A freshwater pond mud methane-oxidizing bacterium and its application

Abstract

The present invention belongs to the field of microorganisms, and discloses freshwater pond sediment methane oxidizing bacteria and applications thereof. The freshwater pond sediment methane oxidizing bacteria SC-6 described in the present invention can oxidize methane into formaldehyde and formic acid, thereby converting methane into organic carbon. Methane oxidizing bacteria can be prepared into biological preparations or added to fish feed to reduce the emission flux of CH4 in ponds. It is screened in NMS liquid culture medium, and shows outstanding ability to oxidize CH4 in the determination of the ability of strain methane oxidation, and the breeding pond environment meets the growth conditions of SC-6. After adding freshwater pond sediment methane oxidizing bacteria SC-6 to the 30cm sediment treatment, observations were carried out for seven consecutive days, and the CH4 emission flux of the pond was reduced by 40%. After adding SC-6 to the 10cm sediment treatment, observations were carried out for seven consecutive days, and the CH4 emission flux of the pond was reduced by 70.8%.

Description

Technical Field

[0001] The invention relates to a freshwater pond bottom mud methane oxidizing bacterium and application thereof, belonging to the technical field of microorganisms. Background Art

[0002] The booming aquaculture industry in my country has also brought with it serious environmental problems. Pond aquaculture, the primary freshwater aquaculture method in my country, requires large amounts of feed, resulting in significant greenhouse gas emissions from ponds. However, there are currently few solutions to address greenhouse gas emissions from aquaculture, necessitating a green and pollution-free approach. To mitigate CH4 emissions from ponds, the addition of methanotrophic bacteria reduces CH4 emissions at the water-air interface by oxidizing some of the CH4 at the pond sediment-water interface. This research provides a theoretical basis and technical support for CH4 emission reduction in pond aquaculture in Jiangsu Province. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to overcome the defects of the prior art and provide a strain with the ability to efficiently oxidize methane and its application. The addition of methane-oxidizing bacteria oxidizes part of the CH4 at the pond sediment-water interface, thereby reducing the emission of CH4 at the water-air interface and reducing the emission of CH4 generated in the pond sediment into the atmosphere.

[0004] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0005] A freshwater pond sediment methane-oxidizing bacterium, which was deposited in the General Microbiology Center of the China Culture Collection Administration on January 31, 2024, with the deposit number CGMCC NO. 29827 and the taxonomic name Bacillus velezinis Bacillus velezensis , the place of preservation is Beijing.

[0006] The strain is suitable for growing at an environmental temperature of 15-30° C. and an environmental pH of 5-8.

[0007] The present invention also provides a CH4 oxidizing bacterial agent, which contains the above-mentioned freshwater pond sediment methane oxidizing bacteria.

[0008] The present invention also provides a method for preparing the above-mentioned CH4 oxidizing bacterial agent, which comprises mixing the above-mentioned freshwater pond bottom mud methane oxidizing bacterial liquid or concentrated liquid with attapulgite to obtain the CH4 oxidizing bacterial agent.

[0009] Furthermore, the CH4 oxidizing bacterial agent contains 10 billion to 10 billion bacteria per gram.

[0010] Furthermore, the preparation method of the CH4 oxidizing bacterial agent comprises the following steps:

[0011] (1) The SC-6 strain was inoculated into LB liquid culture medium and cultured in a constant temperature shaking incubator at a temperature of 30°C and a rotation speed of 180 r / min for 48 h to prepare 10 L of bacterial liquid.

[0012] (2) 10 L of bacterial solution was centrifuged, and the concentrated solution obtained after centrifugation was fixed with 500 g of 400-mesh attapulgite to obtain a CH4 oxidizing bacterial agent prepared from the SC-6 strain.

[0013] Furthermore, the preparation method of the freshwater pond sediment methane-oxidizing bacteria liquid includes: inoculating the above-mentioned freshwater pond sediment methane-oxidizing bacteria into LB liquid culture medium, and culturing in a constant temperature shaking incubator at a temperature of 15-30°C and a rotation speed of 150-200 r / min for 40-50 hours.

[0014] The present invention also provides application of the CH4 oxidizing bacteria agent in aquaculture.

[0015] Furthermore, the CH4 oxidizing bacteria agent is used to oxidize CH4 gas at the mud-water interface of the aquaculture pond.

[0016] Furthermore, the above-mentioned CH4 oxidizing bacteria agent is put into the bottom mud of the freshwater aquaculture pond.

[0017] Furthermore, the temperature is 15-30°C.

[0018] Furthermore, the pH is 5-8. Beneficial effects

[0019] The SC-6 strain screened by the present invention is suitable for and can grow in an aquaculture pond environment (15-30°C, pH 5-8). After the bacterial liquid is fixed, it is put into the pond, which can reduce about 40-70.8% of CH4 emissions into the atmosphere. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is the methane oxidation rate of different methane-oxidizing strains;

[0021] Figure 2 The effect of different temperatures on the growth of methane oxidizing bacteria;

[0022] Figure 3 The effect of different pH on the growth of methane oxidizing bacteria;

[0023] Figure 4 The effect of different nutrient concentrations on the growth of methanotrophic bacteria;

[0024] Figure 5 This is a photo of the bacteria of strain SC-6;

[0025] Figure 6 is the phylogenetic tree of the 16S rRNA gene of strain SC-6;

[0026] Figure 7 This is the CH4 emission flux fluctuation diagram after inoculation with SC-6 strain;

[0027] Figure 8 Box plot of CH4 emission flux under different treatments. DETAILED DESCRIPTION

[0028] The present invention will be further described below. The following examples are only used to more clearly illustrate the technical solution of the present invention and are not intended to limit the scope of protection of the present invention.

[0029] Biomaterial sample preservation:

[0030] Bacillus velezensis, SC-6 has been deposited in the General Microbiology Center of the China Culture Collection Administration, with the deposit address being the Culture Collection Center of the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit number of SC-6 is CGMCC NO. 29827, and the deposit date is January 31, 2024.

[0031] The specific screening method of strain SC-6 is as follows:

[0032] Initial screening of methane-oxidizing bacteria:

[0033] 1. Enrichment of methane-oxidizing bacteria:

[0034] To enrich the supernatant of pond sediment samples, weigh 5 g of each of three mixed samples and place them in a 250 mL Erlenmeyer flask. Add 100 mL of sterile water to the flask and add glass beads to a total of 105 g of mixed sample. Mix the sample in a shaker at 30°C and 170 rpm for 2 hours. Remove the sample, let it rest for half an hour, and then filter to obtain the sample supernatant.

[0035] Inoculate the supernatant for enrichment: After preparing and sterilizing NMS medium, add 20 mL of the filtered supernatant to a culture flask containing 100 mL of NMS liquid medium. Add 25 μL of methanol to the flask every 24 hours, using methanol as the sole carbon source. (All experimental steps are performed in a clean hood.) Incubate the culture in a shaker at 30°C and 170 rpm. Observe the culture every 24 hours until a distinct pink color develops. Inoculate 2 mL of the turbid pink culture into a fresh 100 mL of NMS liquid medium and continue incubating with methanol. Repeat this cycle three times until the culture is purified.

[0036] 2. Isolation and purification of methane-oxidizing bacteria:

[0037] From the final transfer liquid culture, aspirate 1 mL of enriched bacterial suspension and isolate the target strain using a gradient dilution method. Take 100 μL of each dilution from 10⁻¹ to 10⁻¹ and spread the suspension onto NMS solid culture medium using the dilution spread plate method. Place sterile filter paper on the plate lid and add 200 μL of methanol onto the filter paper. Invert the culture medium and incubate in a constant temperature incubator. Observe and record the growth of the strains on the plates daily.

[0038] Colonies grown on NMS solid medium were purified again. Single colonies of different colors and morphologies were streaked onto NMS solid medium. This process was repeated three or more times to obtain single colonies of methanotrophic bacteria and number them. The purified strains were stored on slants at 4°C and in glycerol at -80°C for later use.

[0039] (2) Rescreening of methane-oxidizing bacteria:

[0040] 1. Determination of methane oxidation capacity:

[0041] The six methane-oxidizing strains screened from the NMS liquid culture medium were inoculated from the solid culture medium into the NMS liquid culture medium, cultured at a constant temperature of 28°C, and 1 ml of the single colony liquid was pipetted into a culture bottle containing 40 ml of culture medium. The air in the conical flask was extracted with a syringe, and methane gas was injected. The initial concentration of methane in the bottle was detected by gas chromatograph. The bottle was sealed with a sealing film and placed in a constant temperature shaker for culture. The conditions were set at 30°C and 120 r / min. After 10 days of constant temperature culture, the methane concentration in the culture bottle was detected, and a blank group was set for control. The experimental results are as follows. Figure 1 As shown, the methane oxidation rate of SC-6 was 40%, and SC-1, SC-2, SC-3, SC-4, and SC-6 with methane oxidation rates greater than 15% were selected as efficient methane oxidation strains, and the strain growth environment adaptability was further determined.

[0042] 2. Determination of strain adaptability to pond environment:

[0043] The environmental adaptability of efficient methane-oxidizing strains with a methane oxidation capacity greater than 15% was determined. The strains were streaked on a plate, and after culturing for 24 hours, the bacterial film was picked out and transferred to a conical flask containing 50 ml of LB liquid culture medium for cultivation. It was placed in a shaker at 30°C and 170 r / min for constant temperature culture to obtain a bacterial suspension. According to the inoculation amount of 10%, it was inoculated into 100 ml of LB liquid culture medium. The shaker speed was set at 170 r / min, and the temperature was set to 10°C, 20°C, 30°C, 40°C, and 50°C respectively. After 24 hours of sealed culture in the shaker, the OD600 value was measured to show the growth of the methane-oxidizing strain. The results are shown in the figure. Figure 2 As shown in the figure, at 20°C, SC-1, SC-2, SC-3, and SC-6 grew rapidly. At 30°C and 40°C, all five strains grew well. However, at 10°C and 50°C, the five strains grew slowly. This is likely due to the fact that the extremely high and low temperatures oxidize the enzyme activity within the strains, significantly affecting their growth. Therefore, considering that the water temperature in aquaculture ponds generally ranges from 15°C to 30°C, four strains were selected that are well adapted to pond water temperatures: SC-1, SC-2, SC-3, and SC-6.

[0044] 3. Prepare 0.05% dilute sulfuric acid solution and 1% sodium hydroxide solution, adjust the pH of LB liquid medium to 5, 6, 7, 8, and 9 respectively, inoculate 10% of the solution into 100 mL LB liquid medium, and culture in a sealed shaker at 30°C and 170 rpm for 24 hours. Measure the OD600 value to show the growth of the methane-oxidizing strain. Figure 3 As shown, at a pH of 5, SC-1 exhibited the lowest growth, while SC-6 exhibited the highest growth. At pH 6 and 7, all five strains showed good growth, with SC-6 being the most effective. At pH 8 or above, the growth of the methane-oxidizing strains decreased. Measurements of the pH values ​​in the aquaculture ponds in the study area showed that all five strains were capable of growth in pond environments.

[0045] 4. Select four conical flasks with a capacity of 500mL, add 50mL, 100mL, 200mL, and 500mL of sterile water respectively, and drop 0.1mL of the suspension of the university methane-oxidizing strain into each of the four conical flasks, which is equivalent to diluting its nutrients by 500, 1000, 2000, and 5000 times respectively. After 24 hours of sealed culture in a shaker at 30°C and 170r / min, the OD600 value was measured to show the growth of the methane-oxidizing strain. After centrifugation and fixation, 10L of the bacterial agent was put into two treatment tubes, which was diluted by about 200-300 times on average. Considering that there is a slow exchange of water in the treatment tube and the water in the pond, it is considered that the strain has a stronger growth ability when the dilution multiple is 500-1000 times. The results are as follows Figure 4 As shown, the five strains showed some differences under the four different nutrient conditions. At a dilution factor of 500, SC-4 had the lowest growth, while SC-6 had the highest. At a dilution factor of 1000, SC-6 had the highest growth, while SC-4 had the lowest. At dilution factors of 2000 and 5000, all five strains showed low growth. Therefore, we selected SC-3 and SC-6 as strains that grew best under these nutrient concentrations.

[0046] Sequencing results of strain SC-6

[0047] The colony morphology of SC-6 is milky white, round, moist, and has irregular edges. Figure 5 The 16S rRNA of the methane-oxidizing strain was then identified using PCR amplification using universal bacterial primers 27F and 1492R. After obtaining the sequence, it was compared on the NCBI and EzTaxon websites, and the evolutionary tree was drawn using MEGA10 software. The results are shown in the figure below. Figure 6 The identification results showed that strain SC-6 was Bacillus velezensis.

[0048] The strain sequence is:

[0049]

[0050] The primer sequences are:

[0051] 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 2).

[0052] 1492R: TACGGYTACCTTGTTACGACTT (SEQ ID NO: 3).

[0053] The validation test was carried out in situ in the aquaculture pond:

[0054] Before adding the SC-6 strain, the SC-6 needs to be fixed. Centrifuge 10L of bacterial solution and immobilize the resulting bacteria with 500g of 400-mesh attapulgite soil to create a CH4 oxidizing agent prepared from the SC-6 strain. This CH4 oxidizing agent is then released into the aquaculture pond. The treatment setup is as follows:

[0055] Treatment 1: Add SC-6 CH4 oxidizing bacteria agent at a sediment thickness of 30 cm, and use the 30 cm sediment treatment as a control.

[0056] Treatment 2: The methane-oxidizing strain SC-6 was added to the dredging treatment (sediment thickness 10 cm) to verify the combined emission reduction effect of sediment dredging and the addition of methane-oxidizing bacteria. The dredging alone (sediment thickness 10 cm) treatment was used as a control.

[0057] After adding CH4 oxidizing bacteria prepared by SC-6, the CH4 emission flux of the pond was observed for 7 consecutive days. The CH4 emission flux results are shown in the figure below. Figure 7 As shown:

[0058] When methanotrophic bacteria were not inoculated, the CH4 emission flux in the 30 cm+CK treatment was 0.54 mg m -2 h -1 After 24 h of inoculation with methanotrophic bacteria, the CH4 emission flux of the 30 cm+SC-6 treatment was 0.32 mg m -2 h -1 48 hours after inoculation, the CH4 emission flux of 30 cm+SC-6 treatment was 0.41 mg m -2 h -1 After 7 consecutive days of observation, it was found that the average CH4 emission flux of the 30 cm+SC-6 treatment was 0.15 mg m-3 lower than that of the 30 cm+CK treatment. -2 h -1 .

[0059] In order to explore the combined effect of dredging and adding methanotrophic bacteria on CH4 emission reduction, we observed the CH4 emission flux after inoculating the strain SC-6 at the dredging treatment (10 cm of bottom mud) and found that ( Figure 7 ), when not inoculated with methanotrophic bacteria, the CH4 emission flux of the 10 cm+CK treatment was 0.37 mg m -2 h -1 24 h after inoculation with methanotrophic bacteria, the CH4 emission flux of the 10 cm+CK treatment tube was 0.30 mg m -2 h -1 The CH4 emission flux was measured to be 0.29 mg m in the 10 cm+SC-6 treatment. -2 h -1 48 h after inoculation, the CH4 emission flux in the 10 cm+CK treatment was 0.45 mg m -2 h -1 The CH4 emission flux in the 10 cm+SC-6 treatment was 0.33 mg m -2 h -1 After 7 consecutive days of observation, it was found that the average CH4 emission flux of the 10 cm+SC-6 treatment was 0.065 mg m-3 lower than that of the 10 cm+CK treatment. -2 h -1 .

[0060] like Figure 8 As shown, if methane-oxidizing bacteria prepared with SC-6 are regularly inoculated into aquaculture ponds, compared to a 30cm sediment depth, desilting to 30cm and then inoculating with SC-6 reduces CH4 emissions by 40%. Desilting to 10cm and then inoculating with SC-6 reduces CH4 emissions by 70.8%. Based on IPCC accounting rules, greenhouse gas emissions from freshwater aquaculture ponds in Jiangsu Province were calculated. The pond aquaculture area in Jiangsu Province is 310,605 hectares. Based on these research results, it can be inferred that if methane-oxidizing bacteria emission reduction technology is applied to aquaculture ponds in Jiangsu Province, CH4 emissions could be reduced by 5.07 Gg (141.96 Gg CO2e) over the entire growth cycle.

[0061] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A freshwater pond sediment methane-oxidizing bacterium, which was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on January 31, 2024, with the deposit number CGMCC NO. 29827, and the classification name is Bacillus Velezii ( Bacillus velezensis ), the place of preservation is Beijing.

2. A CH4 oxidizing bacterial agent, characterized in that: The bacterial agent contains the freshwater pond sediment methane oxidizing bacteria according to claim 1.

3. The method for preparing a CH4 oxidizing bacterial agent according to claim 2, characterized in that: The methane oxidizing bacteria liquid of the freshwater pond sediment as claimed in claim 1 is mixed with attapulgite to obtain a CH4 oxidizing bacteria agent.

4. The method for preparing a CH4 oxidizing bacterial agent according to claim 3, characterized in that: The CH4 oxidizing bacterial agent contains 10-10 billion bacteria per gram.

5. The method for preparing a CH4 oxidizing bacterial agent according to claim 3, characterized in that: The preparation method of the freshwater pond sediment methane oxidizing bacteria liquid comprises: inoculating the freshwater pond sediment methane oxidizing bacteria according to claim 1 into LB liquid culture medium, and culturing in a constant temperature shaking incubator at a temperature of 15-30° C. and a rotation speed of 150-200 r / min for 40-50 hours.

6. The use of the CH4 oxidizing bacteria agent according to claim 2 in aquaculture, characterized in that: The CH4 oxidizing bacteria agent is used to oxidize CH4 gas at the interface between the bottom mud and water in the aquaculture pond.

7. The use according to claim 6, characterized in that: The CH4 oxidizing bacteria agent according to claim 2 is placed into the bottom mud of a freshwater aquaculture pond.

8. The use according to claim 7, characterized in that: The water temperature of the freshwater aquaculture pond is 15-30°C.

9. The use according to claim 7, characterized in that: The pH of the freshwater aquaculture pond is 5-8.

Images