Construction method and application of a self-replicating mRNA vaccine against porcine epidemic diarrhea virus

By designing a self-replicating mRNA vaccine, using Venezuelan equine encephalitis virus RNA replicon to replicate antigenic mRNA in host cells and optimizing antigenic protein gene sequence, the problems of low expression and insufficient durability of traditional mRNA vaccines are solved, and a more efficient and lasting immune response is achieved.

CN118725054BActive Publication Date: 2025-06-27SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411079537.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-07
Publication Date
2025-06-27
Estimated Expiration
2044-08-07

AI Technical Summary

Technical Problem

The existing traditional mRNA vaccines have problems with low expression and insufficient durability in inducing antibody responses, and it is difficult to effectively prevent infection caused by mutant strains of swine epidemic diarrhea virus (PEDV).

Method used

A self-replicating mRNA vaccine was designed and constructed to replicate antigenic mRNA in host cells using the Venezuelan equine encephalitis virus RNA replicon, significantly increasing the expression of antigenic proteins, and improving its immunogenicity by optimizing the antigenic protein gene sequence.

Benefits of technology

A higher antigen expression level was achieved, reducing vaccine dose demand, reducing side effects risks, and significantly improving the durability and protective effect of the immune response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118725054B_ABST
    Figure CN118725054B_ABST
Patent Text Reader

Abstract

The present invention discloses a construction method and application of a self-replicating mRNA vaccine for porcine epidemic diarrhea virus, belonging to the field of pharmaceutical technology. The self-replicating mRNA vaccine comprises the sequence as set forth in SEQ ID NO: 1. Also disclosed is a lipid nanoparticle-encapsulated self-replicating mRNA vaccine, which comprises the self-replicating mRNA vaccine and lipids for encapsulating the self-replicating mRNA vaccine. The mRNA vaccine prepared by the present invention can quickly respond to the currently prevalent porcine epidemic diarrhea virus, reducing the R & D and production cycle of new vaccine development. Vaccine efficacy tests show that the self-replicating mRNA vaccine prepared by the present invention has good immunogenicity and can produce high levels of neutralizing antibodies against porcine epidemic diarrhea virus in vivo.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a construction method and application of a self-replicating mRNA vaccine for porcine epidemic diarrhea virus. Background Art

[0002] Porcine Epidemic Diarrhea (PED) is a highly contagious digestive tract infectious disease caused by Porcine Epidemic Diarrhea Virus (PEDV). Domestic pigs of different ages and strains are susceptible to infection. This virus poses the greatest threat to suckling piglets, causing severe diarrhea, vomiting, dehydration, and high mortality rates in piglets within two weeks of age, with mortality rates reaching 80 - 100%. The histopathological changes in tissues infected with PEDV mainly show atrophy and necrosis of small intestinal villi, and it is an important disease currently seriously endangering the pig farming industry. In 1971, PEDV was first reported in the UK. In 1977, the classical strain CV777 of PEDV was isolated in Belgium. Due to strict breeding environments and effective vaccine protection, PEDV only showed sporadic occurrences in European and Asian countries. However, in 2010, highly pathogenic PEDV variant strains broke out in China, with mortality rates in infected piglets reaching up to 100%. By 2013, highly pathogenic PEDV variant strains had spread widely in countries or regions such as the United States, Canada, Mexico, and Southeast Asia. Although immunization with commercial inactivated vaccines or attenuated vaccines is carried out, due to the poor cross-protection effect of inactivated vaccines or attenuated vaccines against PEDV variant strains, combined with the continuous evolution of variant strains, PEDV infections still occur frequently in pig herds. Therefore, it is extremely urgent to design more effective vaccines for the prevention and control of PEDV.

[0003] An mRNA vaccine introduces mRNA encoding an antigen protein into the body, expresses the antigen protein in the body, and induces a specific immune response in the body, thereby enabling the body to obtain immune protection. Compared with traditional vaccines, mRNA vaccines can induce both cellular immunity and humoral immunity, and have the characteristics of rapid response to pathogen mutations, simple production processes, high production efficiency, and easy large-scale expansion. Self-replicating mRNA vaccines have some obvious advantages compared to ordinary mRNA vaccines. First, self-replicating mRNA vaccines have higher expression efficiency and can rapidly translate a large amount of viral antigen proteins in cells, thereby stimulating a more powerful and lasting immune response. Second, self-replicating mRNA vaccines have a longer protection period because they can continuously self-replicate and produce more antigen proteins, thereby extending the duration of immune memory. Generally speaking, self-replicating mRNA vaccines have better efficacy and are safer, and are expected to become an important breakthrough in the future vaccine research and development field.

[0004] Although traditional mRNA vaccines against PEDV have been reported, such as CN113274491A, traditional mRNA vaccines still have some problems. For example, mRNA is easily degraded in the body, resulting in low expression levels of antigen proteins, and it cannot continuously stimulate the immune system in the body. Compared with traditional mRNA vaccines, self-amplifying mRNA vaccines can self-replicate, thus significantly increasing the expression level of antigen proteins. The self-replicating mRNA of this invention utilizes the Venezuelan equine encephalitis (VEE) virus RNA replicon, which can replicate antigen mRNA in host cells, thereby greatly increasing the production of antigens. In contrast, traditional mRNA vaccines can only produce antigens by directly translating the mRNA sequence, with limited expression levels. Since self-replicating mRNA can replicate in the body and enhance antigen expression, the required initial dose is much lower. This can not only reduce production costs but also reduce the risk of side effects that may be caused by excessive vaccine doses. Higher antigen expression levels can lead to stronger immune responses. The highly efficient expression of self-replicating mRNA vaccines can stimulate the immune system more persistently, thus producing a longer-lasting protective effect. This is particularly important for infectious disease vaccines that require strong and persistent immune responses. Self-replicating mRNA vaccines can reduce the raw materials and volume required in the production and packaging processes because the amount of mRNA required for a single-dose vaccine is significantly reduced. Therefore, self-replicating mRNA vaccines show significant advantages in enhancing antigen expression, reducing dose requirements, enhancing immune responses, and improving production efficiency. These characteristics make them have great potential in the prevention and control of infectious diseases Summary of the Invention

[0005] To solve the above problems, the present invention designs and optimizes the nucleotide sequence of the spike protein S of PEDV and clones it into a self-replicating vector to obtain a self-replicating PEDV mRNA vaccine with better performance

[0006] First, the present invention provides an antigen fragment with broad-spectrum anti-porcine epidemic diarrhea virus. The codons of the antigen fragment are first optimized, and at the same time, the repetitive regions in the original sequence are removed to avoid stem-loop structures in mRNA and promote the synthesis process. Unwanted sequences are modified, including restriction enzyme cleavage sites and negative cis-acting sites used in molecular cloning. The entire sequence is fine-tuned to increase translation efficiency and extend the half-life of mRNA. Significantly enhanced the immunogenicity of the antigen protein, increased the neutralizing antibodies against PEDV produced in the administered subject, and the amino acid sequence of the antigen fragment is as shown in SEQ ID NO.2

[0007] One aspect of the present invention provides a recombinant nucleic acid, which is characterized by comprising a nucleic acid encoding the optimized PEDVS gene, and the optimized sequence is shown as SEQ ID NO: 1.

[0008] One aspect of the present invention provides a recombinant mRNA, which is characterized by comprising an mRNA encoding the optimized PEDVS protein.

[0009] Furthermore, the recombinant mRNA is characterized in that the mRNA further comprises one or more of a 5ˋ-UTR, a 3ˋ-UTR, a polyA sequence, and an IRES sequence.

[0010] Furthermore, the nucleotide sequence of the 5ˋ-UTR is:

[0011] GAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTA TTTTATTTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC, and the polyA sequence is AAAAAAAAAAAAAAAAAAAAAAAAAA.

[0012] One aspect of the present invention provides an expression cassette, which is characterized by comprising the recombinant nucleic acid or the recombinant mRNA.

[0013] One aspect of the present invention provides a vector, which is characterized by comprising the recombinant nucleic acid, or the recombinant mRNA, or the expression cassette; preferably, the vector comprises a self-replicating vector; more preferably, the self-replicating vector comprises a VEE self-replicating vector; most preferably, the vector is a T7-VEE vector.

[0014] One aspect of the present invention provides a cell, which is characterized by comprising the recombinant nucleic acid, or the recombinant mRNA, or the expression cassette, or the vector.

[0015] One aspect of the present invention provides a recombinant bacterium, which is characterized by comprising the recombinant nucleic acid, or the recombinant mRNA, or the expression cassette, or the vector; preferably, the bacterium is Escherichia coli; more preferably, the Escherichia coli is one of E.coli BL21(DE3), E.coli Origami B(DE3) or E.coli RosettaBlue(DE3); most preferably, the Escherichia coli is E.coli BL21(DE3).

[0016] One aspect of the present invention provides a composition, characterized by comprising the optimized PEDV S protein, or the recombinant nucleic acid, or the recombinant mRNA, or the expression cassette, or the vector, or the cell, or the recombinant bacterium.

[0017] One aspect of the present invention provides a kit, characterized by comprising the optimized PEDV S protein, or the recombinant nucleic acid, or the recombinant mRNA, or the expression cassette, or the vector, or the cell, or the recombinant bacterium, or the composition.

[0018] One aspect of the present invention provides a porcine epidemic diarrhea virus self-replicating mRNA vaccine, comprising:

[0019] (a) the recombinant mRNA; and

[0020] (b) a pharmaceutically acceptable carrier; preferably, the carrier comprises lipids; more preferably, the lipids include one or more of cationic lipids, ionizable lipids, helper lipids, cholesterol, DMG-PEG2000.

[0021] One aspect of the present invention provides a method for preparing a recombinant expression vector for porcine epidemic diarrhea virus self-replicating mRNA, non-capped mRNA recombinant expression vector or self-replicating RNA recombinant expression vector.

[0022] One aspect of the present invention provides the use of the optimized PEDV S protein, or the recombinant mRNA in any of the following: (I) preparing a drug for treating or preventing diseases caused by PEDV infection; or, (II) preparing a drug for treating or preventing PEDV; or (III) preparing a drug for inducing a specific immune response against PEDV in a subject to which it is administered.

[0023] Furthermore, the porcine epidemic diarrhea virus (PEDV) self-replicating mRNA vaccine is applicable to a variety of PEDV strains, and the PEDV strains include classical strain type 1 (1a and / or 1b) and / or variant strain type 2 (2a and 2b).

[0024] Beneficial effects

[0025] The present invention provides a self-replicating mRNA based on the S protein gene of porcine epidemic diarrhea virus. The S protein of PEDV was selected as the antigen, and the corresponding self-replicating mRNA vaccine was designed and constructed. In the research, with reference to the S gene sequence of PEDV SD strain of genotype G1b in the GenBank database (GenBank: MZ596343), we first optimized the sequence of the S protein gene, and the expression level of the optimized S protein gene on cells was significantly better than that of the unoptimized S protein gene sequence. Then the coding sequence of the S protein gene was inserted into the modified T7-VEE-mRNA vector to form the recombinant vector plasmid T7-VEE-mRNA-S. The immunogenicity of the optimized protein was significantly enhanced, increasing the neutralizing antibodies against PEDV produced in vivo. Therefore, the protective effect can be achieved with a smaller vaccine dose. Thus, reducing the vaccination dose correspondingly reduces the amount of liposomes used, and further reduces the cytotoxicity caused by liposomes, while ensuring the immune effect and reducing the toxicity of the vaccine.

[0026] Subsequently, the recombinant vector plasmid was digested and linearized, and the self-replicating mRNA was obtained by in vitro transcription with T7 transcriptase. Finally, it was packaged with nano-lipid particles (LNP) to successfully prepare a self-replicating porcine epidemic diarrhea mRNA vaccine. The vaccine efficacy test showed that the self-replicating PEDV mRNA vaccine of the present invention has good immunogenicity. The present invention evaluated the immune efficacy of the self-replicating PEDV mRNA vaccine through immunization of Balb / c mice animal experiments. The results showed that the neutralizing antibodies against PEDV of genotype G1b in mice could be induced by immunizing twice (with an interval of 2 weeks) with a minimum dose of 3 μg of the self-replicating mRNA vaccine. The experiment proved that the mRNA-based vaccine of the present invention has a strong immune response in mouse experiments, and the mRNA itself has an adjuvant effect, so it can induce a significant immune response. Brief Description of the Drawings

[0027] Figure 1 Plasmid map of vector T7-VEE-GFP;

[0028] Figure 2 Radar chart of relative codon frequencies of PEDV S protein gene;

[0029] Figure 3 GC content adjustment diagram of PEDV S protein gene;

[0030] Figure 4 Expression verification diagram of optimized PEDV S protein gene;

[0031] Figure 5 Plasmid map of vector T7-VEE-mRNA-S;

[0032] Figure 6 Electrophoresis identification diagram of plasmid T7-VEE-mRNA-S digested by restriction endonuclease MluΙ;

[0033] Figure 7 Detection of the expression of PEDV S antigen protein in HEK-293T cells by Western Blotting;

[0034] Figure 8 Particle morphology of LNP-SAM-S under transmission electron microscope;

[0035] Figure 9 Representative particle size of LNP-SAM-S particles;

[0036] Figure 10 Determination of neutralizing antibody titers in sera of mice in each group Specific implementation manners

[0037] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings and specific embodiments. Obviously, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts fall within the scope of protection of the present invention.

[0038] The materials and consumables used in this experimental study can be obtained from commercial channels without special specification. The self-replicating vector T7-VEE-GFP was purchased from Addgene; the PEDV S protein gene sequence optimized for porcine codons was synthesized by Shanghai Saiheng Biotechnology Co., Ltd. and cloned into the pcDNA3.1 vector. High-fidelity enzyme HS (Premix) and RNAMarker RL6,000 were purchased from Takara; restriction endonucleases Cla I, EcoRⅤ, MluΙ, homologous recombination enzyme HiFi DNAAssembly Cloning Kit were all purchased from NEB; T7 High Yield RNASynthesis Kit for Co-transcription was purchased from Yeasen Biotechnology Co., Ltd.; DMRIE-C transfection reagent was purchased from Thermo Fisher Scientific; PEDV S protein monoclonal antibody was purchased from Qianxun Biotechnology Co., Ltd.; HRP-labeled anti-mouse IgG antibody was from Proteintech; DMEM medium, Opti-MEM TMThe serum-free medium, trypsin, and fetal bovine serum were all purchased from Gibco; the LNP packaging kit and citric acid-sodium citrate solution were purchased from NBD Nanotechnology Co., Ltd.; absolute ethanol, DEPC solution, PBS buffer, etc. were all domestic products. The PEDV SD strain was preserved in our laboratory.

[0039] Example 1 Optimization of the self-replicating vector T7-VEE-mRNA

[0040] (1) Double digestion of the self-replicating vector T7-VEE-GFP

[0041] The self-replicating vector T7-VEE-GFP ( Figure 1 ), using the restriction enzyme sites Cla I and Mlu I, removed the GFP, IRES, and puro resistance genes from this vector. The double digestion system is shown in Table 1. After reacting at 37 °C for 2 hours, gel extraction was performed.

[0042] Table 1 Restriction endonuclease Cla I and Mlu I digestion reaction system

[0043]

[0044] (2) Amplification of the 3’UTR and poly(A) of the Venezuelan equine encephalitis (VEE) virus genome

[0045] The combination of the 3’UTR and poly(A) sequences of the VEE virus can effectively enhance the expression level of foreign genes. This ensures the stability and translation efficiency of mRNA, thereby obtaining a higher yield of the target protein. According to the fragment of the VEE virus genome 3’UTR and poly(A) sequences, namely

[0046] GAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTA TTTTATTTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC and

[0047] AAAAAAAAAAAAAAAAAAAAAAAAAA and the sequence after double digestion of the self-replicating vector T7-VEE-GFP, homologous recombination primers were designed using SnapGene software, and the primers were synthesized by Shanghai Sangon Biotech Co., Ltd. (Table 2). This fragment contains a Cla I restriction enzyme site at the 5’ end and an Mlu I restriction enzyme site at the 3’ end. In addition, an EcoR V (GATATC) restriction enzyme site was added for the subsequent insertion of the target gene PEDV S.

[0048] Table 2 Primers for Amplifying 3’UTR and poly(A) Fragments of VEE Virus Genome

[0049]

[0050] Using the vector T7-VEE-GFP as a template, the amplification system is shown in Table 3. After mixing all the reagents, PCR amplification is carried out. The program settings are as follows: 98°C for 5 min; 98°C for 10 s, 55°C for 5 s, 72°C for 10 s, for a total of 35 cycles; finally, extension is carried out at 72°C for 5 min. After 1% agarose gel electrophoresis, the gel is cut and recovered at the size of 201 bp.

[0051] Table 3 Amplification System for S Gene

[0052]

[0053] (3) Ligation of Self-Replicating Vector Plasmid T7-VEE-mRNA

[0054] The purified fragments of 3’UTR and poly(A) of VEE virus genome are subjected to homologous recombination reaction with the double-digested T7-VEE-GFP vector. The system is shown in Table 4, and the reaction condition is 50°C for 15 min. The ligated plasmid is transformed into DH5α competent cells. The plasmids identified as positive by PCR and double digestion methods are sent to Shanghai Sangon Biotech Co., Ltd. for further identification, and finally the self-replicating vector plasmid T7-VEE-mRNA is obtained.

[0055] Table 4 Ligation System

[0056]

[0057] Example 2 Construction of Self-Replicating PEDV mRNA In Vitro Transcription Vector

[0058] (1) Codon Optimization of S Gene in Pigs

[0059] To better express proteins in pigs, the 4149-bp S gene sequence was codon-optimized. The following factors were adjusted, including but not limited to: The codon usage preference of the S gene was adjusted to adapt to the highest expression profile of the target host. The CAI (Codon Adaptation Index) increased from 0.55 to 0.87 (CAI in the range of 0.8 - 1.0 can be regarded as high expression). The relative codon frequency distribution shows the frequency of each individual codon. The radar chart ( Figure 2 ) shows the suitability of the codon usage pattern between the optimized sequence (shown in red) and the host (shown in blue). A better curve match means it is more suitable.

[0060] The average GC content was adjusted from 41.1% to 58.3%, and unfavorable peaks were removed (Figure 3 ) Remove the repetitive regions in the original sequence to avoid stem-loop structures in mRNA and facilitate the synthesis process. Modify the unwanted sequences, including restriction enzyme cleavage sites and negative cis-acting sites used in molecular cloning. The entire sequence is fine-tuned to increase translation efficiency and extend the half-life of mRNA. The optimized sequence of the PEDV S gene after optimization is shown as SEQ ID NO: 1.

[0061] (2) Expression verification of the optimized S protein gene

[0062] Protein expression of the optimized PEDV S protein gene in 293T cells. First, clone the PEDV S protein gene before and after optimization into the pcDNA3.1 expression vector and transfect HEK293T cells. At 48 hours after transfection, use RIPA buffer with protease inhibitors added for protein extraction. Then, quantify the extracted protein by the BCA method, and subsequently perform SDS-PAGE electrophoresis separation. After electrophoresis, transfer the protein to a PVDF or nitrocellulose membrane and block it with a blocking solution to reduce non-specific binding. Then, incubate with a specific primary antibody, wash to remove unbound antibodies, and then add an HRP-labeled secondary antibody for incubation. Subsequently, use an ECL color development reagent to detect the signal and record the results through an imaging system. Finally, observe the band of the PEDV S protein on the membrane ( Figure 4 ). The results show that the expression level of the protein with the optimized sequence is significantly increased.

[0063] (3) Primer design and synthesis

[0064] According to the optimized sequence of the PEDV SD strain S gene codons and the sequence of the vector T7-VEE-mRNA, use SnapGene software to design homologous recombination primers for amplifying the S gene. The primers are synthesized by Shanghai Sangon Biotech Co., Ltd. (Table 5).

[0065] Table 5 Specific amplification primers for the S gene

[0066]

[0067] (4) PCR amplification of the PEDV S gene

[0068] Using the porcine codon-optimized S gene synthesized by the company as a template, the amplification system is shown in Table 6. After mixing all the reagents, perform PCR amplification. The program is set as follows: 98°C for 5 min; 98°C for 10 s, 55°C for 5 s, 72°C for 4 min 30 s, for a total of 35 cycles; finally, extend at 72°C for 5 min.

[0069] Table 6 S gene amplification system

[0070]

[0071] (5) Self-replicating vector plasmid T7-VEE-mRNA single digestion

[0072] Digest the vector T7-VEE-mRNA with the restriction endonuclease EcoRⅤ for single digestion. The digestion system is shown in Table 7, and then perform homologous recombination with the amplified S gene.

[0073] Table 7 Vector double digestion system

[0074]

[0075] (6) Ligation of PCR product and T7-VEE-mRNA vector

[0076] Perform homologous recombination reaction on the purified S gene fragment and the single-digested T7-VEE-mRNA vector. The system is shown in Table 8, and the reaction condition is incubation at 50 °C for 15 minutes. Transform the ligated plasmid into DH5α competent cells, and send the plasmid identified as positive by PCR and double digestion methods to Shanghai Sangon Biological Engineering Co., Ltd. for further identification. Finally, obtain T7-VEE-mRNA-S( Figure 5 ).

[0077] Table 8 Ligation system

[0078]

[0079] (7) Linearization of recombinant plasmid

[0080] The concentration of template DNA for synthesizing mRNA is 0.5 - 1 μg / μL. Considering the loss during recovery after digestion, determine the amount of plasmid for restriction endonuclease treatment according to Table 9. If there is uncut circular plasmid, larger fragments than the target size will be generated during in vitro transcription. Take a part of the digested template DNA for agarose gel electrophoresis to confirm that the circular plasmid is completely cut( Figure 6 ).

[0081] Table 9 Ligation system

[0082]

[0083] Example 3 In vitro transcription and expression verification of self-replicating PEDV S gene mRNA

[0084] (1) In vitro transcription of PEDV S gene mRNA

[0085] Thaw each corresponding component in the T7 HighYield RNA Synthesis Kit for Co-transcription on ice, prepare the reaction mixture at room temperature, add each component in the order shown in Table 10, and react at 37 °C for 3 h. Recover the transcribed mRNA by lithium chloride precipitation and name it SAM-S.

[0086] Table 10 In vitro transcription reaction system

[0087]

[0088]

[0089] (2) Transfection of mRNA SAM-S and identification by Western Blotting

[0090] Transfect SAM-S into HEK-293T and perform Western Blotting identification. The specific steps are as follows: One day before cell transfection, digest the cells with trypsin and count them. Plate the cells in a six-well plate. Transfection can be carried out when the growth density reaches 80%. Wash the cells once with PBS and then once with serum-free DMEM medium before cell transfection; Add 1 mL of Opti-MEM and 6 μL of DMRIE-C transfection reagent to a 1.5 mL centrifuge tube, mix well by pipetting, then add 3.5 μg of the transcribed mRNA, quickly mix well by pipetting and drop it onto HEK-293T. Culture in an incubator at 37 °C and 5% CO2 for 4 h, and then change to DMEM medium containing 2% FBS. Cells transfected with SAM-S are identified by Western Blotting, and obvious specific bands can be detected with the PEDV S protein monoclonal antibody ( Figure 7 ). The results show that mRNA SAM-S can be well expressed in cells.

[0091] Example 4 Preparation and identification of PEDV self-replicating mRNA lipid nanoparticles (LNP-SAM-S)

[0092] (1) Preparation of mRNA lipid nanoparticles (LNP-SAM-S)

[0093] Use the LNP encapsulation kit (Nazhida, product number: N01001050) to prepare self-replicating mRNA lipid nanoparticles. Dilute the mRNA (buffer phase) obtained by in vitro transcription with a citric acid-sodium citrate solution with pH = 4.0. The concentration of the diluted mRNA is 33.3 μg / mL. Mix the diluted mRNA with liposomes in a certain ratio and use an LNP microfluidic preparation instrument (Nazhida, model: NEXSTARnano1) to prepare LNP-SAM-S. The parameters and processes are as follows:

[0094] mRNA: Total liposome volume ratio 3:1 mRNA: Total liposome flow rate ratio 9 mL / min: 3 mL / min

[0095] After the sample was collected, an equal volume of citric acid-sodium citrate solution with pH = 4.0 was immediately added for dilution, and then centrifuged using a Millipore 30KDa ultrafiltration tube to 1 / 4 of the original volume. Then, 15 times the volume of PBS buffer was added to reduce the ethanol content to less than 0.5%. Finally, ultrafiltration concentration was performed using PBS buffer containing 10% sucrose.

[0096] (2) Characterization of PEDV LNP-SAM-S particles

[0097] (a) Morphological characteristics

[0098] Drop LNP-SAM-S above the copper grid, and then drop it again after the liquid is slightly dry. After drying at room temperature, drop a drop of 2.5% phosphotungstic acid for negative staining, and then drop it again after the liquid is slightly dry. After the copper grid is air-dried, transfer it to a glass petri dish lined with filter paper and leave it in the oven overnight. After drying, observe its morphology through a transmission electron microscope ( Figure 8 ). The results showed that the self-replicating mRNA lipid nanoparticles presented a uniform morphology under the transmission electron microscope, and the particle distribution was relatively consistent. Through the negative staining technique, the structural characteristics of the particles were clearly observed, indicating that their size and morphology met the expectations.

[0099] (b) Detection of particle size distribution

[0100] Dilute LNP-SAM-S 10,000 times with PBS, and detect its particle size through a nanoparticle size and zeta potential analyzer. The average particle size is 120.37 nm, and the aggregation index (Polydispersity Index, PDI) of LNP-SAM-S is 0.159 ( Figure 9 ).

[0101] Example 5 Immunogenicity study of LNP-SAM-S vaccine

[0102] (1) Experimental animals and grouping

[0103] Female BALB / c mice, 6 weeks old, weighing 18 - 20 g: Purchased from Spf (Suzhou) Biotechnology Co., Ltd. A total of 21 mice were divided into 4 groups, with 3 mice in each group.

[0104] The first group: PBS control group, each mouse was injected with 50 μL of PBS with pH = 7.2.

[0105] The second group: LNP-SAM-S vaccine group, each mouse was injected with 3 μg.

[0106] The third group: LNP-SAM-S vaccine group, each mouse was injected with 10 μg.

[0107] Group 4: LNP-SAM-S vaccine group, with 30 μg injected into each mouse.

[0108] (2) Immunization method

[0109] All immunizations were performed by injecting into the bilateral tibialis anterior muscles. Blood was collected from the orbital cavities of the mice in each group at regular intervals to detect the neutralizing antibody titer. The mice in each group were boost-immunized 14 days after the primary immunization, and the immunization dose was the same as that of the primary immunization in each group.

[0110] (3) Determination of neutralizing antibody titer

[0111] Before the neutralization experiment, the serum of the mice was inactivated in a 56 °C water bath for 30 minutes. The method of fixing the virus and diluting the serum was used for determination: the test sample was serially diluted 2-fold with serum-free DMEM medium, i.e., 1:8, 1:16, 1:32, …, 1:8192. 100 μL of each diluted test serum was taken and added to 100 μL of PEDV SD virus containing 100 TCID 50 . After thorough mixing, the reaction was carried out in a 37 °C 5% CO2 cell culture incubator for 1 hour and 30 minutes. Each reaction mixture was inoculated into 5 wells of Vero E6 cells. After inoculation, the number of cell wells with or without CPE in each group was recorded; the neutralizing antibody titer of the serum was calculated by the Reed-Muench method. The results showed that 14 days after the first immunization, the mice in the LNP-SAM-S immunized group showed a relatively high neutralizing antibody level; 14 days after the boost immunization, the serum neutralizing antibody level of the mice in the LNP-SAM-S immunized group was further increased ( Figure 10 ). The level of neutralizing antibody could reach 2 11 ~2 12 , and these neutralizing antibody levels were significantly higher than those of traditional mRNA vaccines, which were 2 8 -2 9 . The neutralizing antibody level was 4-8 times that of traditional mRNA vaccines. These results indicate that the self-replicating mRNA vaccine against PEDV can generate a high level of neutralizing antibodies, and the self-replicating mRNA design can promote a stronger and more persistent immune response. By designing the self-replicating mRNA vaccine (LNP-SAM-S), we effectively overcame multiple defects existing in traditional mRNA vaccines, significantly improved the level and speed of neutralizing antibody production, and enhanced the persistence of immune protection, providing an effective solution for preventing virus infections such as PEDV. These advantages make the self-replicating mRNA vaccine have important application prospects in dealing with the epidemic.

[0112] The above description of the embodiments is intended to enable those of ordinary skill in the art to understand and use the present invention. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative efforts. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

1. Use of porcine epidemic diarrhea virus self-replicating mRNA lipid nanoparticles in the preparation of a drug for treating or preventing diseases caused by PEDV infection, characterized in that: The preparation method of the self-replicating mRNA lipid nanoparticles is: The self-replicating mRNA lipid nanoparticles were prepared using an LNP encapsulation kit; the porcine epidemic diarrhea virus self-replicating mRNA obtained by in vitro transcription was diluted with a citric acid-sodium citrate solution with a pH of 4.0, the concentration of the diluted mRNA was 33.3 μg / mL, and the diluted mRNA and liposomes were mixed according to a proportion using an LNP microfluidic preparation instrument to prepare self-replicating mRNA lipid nanoparticles, wherein: The volume ratio of mRNA:total liposomes was 3:

1. The flow rate ratio of mRNA:total liposomes was 9 mL / min:3 mL / min, After the sample was collected, an equal volume of citric acid-sodium citrate solution with a pH of 4.0 was immediately added for dilution, and the sample was centrifuged to 1 / 4 of the original volume using a Millipore 30KDa ultrafiltration tube, and then 15 times the volume of PBS buffer was added to reduce the ethanol content to below 0.5%, and finally ultrafiltration and concentration was performed using a PBS buffer containing 10% sucrose; Among them, the porcine epidemic diarrhea virus self-replicating mRNA includes the optimized mRNA of the PEDV S protein gene, the amino acid sequence of the PEDVS protein is shown in SEQ ID NO.2, the sequence of the optimized PEDV S protein gene is shown in SEQ ID NO: 1, and the self-replicating mRNA also includes a 3'-UTR and a polyA sequence, and the nucleotide sequence of the 3'-UTR is: GAATTGGCAAGCTGCTTACATAGAACTCGCGGCGATTGGCATGCCGCCTTAAAATTTTTA TTTTATTTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC, the polyA sequence is AAAAAAAAAAAAAAAAAAAAAAAAAAA.

Citation Information

Patent Citations

  • RNA vaccine for porcine epidemic diarrhea and construction method thereof

    CN113274491A

  • Replication type mRNA vaccine and preparation method thereof

    CN116240223A

  • Porcine epidemic diarrhea virus S protein gene-based mRNA (messenger ribonucleic acid), application and vaccine

    CN118147173A