Molecular markers of aortic dissection and their applications

Abstract

The present invention discloses molecular markers for aortic dissection and applications thereof, and an application of a substance for detecting molecular markers for aortic dissection, characterized by comprising one or more of the following applications: 1) application in the preparation of products for diagnosing aortic dissection; 2) application in the preparation of products for screening aortic dissection; 3) application in the preparation of products for assessing the risk of aortic dissection; 4) application in the preparation of products for distinguishing aortic dissection from acute myocardial infarction; the molecular markers for aortic dissection include genes ADAMTS2 and KIF19, etc., which can be used as diagnostic markers for AD, and can also be used as one of the indicators for assessing the severity of the disease in AD patients, have good diagnostic efficacy, and can distinguish AD patients from AMI patients, so that patients can receive effective treatment.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and specifically relates to aortic dissection molecular markers and applications thereof. Background Art

[0002] Cardiovascular disease (CVD) is the leading cause of death in many countries, causing 16.7 million deaths each year. Aortic dissection (AD) is one of the most dangerous cardiovascular diseases. It is caused by rupture of the aortic intima due to various reasons. Blood enters the media and tears the aortic wall to form true and false lumens. AD can be divided into Stanford A and Stanford B according to the Stanford classification. Acute Stanford type A aortic dissection (ATAAD) is a critical emergency in clinical practice and has a high mortality rate. The mortality rate increases by about 1% per hour within 2 days after onset. The mortality rate of patients who have not received surgical treatment is as high as 74% within 2 weeks.

[0003] ATAAD patients usually present with severe chest and back pain at the onset of the disease. Similarly, patients with acute myocardial infarction (AMI) may also present with chest pain at the onset of the disease. The two are difficult to distinguish and can be easily misdiagnosed. Although ATAAD can be clearly diagnosed and differentiated from AMI by aortic enhanced CT, many hospitals perform emergency percutaneous coronary stenting to save time because ATAAD is relatively rare. Once acute myocardial infarction is misdiagnosed, preoperative antiplatelet therapy will lead to catastrophic consequences. At present, there is no blood test index that can specifically and sensitively diagnose ATAAD. For clinicians, it is a huge challenge to quickly distinguish between these two diseases in the emergency room, because both are very dangerous and have completely different treatment plans. Once misdiagnosed and given the wrong treatment plan, the consequences are often catastrophic. Therefore, it is particularly important to find markers that can sensitively and specifically diagnose ATAAD or predict the occurrence of ATAAD through simple and rapid blood tests.

[0004] With the completion of the human genome sequencing project and the development of high-throughput sequencing technology, researchers in the medical field have a deeper understanding of the human genome, and their understanding of disease-related genetic variations, the functions of related genes, and regulatory networks has gradually deepened, and high-throughput sequencing has been widely used. In recent years, more and more studies have found genes related to ATAAD through high-throughput sequencing, but most of the studies are based on RNA expressed in aortic tissue. Since obtaining aortic tissue is very traumatic to the human body and difficult to apply in clinical practice, it may not be appropriate to use differentially expressed RNA in aortic tissue as a biomarker for AD.

[0005] ATAAD has high disability and mortality rates and is not easy to detect early. Although aortic enhanced CT is the gold standard for diagnosing ATAAD, it is expensive and time-consuming for patients, and many primary hospitals do not have the conditions to complete this examination. Aortic tissue is difficult to obtain, and it is difficult to use differentially expressed RNA as a biomarker. Therefore, differentially expressed RNA screened from peripheral blood can be more conveniently used as a biomarker for ATAAD in clinical practice. Summary of the invention

[0006] Technical problems solved: In response to the above technical problems, the present invention provides molecular markers for aortic dissection and applications thereof, which can effectively solve the shortcomings of existing methods in that the detection time for type A aortic dissection is long and it is difficult to distinguish it from acute myocardial infarction.

[0007] Technical solution: In the first aspect, the present invention provides an application of a substance for detecting molecular markers of aortic dissection, including one or more of the following applications:

[0008] 1) Application in the preparation of products for diagnosing aortic dissection;

[0009] 2) Application in the preparation of products for screening aortic dissection;

[0010] 3) Use in the preparation of products for assessing the risk of aortic dissection;

[0011] 4) Application in the preparation of products for distinguishing aortic dissection from acute myocardial infarction;

[0012] The molecular markers of aortic dissection include gene ADAMTS2 (Gene ID: 9509) and gene KIF19 (Gene ID: 124602).

[0013] Preferably, the aortic dissection molecular marker also includes gene OLAH (Gene ID: 55301).

[0014] Furthermore, the aortic dissection molecular marker also includes the gene FXYD2 (Gene ID: 486).

[0015] Furthermore, the aortic dissection molecular markers also include the gene MCEMP1 (gene ID: 199675).

[0016] Preferably, the substance is a reagent for detecting the expression of aortic dissection molecular markers, or a reagent for specifically identifying aortic dissection molecular markers, or a reagent for detecting the content of aortic dissection molecular markers.

[0017] Preferably, the substance is a substance for detecting aortic dissection molecular markers and is one of the following a), b) or c):

[0018] a) Primers for detecting the expression of molecular markers of aortic dissection; or primers for specifically identifying molecular markers of aortic dissection;

[0019] b) a reagent set containing the reagent described in a);

[0020] c) A kit containing a) or b).

[0021] Further, the primers include upstream primers and downstream primers for amplifying the ADAMTS2 gene, whose nucleotide sequences are shown in SEQ ID No.1-SEQ ID No.2; upstream primers and downstream primers for amplifying the KIF19 gene, whose nucleotide sequences are shown in SEQ ID No.3-SEQ ID No.4; upstream primers and downstream primers for amplifying the OLAH gene, whose nucleotide sequences are shown in SEQ ID No.5-SEQ ID No.6; upstream primers and downstream primers for amplifying the FXYD2 gene, whose nucleotide sequences are shown in SEQ ID No.7-SEQ ID No.8; upstream primers and downstream primers for amplifying the MCEMP1 gene, whose nucleotide sequences are shown in SEQ ID No.9-SEQ ID No.10:

[0022] SEQ ID No.1: TCACGCCATCTTCCTCACAC;

[0023] SEQ ID No.2:AAGCCGTCCTCATGGTTCAG;

[0024] SEQ ID No.3: GGAGATGGTGTATCAGGCCAC;

[0025] SEQ ID No.4: CGTTGAGGGTCTGAACATAGATG;

[0026] SEQ ID No.5: CCTGGCATCGCATTCCCAA;

[0027] SEQ ID No.6: GGTACGTTAGAGGTGCAACTTC;

[0028] SEQ ID No.7:CGTGGACCCGTTCTACTATGACTA;

[0029] SEQ ID No.8: GCGCTTCTTATTGCCCCCAC;

[0030] SEQ ID No.9:GGGGGTCTCAGCCAAGAATC;

[0031] SEQ ID No. 10: GGTCGTGAATGACCACCCTT.

[0032] Beneficial effects: 1) The genes ADAMTS2, KIF19, OLAH, FXYD2 and MCEMP1 protected by the present invention constitute different gene groups and can be used as biomarkers for AD;

[0033] 2) The genes ADAMTS2, KIF19, OLAH, FXYD2 and MCEMP1 protected by the present invention constitute different gene groups and can be used as one of the indicators for evaluating the severity of AD patients;

[0034] 3) The genes ADAMTS2, KIF19, OLAH, FXYD2 and MCEMP1 protected by the present invention constitute different gene groups and have good potential for diagnosing AD patients as markers, and have good diagnostic efficacy, which can distinguish AD patients from AMI patients and enable patients to receive effective treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The volcano plot (A) and cluster heat map (B) of differentially expressed genes, where L represents the dissection case group and HC represents the normal control group;

[0036] Figure 2 The qPCR results are specifically verified for the mRNA expression levels of each gene between the aortic dissection and acute myocardial infarction case groups and the normal control group in the present invention, where CON: normal control group (n=64); AMI: acute myocardial infarction case group; ATAAD: aortic dissection case group (n=64), *: P<0.05; **: P<0.01; ***: P<0.001; ns: no statistically significant difference;

[0037] Figure 3 is the restricted cubic spline regression analysis curve of the correlation between the mRNA expression of specific genes and ATAAD;

[0038] Figure 4 The ROC curve diagram of the molecular markers of different gene combinations of the present invention for diagnosing aortic dissection;

[0039] Figure 5 The figure is a ROC curve diagram of molecular markers of different gene combinations of the present invention for distinguishing aortic dissection from acute myocardial infarction. DETAILED DESCRIPTION

[0040] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments: Example 1

[0041] First, high-throughput transcriptome sequencing was performed on 8 ATAAD cases and 20 normal controls to screen the differentially expressed gene mRNAs in ATAAD cases. Twenty up-regulated and down-regulated genes with the most significant differential expression in the sequencing results were screened and included in the validation work. Then, a three-group case-control study design was adopted. In the first stage, 84 pairs of ATAAD case and control samples were used for validation, and the gene mRNAs with validation results consistent with the sequencing direction and statistically significant were included in the second stage validation; in the second stage, 94 pairs of ATAAD case and control samples were used for validation, and the gene mRNAs with validation results consistent with the sequencing direction and statistically significant were included in the specific validation. The specific validation used 64 AMI and 64 controls, and the gene mRNAs with differential expression between the ATAAD and AMI case groups were used as the specific gene mRNAs of ATAAD. The expression levels of the mRNAs of the genes to be validated were detected by real-time fluorescence quantitative PCR (qRT-PCR). Finally, the relative quantitative method 2-ΔΔCT was used to calculate the mRNA expression. Mann-Whitney U test was used to compare the differences in gene expression between the case group and the control group. Restricted cubic spline (RCS) was used to explore the dose-response relationship between gene mRNA expression level and ATAAD; the receiver operating characteristic curve (ROC curve) was used to evaluate the discriminative ability of specific gene mRNA for ATAAD and normal people and ATAAD and AMI, and its sensitivity, specificity and area under the ROC curve (Area Under Curve, AUC) were analyzed, and different models were constructed to analyze its discriminative value for the onset of ATAAD. The specific data are as follows:

[0042] Association between specific mRNA expression and acute Stanford type A aortic dissection: a case-control study.

[0043] 1. Clinical samples:

[0044] Peripheral blood was collected from 178 patients who were hospitalized in the Department of Cardiovascular Surgery of Nanjing First Hospital from 2019 to 2022 with a primary diagnosis of AD. 1.5 mL of peripheral blood was collected using an EDTA anticoagulant tube, and 4.5 mL of whole blood RNA preservation solution (Nanjing Yi Ning Fu Sheng Biotechnology Co., Ltd.) was added and mixed thoroughly, and then stored in a -20°C refrigerator for RNA extraction. Inclusion criteria:

[0045] Inclusion criteria for ATAAD cases: ① Han Chinese aged 18-85 years; ② ATAAD patients diagnosed by full-length enhanced aortic scan and confirmed during surgery. Exclusion criteria for cases: ① Cardiovascular diseases caused by genetic diseases or hereditary cardiovascular diseases such as Marfan syndrome, Ehlers-Danlos syndrome, familial thoracic aortic aneurysm, dissection caused by trauma, etc.; ② Patients proven to be non-ATAAD during surgery; ③ Patients with malignant tumors; ④ Patients who are considered by the researchers to have other conditions that are not suitable for inclusion in this study.

[0046] Inclusion criteria for AMI cases: ① Han people aged 18-85 years; ② patients hospitalized with AMI in Nanjing First Hospital, the diagnosis of acute myocardial infarction (type I myocardial infarction) adopts the fourth edition of the "Global Definition of Myocardial Infarction" standard, that is, acute myocardial injury [serum cardiac troponin (cTn) increases and / or decreases, and at least once exceeds the upper limit of normal (99th percentile of the upper limit of the reference value)], and there is clinical evidence of acute myocardial ischemia, including: I. Symptoms of acute myocardial ischemia; II. New ischemic electrocardiogram changes; III. New pathological Q waves; IV. New imaging evidence of viable myocardial loss or ventricular wall segmental motion abnormalities; V. Coronary angiography or intracavitary imaging examination. Case exclusion criteria: ① Taking antiplatelet drugs and lipid-lowering drugs within the past 2 weeks; ② Severe liver and kidney dysfunction (ALT>5 times ULN, eGFR<30mL / min / 1.73mm 2 ); ③ Patients with malignant tumors; ④ Known bleeding disorders or active bleeding; ⑤ Patients participating in other interventional clinical trials.

[0047] The present invention is in collaboration with the School of Public Health of Nanjing Medical University, and the control source is the prospective cohort study population conducted in Jurong City, Jiangsu Province from 2018 to 2019.

[0048] Control inclusion criteria: Individuals were matched 1:1 with ATAAD and AMI cases in terms of age (±2 years) and gender.

[0049] Control exclusion criteria: patients with severe heart, brain, lung, kidney diseases and tumors.

[0050] 2. Experimental methods:

[0051] 2.1 RNA extraction:

[0052] The total RNA of peripheral blood was extracted by magnetic bead method (Cat#Yu-BR02-1, Wuxi Yu'an Biotechnology Co., Ltd., China), and the specific steps were as follows:

[0053] (1) Sample processing: Thaw the frozen sample at room temperature, mix by inverting, add 800 μL of the sample to a 1.5 mL centrifuge tube, then add 600 μL of isopropanol, mix by inverting. Centrifuge at 7230 rpm at 4°C for 10 min;

[0054] (2) Discard the supernatant, retain the precipitate, and add 400 μL of lysis adsorption solution, 10 μL of RNA protectant, and 10 μL of mixed magnetic beads. Close the lid, place the centrifuge tube on a shaker and shake for 10 minutes, remove the centrifuge tube, and centrifuge it instantly;

[0055] (3) Place the centrifuge tube on a magnetic rack, let it stand for 2 min, open the lid, aspirate the liquid with a pipette and discard it, retaining the magnetic beads;

[0056] (4) Add 600 μL of Buffer AW1, close the lid, and place the centrifuge tube on a shaker for 1 min;

[0057] (5) Place the centrifuge tube on the magnetic rack. After standing for 1 minute, quickly invert the magnetic rack upside down to fully recover the magnetic beads on the centrifuge tube cover. Stand for another 1 minute. Open the cover, aspirate the liquid with a pipette and discard it, retaining the magnetic beads;

[0058] (6) Add 600 μL of 80% DEPC ethanol, close the lid, and place the centrifuge tube on a shaker for 1 min;

[0059] (7) Place the centrifuge tube on the magnetic rack. After standing for 1 minute, quickly invert the magnetic rack upside down to fully recover the magnetic beads on the centrifuge tube cover. Let stand for another 1 minute. Open the cover, aspirate the liquid with a pipette and discard it, retaining the magnetic beads;

[0060] (8) Repeat steps (6)-(7);

[0061] (9) Place the centrifuge tube on a foam board, put it into a 50°C constant temperature water bath, and dry it for 2 min;

[0062] (10) Take back the centrifuge tube, add 50 μL of eluent A, blow the magnetic beads thoroughly to disperse them into the eluent, close the lid, place the centrifuge tube on a foam plate, and place it in a 52°C constant temperature water bath for 2 min;

[0063] (11) Place the centrifuge tube on a magnetic rack and let it stand for 2 min until the liquid becomes clear. Open the lid and use a pipette to transfer the liquid to another new centrifuge tube and discard the magnetic beads.

[0064] (12) RNA concentration and purity were detected by ultraviolet spectrophotometry (nucleic acid protein analyzer Thermo Nano Drop 2000). RNA purity was qualified when the OD value (260 / 280) was between 1.8 and 2.0.

[0065] 2.2 RNA reverse transcription to cDNA

[0066] cDNA was synthesized using the TAKARA reverse transcription kit (RR047A Takara PrimeScript™RT reagent Kitwith gDNA Eraser, Japan). The specific steps are as follows:

[0067] (1) Based on the measured concentrations, balance the RNA of samples with different concentrations to four fixed values: 10 ng / μL, 30 ng / μL, 50 ng / μL, and 100 ng / μL. Calculate the volume of eluent A to be added based on the concentrations;

[0068] (2) Add 2 μL of reverse transcription system 1 to a 200 μL centrifuge tube;

[0069] (3) Add RNA sample to the centrifuge tube (volume calculated based on concentration), centrifuge, and place in a 42°C water bath for 2 min;

[0070] (4) Add 10 μL reverse transcription system 2 and centrifuge;

[0071] (5) PCR amplification, the program was set at 37°C for 15 min, 85°C for 5 s, and 15°C infinity;

[0072] (6) After reverse transcription, store in a -80°C refrigerator for subsequent experiments.

[0073] 2.3 qRT-PCR

[0074] Design the mRNA primer sequences according to the mRNA primer design principles;

[0075] The relative quantitative detection of mRNA was completed by qPCR, using the SYBR Green method. The experiment used a 384-well plate, with 3 parallel wells set for each sample, and GAPDH was used as the internal reference gene. The first-stage detection was completed using the ABIQuantStudio7 fluorescence quantitative PCR system, and the second-stage and specificity verification were completed using the Fusheng FS384 real-time fluorescence quantitative PCR instrument. The standard deviation of the CT value between each sample well was less than 0.5, and the final reading was the average of the three wells;

[0076] The system used 1.5 μL of cDNA sample, 1.3 μL of RNase-free H2O, 2.8 μL of SYBR Green Master Mix, and 0.2 μL each of forward and reverse primers, for a total of 6 μL system;

[0077] The qPCR program was set as follows: ① pre-denaturation: 95℃, 5min; ② denaturation: 95℃, 10s; ③ annealing: 57℃, 20s; ④ extension: 72℃, 20s; ⑤ melting curve: instrument default setting. Steps ② to ④ were cycled 40 times in sequence, and the remaining steps were performed only once.

[0078] 2.4 Calculation method of mRNA expression

[0079] The relative quantitative method (2-ΔΔCT) was used to calculate the expression level of each mRNA. The specific method is as follows:

[0080] (1) ΔCT = CT value of target gene - CT value of reference gene;

[0081] (2) Batch coefficient fn = average ΔCT of the control group in each batch / average ΔCT of the total control;

[0082] (3) ΔCT core = ΔCT / fn;

[0083] (4) ΔΔCT nuclear = ΔCT nuclear - average ΔCT of total control;

[0084] (5) mRNA expression level = 2 (-ΔΔCT nuclei).

[0085] 2.5 Data collation and statistical analysis

[0086] All experimental data were collated and checked for consistency by two people independently. The expression of each gene mRNA was calculated by relative quantification method, and the extreme value was corrected by the mean of ΔCT value plus or minus three standard deviations before analysis. The difference of each mRNA expression level between the case group and the control group was compared by Mann-Whitney U test. Restricted cubic spline (RCS) was used to analyze the dose-response relationship between mRNA expression level and ATAAD. ROC (receiveroperating characteristic) curve was drawn to analyze the discriminative ability of specific mRNA for ATAAD and normal population and ATAAD and AMI, and its sensitivity, specificity and area under curve (AUC) were obtained. The above analyses were performed using SPSS 24 or R 4.2.2 statistical software. The statistical analysis results were considered statistically significant when bilateral P < 0.05.

[0087] 3. Experimental results:

[0088] like Figure 1As shown: RNA-Seq detected a total of 19548 mRNAs, of which 3634 were significantly dysregulated (Padj < 0.05, |log2FC| > 1). Compared with the normal control group, 1923 mRNAs were significantly upregulated and 1711 mRNAs were significantly downregulated in the ATAAD group. Volcano plot ( Figure 1 A) and heatmap ( Figure 1 B) shows the expression profiles of mRNAs between ATAAD and normal control.

[0089] like Figure 2 As shown: Compared with the control group, the ADAMTS2, OLAH and KIF19 gene mRNAs in the AMI case group were differentially up-regulated (P<0.05); compared with the AMI case group, the ADAMTS2, OLAH and MCEMP1 gene mRNAs in the ATAAD case group were differentially up-regulated (P<0.05), and the FXYD2 and KIF19 gene mRNAs were differentially down-regulated (P<0.05); compared with the control group, the mRNAs of each gene in the ATAAD case group were differentially expressed.

[0090] like Figure 3 As shown: the up-regulated gene mRNA generally showed that the risk of ATAAD increased with the increase of expression, among which the risk of ATAAD increased with the increase of ADAMTS2 expression level; the initial risk of OLAH and MCEMP1 increased with the increase of expression level, and then decreased slightly with the increase of expression level, but the risk was still much higher than the low expression level; the down-regulated gene mRNA generally showed that the risk of ATAAD decreased with the increase of expression, among which the risk of FXYD2 decreased with the increase of expression level, and finally the OR tended to 1; the risk of KIF19 first decreased with the increase of expression level, then increased slightly with the increase of expression level, and finally showed a harmful effect (OR>1).

[0091] like Figure 4 As shown: the AUC value of gene ADAMTS2 and gene KIF19 is >0.88, the AUC value of gene ADAMTS2, gene KIF19 and gene OLAH is >0.94, the AUC value of gene ADAMTS2, gene KIF19, gene OLAH and gene FXYD2 is >0.97, and the AUC value of gene ADAMTS2, gene KIF19, gene OLAH, gene FXYD2 and gene MCEMP1 is >0.98, indicating that the above gene combination has good potential for diagnosing AD and has good diagnostic efficacy, and the larger the ACU value, the greater the diagnostic efficiency of the corresponding gene combination.

[0092] like Figure 5As shown: the AUC value of gene ADAMTS2 and gene KIF19 is > 0.95, the AUC value of gene ADAMTS2, gene KIF19 and gene OLAH is > 0.97, the AUC value of gene ADAMTS2, gene KIF19, gene OLAH and gene FXYD2 is > 0.97, and the AUC value of gene ADAMTS2, gene KIF19, gene OLAH, gene FXYD2 and gene MCEMP1 is > 0.98, indicating that the above gene combination has good potential for distinguishing aortic dissection from acute myocardial infarction, and the larger the AUC value, the greater the discrimination ability of the corresponding gene combination.

[0093] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An application of a substance for detecting aortic dissection molecular markers, characterized in that: Includes one or more of the following applications: 1) Application in the preparation of products for diagnosing aortic dissection; 2) Application in the preparation of products for screening aortic dissection; 3) Use in the preparation of products for assessing the risk of aortic dissection; 4) Application in the preparation of products for distinguishing aortic dissection from acute myocardial infarction; The test sample is the whole blood RNA of the peripheral blood of the test sample, and the substance is a primer for detecting the expression of aortic dissection molecular markers. The aortic dissection molecular markers include gene ADAMTS2 and gene KIF19. The risk of ATAAD increases with the increase of ADAMTS2 expression level, and the risk of ATAAD decreases with the increase of KIF19 gene expression.

2. The use according to claim 1, characterized in that: The molecular markers of aortic dissection also include the gene OLAH. The risk of ATAAD initially increases with the increase of OLAH expression level, and then the risk of ATAAD slightly decreases with the increase of OLAH expression level, but the risk of ATAAD is still much higher than that at low expression levels.

3. The use according to claim 2, characterized in that: The aortic dissection molecular markers also include the gene FXYD2. The risk of ATAAD decreases as the expression level of FXYD2 increases.

4. The use according to claim 3, characterized in that: The aortic dissection molecular markers also include the gene MCEMP1. The risk of ATAAD initially increases with the increase of MCEMP1 expression level, and then the risk of ATAAD slightly decreases with the increase of MCEMP1 expression level, but the risk of ATAAD is still much higher than that at low expression levels.

5. The use according to claim 4, characterized in that: The primers used to detect the expression amount of molecular markers of aortic dissection include upstream primers and downstream primers for amplifying the gene ADAMTS2, and their nucleotide sequences are shown in SEQ ID No.1-SEQID No.2; upstream primers and downstream primers for amplifying the gene KIF19, and their nucleotide sequences are shown in SEQ ID No.3-SEQID No.4; upstream primers and downstream primers for amplifying the gene OLAH, and their nucleotide sequences are shown in SEQ ID No.5-SEQ IDNo.6; upstream primers and downstream primers for amplifying the gene FXYD2, and their nucleotide sequences are shown in SEQ ID No.7-SEQ IDNo.8; upstream primers and downstream primers for amplifying the gene MCEMP1, and their nucleotide sequences are shown in SEQ ID No.9-SEQ IDNo.10.

Images