparative Example 5 are as follows Figure 5 The blood glucose levels of mice in the dipro-O group were significantly lower than those in the PBS group at 30 min, 60 min, and 90 min, indicating that the insulin resistance level of mice after dipro-O intervention was lower than that in the PBS group. Combined with the OGTT experiment of mice in the BPL1 group, the blood glucose level of mice in the dipro-O group was significantly lower than that in the BPL1 group at 30 min, indicating that the sensitivity of dipro-O to control blood glucose changes in a short period of time is better than that of BPL1.

[0082] The blood glucose level of mice in the Inactive dipro-O group was the lowest at 30 minutes, indicating that the insulin sensitivity of mice increased after the Inactive dipro-O intervention, and they were more sensitive to changes in blood glucose levels in the short term; combined with the results of Examples 6 and 7, it can be shown that both the live bacteria and pasteurized bacteria of dipro-O can effectively regulate blood glucose homeostasis.

[0083] Example 8 Dipro-O and Inactive dipro-O intervention reduced liver lipid accumulation in DIO animal models

[0084] At the end of the 19th week after the mouse high-fat model was established and oral administration of Bifidobacterium longum dipro-O was performed according to the method of Example 5, the mouse liver was taken and fixed in 4% paraformaldehyde, and H&E stained sections of the liver were prepared and lipid accumulation was analyzed. Based on the sections and liver NAS score results,

[0085] Comparative Example 6 Analysis of liver slices after BPL1 treatment in DIO animal model

[0086] At the end of the 19th week after the mouse high-fat model was established and the BPL1 strain was gavaged according to the method of Example 5, the mouse liver was taken and fixed in 4% paraformaldehyde, H&E stained sections of the liver were prepared and lipid accumulation was analyzed, and the results were scored based on the sections and liver NAS.

[0087] The results of Example 8 and Comparative Example 6 are shown in Figure 6 ,from Figure 6It can be seen that many vacuoles caused by lipid droplet accumulation appeared in the livers of mice treated with PBS, while the NAS scores of the livers of mice in the dipro-O group and the Inactive dipro-O group were significantly lower than those in the PBS group, indicating that lipid accumulation in the livers of mice decreased after administration of probiotics. Combined with the slice results of mice in the BPL1 group, it can be found that compared with the PBS group, the number of vacuoles in the livers of mice in the BPL1 group decreased, but there was no significant difference in the NAS scores. In summary, compared with BPL1, dipro-O and Inactive dipro-O have excellent ability to remove lipid accumulation.

[0088] Example 9: Serum AST levels in DIO animal models decreased after dipro-O intervention

[0089] At the end of the 19th week after the high-fat model was established in mice and Bifidobacterium longum dipro-O was gavaged according to the method of Example 5, blood was collected from the mice in a 1.5 mL sterile centrifuge tube, and serum was collected by centrifugation at 7000 rpm at 4°C for 10 minutes, and the AST level in the mouse serum was detected.

[0090] Comparative Example 7 Analysis of serum AST levels after BPL1 treatment in DIO animal model

[0091] At the end of the 19th week after the mouse hyperlipidemia model was established and the BPL1 strain was gavaged according to the method of Example 5, the mice were sampled and the mouse blood was collected in a 1.5 mL sterile centrifuge tube. The serum was collected by centrifugation at 4°C and 7000 rpm for 10 minutes, and the AST level in the mouse serum was detected.

[0092] The results of Example 9 and Comparative Example 7 are shown in Figure 7 ,from Figure 7 It can be seen that compared with the PBS group, the AST level in the serum of mice in the dipro-O group was reduced by 45.85%, while combined with the AST level of the BPL1 group, it was found that there was no statistical difference compared with the PBS group; this shows that compared with BPL1, the intervention of dipro-O can reduce the level of liver damage in DIO model mice, while the BPL1 group does not have the effect of protecting the liver.

[0093] Example 10: Serum cholesterol, triglyceride and high-density lipoprotein levels in DIO animal models decreased after dipro-O intervention

[0094] At the end of the 19th week after the high-fat modeling of mice was established and Bifidobacterium longum dipro-O was gavaged according to the method of Example 5, the serum of each group of DIO modeled mice was collected (see Example 9 for the specific steps), and the changes in total cholesterol (TC), triglycerides (TG) and high-density lipoprotein (HDL) in the blood were detected.

[0095] Comparative Example 8 Analysis of serum cholesterol, triglyceride and high-density lipoprotein levels after BPL1 treatment in DIO animal model

[0096] At the end of the 19th week after the mouse high-fat model was established and the BPL1 strain was gavaged according to the method of Example 5, the serum of each group of DIO model mice was collected (see Example 9 for specific steps), and the changes in total cholesterol (TC), triglycerides (TG) and high-density lipoprotein (HDL) in the blood were detected.

[0097] The results of Example 10 and Comparative Example 8 are shown in Figure 8 ,Depend on Figure 8 It can be seen that compared with the data of the BPL1 group, the cholesterol level in the blood of mice in the dipro-O group was significantly reduced (reduced by 16.28%); at the same time, the triglyceride level in the mouse blood was analyzed, and it was found that compared with the PBS group, the serum triglyceride level in the dipro-O group was reduced by 25.00%, and the serum triglyceride level in the Inactive dipro-O group was reduced by 25.03%, while in the high-density lipoprotein analysis, it was found that dipro-O treatment increased the HDL level in the mouse blood by 27.87%, and there was no significant difference between the other groups and the PBS group. This part of the results shows that compared with BPL1, the intervention of dipro-O lowers the cholesterol and triglyceride levels in the mouse serum, and at the same time increases the level of high-density lipoprotein that is beneficial to the human body.

[0098] Example 11 After dipro-O intervention, the intestinal barrier health of DIO mice was improved and the levels of inflammatory cytokines were reduced

[0099] At the end of the 19th week after the mouse high-fat model was established and oral administration of Bifidobacterium longum dipro-O was performed according to the method of Example 5, the mouse colon tissue was taken and the expression of colon-related genes was analyzed. The specific steps were as follows: about 5 mm of mouse colon tissue was taken into a 1.5 mL EP tube, 1 mL of Trizol reagent (Invitrogen, catalog number: 15596026) and 4 2.5 mm stainless steel balls were added to each tube, and the mixture was homogenized at 60 MHz for 45 seconds, with a rest period of 15 seconds, and repeated 5 times. RNA was then extracted and reverse transcribed. QuantStudio TM 5Real-Time PCR System was used for quantitative analysis of gene expression levels, and the detected genes included ZO-1, mTff3, TNF-α, Muc2, and the internal reference gene beta-Actin;

[0100] Comparative Example 9 Analysis of changes in intestinal gene expression levels after BPL1 treatment in DIO animal model

[0101] The mouse high-fat model was established according to the method of Example 5 and the BPL1 strain was gavaged orally. At the 19th week, the mouse colon tissue was taken and the expression of colon-related genes was analyzed. The specific steps are shown in Example 11.

[0102] The experimental results of Example 11 and Comparative Example 9 are shown in Fig. 9 , Fig. 9 The results of intestinal barrier and inflammation-related gene analysis in high-fat model obese mice were as follows: the expression level of mouse trefoil peptide factor (mTff3) that plays a role in mucosal repair in the dipro-O group increased by 55.59%, indicating that dipro-O can promote intestinal mucosal repair, while the level of mTff3 in the BPL1 group was significantly reduced; the expression of intestinal barrier tight junction protein gene ZO-1 was analyzed, and it was found that compared with the NC group, ZO-1 was significantly reduced in the PBS group and the BPL1 group (45.77% in the PBS group and 48.85% in the BPL1 group), the expression of ZO-1 in the dipro-O group was no different from that in the NC group, and the expression level of ZO-1 in the Inactive dipro-O group was significantly increased (increased by 76.66%), indicating that dipro-O treatment can promote the expression of tight junction proteins; the expression level of mucus protein Muc2 was analyzed, and it was found that compared with the NC group, the expression of Muc2 in the BPL1 group was reduced by 75.96%, while that in the dipro-O and Inactive dipro-O groups was significantly increased (increased by 76.66%). There was no difference in the expression level of Muc2 between the dipro-O group and the NC group. Analysis of the levels of proinflammatory cytokines showed that the levels of proinflammatory cytokines TNF-α in the colon tissues of the PBS and BPL1 groups were significantly increased compared with those in the blank treatment (NC) group (increased by 372.74% in the PBS group and 564.79% in the BPL1 group), while there was no statistical difference between the dipro-O and Inactive dipro-O groups and the NC group, indicating that the use of dipro-O or Inactive dipro-O can reduce the level of inflammation in the colon of mice caused by a high-fat diet. Combined with the above data, we believe that dipro-O can maintain the health of the intestinal barrier by promoting the expression of genes related to intestinal barrier maintenance and repair and inhibiting the expression of inflammatory cytokines, which is more advantageous than BPL1.

[0103] Example 12 Analysis of changes in intestinal flora in hyperlipidemia mouse model treated with dipro-O

[0104] At 19 weeks after the high-fat modeling of mice was established and Bifidobacterium longum dipro-O was gavaged according to the method of Example 5, the feces of the mice were collected, and the microbial DNA was extracted using a fecal genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., DP328), and amplified using 16s rRNA universal primers (sequencing primers are shown in Table 1), and sent to Qingke Biotechnology Co., Ltd. for sequencing, and then the samples were analyzed in different dimensions using bioinformatics analysis software (such as QIIME2, etc.) to compare the differences between the groups; Fig.10 , mouse β diversity ( Fig.10 -A), genus level ( Fig.10 -B) The intestinal flora structure has changed, and LEFSE is used to further analyze the changes in differential bacteria ( Fig.10 -C) It was found that dipro-O treatment increased the abundance of Clostridium bacteria in the intestines of mice, indicating that dipro-O can not only reduce weight and lower blood lipids, but also regulate the dysbiosis of obese mice to a certain extent.

[0105] Table 1. 16S amplification primers

[0106] name Sequence (5'-3') 27F AGAGTTTGATCCTGGCTCAG 1492R GGTTACCTTGTTACGACTT

[0107] Example 13 Dipro-O intervention reduces liver lipid accumulation in hyperlipidemia animal model

[0108] Eight-week-old male C57BL / 6J mice were fed a high-fat (40 kcal%), high-cholesterol (1.25%), and high-sodium cholate (0.5%) mouse diet (Dyets, catalog number: ASHF4) for eight weeks to establish a hyperlipidemia model. The intragastric gavage conditions were the same as those for the DIO model mice in Example 5. After eight weeks of intragastric gavage, the mouse livers were sampled, and the liver tissues were sliced ​​and stained with H&E. The results are shown in FIG. Fig.11 As shown in the figure, after hyperlipidemia modeling, cavities caused by a small amount of lipid droplets and some inflammatory cell aggregation appeared in the liver (PBS group). After intervention with dipro-O, the vacuolar structure and inflammatory cell aggregation were significantly reduced (dipro-O group), indicating that dipro-O intervention effectively reduced the accumulation of lipids in the liver.

[0109] Example 14: Serum AST levels decreased in hyperlipidemia animal models after dipro-O intervention

[0110] Eight-week-old male C57BL / 6J mice were fed a high-fat (40 kcal%), high-cholesterol (1.25%), and high-sodium cholate (0.5%) mouse diet (Dyets, catalog number: ASHF4) for hyperlipidemia modeling. Eight weeks after modeling, the mice were gavaged under the same gavage conditions as the DIO model in Example 5. Blood was collected eight weeks after gavage, and serum was separated to analyze serum AST levels. Fig.12 It can be seen that the serum AST level in the PBS group increased by 108.30%, indicating an increased degree of liver damage; after intervention with Bifidobacterium longum dipro-O, the AST level decreased by 35.45% compared with the PBS group, indicating that the intervention of dipro-O alleviated the liver damage caused by high-fat diet in mice.

[0111] Example 15: Dipro-O intervention reduces serum cholesterol (TC) and low-density lipoprotein (LDL) levels in hyperlipidemia animal models

[0112] Eight-week-old male C57BL / 6J mice were fed a high-fat (40 kcal%), high-cholesterol (1.25%), and high-sodium cholate (0.5%) mouse diet (Dyets, catalog number: ASHF4) for eight weeks to establish a hyperlipidemia model. The intragastric gavage conditions were the same as those for the DIO model mice in Example 5. Blood was collected from the mice after eight weeks of gavage, and serum cholesterol and low-density lipoprotein were analyzed after serum separation. The results are shown in Table 1. Fig.13 As shown, intervention with Bifidobacterium longum dipro-O in the ASHF-induced hyperlipidemia mouse model reduced blood cholesterol levels by 40.50% and low-density lipoprotein levels by 60.25%, indicating that dipro-O intervention can effectively improve the blood health of mice.

Claims

1. A strain of Bifidobacterium longum subsp. longum ( Bifidobacterium longum subsp.longum ) dipro-O, characterized in that The Bifidobacterium longum subsp. Bifidobacterium longum subsp.longum )dipro-O was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on December 25, 2023, with the deposit number: CGMCC No.29383.

2. The Bifidobacterium longum subspecies longum according to claim 1 ( Bifidobacterium longum subsp.longum ) dipro-O, characterized in that The strain can produce bile salt hydrolase, and the diameter of its bile salt hydrolysis ring is 15-35 mm; the strain can produce indole-3-lactic acid by tryptophan metabolism, and the content of the produced indole-3-lactic acid is 5000-25000 ng / ml; the strain can directly reduce the level of cholesterol in the culture medium, and the proportion of cholesterol reduction is 10%-100%.

3. Containing the Bifidobacterium longum subspecies longum according to claim 1 ( Bifidobacterium longum subsp.longum ) dipro-O product, characterized in that, The product is a fermented product.

4. The product according to claim 3, wherein the fermented product comprises Bifidobacterium longum subsp. longum ( Bifidobacterium longum subsp.longum ) fermentation precipitate or bacterial suspension of dipro-O.

5. The Bifidobacterium longum subspecies longum of claim 1 ( Bifidobacterium longum subsp.longum ) Use of dipro-0 or the product according to any one of claims 3 to 4 in the preparation of a fermented product for regulating lipid metabolism, wherein the fermented product for regulating lipid metabolism is a fermented product having at least one of the following effects: 1) Fermented products that can reduce body weight; 2) Fermented products that improve blood sugar levels; 3) Fermented products that improve intestinal immunity; 4) Fermented products that can improve blood lipid metabolism disorders; 5) Fermented products that improve liver tissue damage induced by high-fat diet; 6) Fermented products that improve the intestinal barrier; 7) Fermented products that can improve intestinal flora structure disorders.

6. The use according to claim 5, characterized in that: The fermented product having the effect of reducing body weight is specifically a fermented product having the effect of reducing weight gain caused by a high-fat diet.

7. The use according to claim 5, characterized in that: The fermented product having the effect of improving blood sugar is specifically a fermented product having the effect of reducing the increase in blood sugar caused by a high-fat diet.

8. The use according to claim 5, characterized in that: The fermented product having the function of improving intestinal immunity is specifically a fermented product having the function of reducing the TNF-α level in the intestine.

9. The use according to claim 5, characterized in that: The fermented product with the function of improving blood lipid metabolism disorder is specifically a fermented product with the function of reducing the content of total cholesterol TC, total triglyceride TG, low-density lipoprotein LDL-C in the blood and increasing the content of high-density lipoprotein cholesterol HDL-C in the blood.

10. The use according to claim 5, characterized in that: The fermented product having the function of improving liver tissue damage caused by a high-fat diet is specifically a fermented product having the function of improving aspartate aminotransferase and hepatocyte fatty degeneration.

11. The use according to claim 5, characterized in that: The fermented product having the function of improving the intestinal barrier is specifically a fermented product that increases the expression of intestinal barrier genes mTff3, Muc2, and ZO-1 in the intestine.

12. The use according to claim 5, characterized in that: The fermented product having the function of improving the disordered intestinal flora structure is specifically a fermented product that regulates the β diversity and genus level changes of the intestinal flora.

Images