A strain of Staphylococcus capitis, a bacterial agent and its application, and a scalp care product

Abstract

The present invention belongs to the field of microbial technology, and specifically relates to a strain of Staphylococcus capitis, a bacterial agent and its application, and a scalp care product. The present invention isolates and obtains a strain of Staphylococcus capitis from scalp for the first time. Experiments have confirmed that the fermentation supernatant of the Staphylococcus capitis is rich in active ingredients such as short-chain fatty acids, T-SOD enzymes and GSH-P enzymes, and has good anti-inflammatory and antioxidant effects. Antibacterial tests have shown that the fermentation supernatant of Staphylococcus capitis CCSMS0308 can promote the growth of normal scalp flora Propionibacterium acnes and Malassezia globosa, and inhibit the growth of harmful bacteria restrictive Malassezia, thereby regulating the balance between bacteria and fungi in the scalp, regulating the balance of scalp flora, reducing the growth and reproduction of harmful bacteria, and helping to improve the health of dandruff scalp, so it has good practical application value.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a strain of Staphylococcus capitis, a bacterial agent and application thereof, and a scalp care product. Background Art

[0002] Research on dandruff shows that Malassezia restrictae was previously believed to be the main cause of dandruff. However, research has now found that the mechanism of dandruff formation is very complex. As for factors related to the scalp microecology, it is not only caused by Malassezia restrictae, but is caused by the disorder of the entire scalp microecology.

[0003] At present, the research on the mechanism of dandruff and its prevention and treatment methods mainly focuses on inhibiting Malassezia. Commonly used treatment drugs include shampoos containing antifungal ingredients, antibiotics, anti-inflammatory drugs, etc. However, long-term use of antifungal drugs will produce drug resistance and bring side effects such as dizziness and burning sensation. Therefore, antifungal treatment of dandruff alone may not be the only effective countermeasure. Comprehensive treatment is needed to restore the homeostasis between scalp microorganisms and protect the health of the scalp from the root. Summary of the invention

[0004] In view of the above-mentioned prior art, the purpose of the present invention is to provide a strain of Staphylococcus capitis, a bacterial agent and its application, and a scalp care product. Specifically, the present invention isolates a strain of Staphylococcus capitis with good anti-inflammatory and antioxidant properties from the healthy scalp of the human body. It has been verified by experiments that its fermentation supernatant has good effects on promoting the proliferation of Propionibacterium acnes and Malassezia globosa, while inhibiting the proliferation of Malassezia restricta, and can regulate the balance of the flora of people with dandruff, and can be used in the development of anti-inflammatory and antioxidant scalp care and dandruff-related care products. Based on the above research results, the present invention is completed.

[0005] In order to achieve the above technical objectives, the technical solution provided by the present invention is as follows:

[0006] The first aspect of the present invention provides a strain of Staphylococcus capitis ( 头状葡萄球菌 ) CCSMS0308, Staphylococcus capitis ( 头状葡萄球菌 ) CCSMS0308 was deposited on January 18, 2024 at the General Microbiology Center of China Culture Collection Administration (address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China), with the deposit number CGMCC No. 29671.

[0007] The second aspect of the present invention provides a bacterial agent, wherein the bacterial agent comprises the Staphylococcus capitis ( 头状葡萄球菌 ) CCSMS0308 and the Staphylococcus capitis ( 头状葡萄球菌 ) Any one or both of the cultures of CCSMS0308.

[0008] In the present invention, the Staphylococcus capitis ( 头状葡萄球菌 ) CCSMS0308 culture is Staphylococcus capitis ( 头状葡萄球菌 ) The material obtained by culturing CCSMS0308 in culture medium.

[0009] The third aspect of the present invention provides the above-mentioned Staphylococcus capitis ( 头状葡萄球菌 )Application of CCSMS0308 or the above-mentioned bacterial agent in the preparation of scalp care products. Wherein, the scalp care products have any one or more effects of anti-inflammatory, anti-oxidation, and regulating scalp microecology, thereby improving the health of dandruff scalp.

[0010] The anti-inflammatory effect is specifically manifested in that the fermentation supernatant of Staphylococcus capitis has the ability to inhibit hyaluronidase.

[0011] The antioxidant effect is specifically manifested as follows: the fermentation supernatant of Staphylococcus capitis is rich in T-SOD and GSH-PX, and exhibits an antioxidant effect on ABTS + Free radical and DPPH free radical scavenging effect.

[0012] The regulation of scalp microecology is specifically manifested in: regulating the balance between bacteria and fungi in the scalp, regulating the balance of scalp flora, reducing the growth and reproduction of harmful bacteria, and promoting the reproduction of beneficial bacteria.

[0013] Furthermore, the harmful bacteria include Malassezia restricta; and the beneficial bacteria include any one or two of Propionibacterium acnes and Malassezia globosa.

[0014] A fourth aspect of the present invention provides a scalp care product, comprising any one or more of the above-mentioned Staphylococcus capitis CCSMS0308 and the above-mentioned bacterial agent.

[0015] Furthermore, the scalp care product comprises the culture of the above-mentioned Staphylococcus capitis CCSMS0308; the culture comprises any one or both of the supernatant and the bacterial cell fragments of the fermentation liquid of the above-mentioned Staphylococcus capitis CCSMS0308.

[0016] Beneficial technical effects of one or more of the above technical solutions:

[0017] The above technical scheme reports a scalp-derived Staphylococcus capitis for the first time. Experiments have confirmed that the TSB fermentation supernatant of the Staphylococcus capitis is rich in active ingredients such as short-chain fatty acids, T-SOD enzymes and GSH-P enzymes, and has good anti-inflammatory and antioxidant effects. Antibacterial tests have shown that the fermentation supernatant of the Staphylococcus capitis CCSMS0308 can promote the growth of normal scalp flora Propionibacterium acnes and Malassezia globosa, while inhibiting the growth of harmful bacteria restrictive Malassezia, thereby regulating the balance between bacteria and fungi in the scalp, regulating the balance of scalp flora, reducing the growth and reproduction of harmful bacteria, and helping to improve the health of dandruff scalp, so it has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The colony morphology and bacterial image of Staphylococcus capitis CCSMS0308 of the present invention are shown in Figure 1; wherein A is a plate colony morphology image, and B is a bacterial image under the field of view of an electron microscope.

[0019] Figure 2 This is the growth curve of Staphylococcus capitis CCSMS0308 of the present invention.

[0020] Figure 3 This is a diagram showing the inhibitory effect of the fermentation supernatant of Staphylococcus capitis CCSMS0308 on hyaluronidase of the present invention.

[0021] Figure 4 This is a diagram showing the scavenging effect of the fermentation supernatant of Staphylococcus capitis CCSMS0308 on ABTS free radicals.

[0022] Figure 5 This is a diagram showing the scavenging effect of the fermentation supernatant of Staphylococcus capitis CCSMS0308 of the present invention on DPPH free radicals.

[0023] Figure 6 This is the effect of the fermentation supernatant of Staphylococcus capitis CCSMS0308 on the growth of Propionibacterium acnes CCSMS1509 of the present invention.

[0024] Figure 7 This is the effect of the fermentation supernatant of Staphylococcus capitis CCSMS0308 of the present invention on the growth of Malassezia globosa CCSMS1050.

[0025] Figure 8 This is the effect of the fermentation supernatant of Staphylococcus capitis CCSMS0308 of the present invention on the growth of Malassezia restricta CCSMS1060. DETAILED DESCRIPTION

[0026] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0027] In a typical embodiment of the present invention, a strain of Staphylococcus capitis ( 葡萄球菌属 头状的 ) CCSMS0308, which was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, China) on January 18, 2024, with the deposit number CGMCC No.29671.

[0028] In another specific embodiment of the present invention, a bacterial agent is provided, wherein the bacterial agent comprises the Staphylococcus capitis ( 头状葡萄球菌 ) CCSMS0308 and culture of the Staphylococcus capitis CCSMS0308.

[0029] In the present invention, the culture of Staphylococcus capitis CCSMS0308 is a substance obtained by culturing Staphylococcus capitis CCSMS0308 in a culture medium (all substances in a culture container).

[0030] In the above culture, the substance includes Staphylococcus capitis CCSMS0308 (the bacteria itself) and / or metabolites of Staphylococcus capitis CCSMS0308.

[0031] In the present invention, the term "culture" refers to a general term for liquid or solid / liquid culture medium with a microbial population after artificial inoculation and culture. That is, the product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or can contain a certain amount of culture medium, metabolites or other components produced during the culture process. The term "culture" also includes a subculture obtained by subculturing microorganisms, which can be a culture of a certain generation or a mixture of several generations.

[0032] More specifically, the culture can be the fermentation supernatant or bacterial fragment of Staphylococcus capitis CCSMS0308. Experimental verification shows that it is rich in active ingredients such as short-chain fatty acids (such as acetic acid, propionic acid, isobutyric acid, butyric acid, isovaleric acid and valeric acid, etc.), T-SOD enzyme and GSH-P enzyme, and does not contain live bacteria. Therefore, it can be used as a raw material for cosmetics, etc.

[0033] In the present invention, the term "metabolite" refers to the primary metabolites and / or secondary metabolites produced during the metabolism of microorganisms. Primary metabolism refers to the process in which microorganisms absorb various nutrients from the outside world and generate substances and energy to maintain life activities through catabolism and anabolism. The products of primary metabolism are primary metabolites, such as monomers such as monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, lipids, etc. Secondary metabolism refers to the process in which microorganisms use primary metabolites as precursors to synthesize some substances that have no clear function on the life activities of microorganisms during a certain growth period. The products of secondary metabolism are secondary metabolites, which are mostly compounds with relatively complex molecular structures, such as, fatty acids, proteins (enzymes), alkaloids, etc.

[0034] In the present invention, the metabolite can be obtained from the culture of the Staphylococcus capitis CCSMS0308. The metabolite can be a sterile metabolite of the Staphylococcus capitis CCSMS0308 or a bacteria-containing metabolite of the Staphylococcus capitis CCSMS0308. The sterile metabolite of the Staphylococcus capitis CCSMS0308 can be prepared according to the following method: the Staphylococcus capitis CCSMS0308 is cultured in a liquid culture medium, and the Staphylococcus capitis CCSMS0308 in the liquid culture (fermentation broth) is filtered out to obtain the sterile metabolite of the Staphylococcus capitis CCSMS0308. The bacteria-containing metabolite of the Staphylococcus capitis CCSMS0308 can be specifically prepared according to the following method: the Staphylococcus capitis CCSMS0308 is cultured in a liquid fermentation medium, and the fermentation broth is collected, and the fermentation broth is the bacteria-containing metabolite of the Staphylococcus capitis CCSMS0308.

[0035] In another specific embodiment of the present invention, the use of the above-mentioned Staphylococcus capitis CCSMS0308 or the above-mentioned bacterial agent in the preparation of a scalp care product is provided. The scalp care product has any one or more effects of anti-inflammatory, anti-oxidation, and regulating scalp microecology, thereby improving the health of dandruff scalp.

[0036] The anti-inflammatory effect is specifically manifested in that the fermentation supernatant of Staphylococcus capitis has the ability to inhibit hyaluronidase.

[0037] The antioxidant effect is specifically manifested as follows: the fermentation supernatant of Staphylococcus capitis is rich in T-SOD and GSH-PX, and exhibits an antioxidant effect on ABTS + Free radical and DPPH free radical scavenging effect.

[0038] The regulation of scalp microecology is specifically manifested in: regulating the balance between bacteria and fungi in the scalp, regulating the balance of scalp flora, reducing the growth and reproduction of harmful bacteria, and promoting the reproduction of beneficial bacteria.

[0039] In another specific embodiment of the present invention, the harmful bacteria include Malassezia restricta; and the beneficial bacteria include any one or two of Propionibacterium acnes and Malassezia globosa.

[0040] In another specific embodiment of the present invention, a scalp care product is provided, wherein the scalp care product comprises the above-mentioned Staphylococcus capitis CCSMS0308 and any one or two of the above-mentioned bacterial agents.

[0041] In another specific embodiment of the present invention, the scalp care product comprises the culture of the above-mentioned Staphylococcus capitis CCSMS0308; the culture comprises any one or both of the supernatant and bacterial cell fragments of the fermentation broth of the above-mentioned Staphylococcus capitis CCSMS0308.

[0042] As described above, the scalp care product has any one or more effects of anti-inflammatory, anti-oxidation, and regulating scalp microecology, thereby improving the health of dandruff scalp. And the scalp care product can be any one or more of medicines, daily chemicals and cosmetics. It should be noted that when the scalp care product is a cosmetic, its components do not contain live bacteria.

[0043] Furthermore, the scalp care product may also contain any other raw material ingredients allowed to be added in the field of medicines, daily chemicals or cosmetics, and different dosage forms of scalp care products may be prepared therefrom, such as ointments (creams), sprays, emulsions, aqueous solutions, patches, etc., which are not specifically limited here.

[0044] The present invention is further described below in conjunction with examples. The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. Meanwhile, in the examples of the present invention, unless otherwise specified, all preparation raw materials are commercially available products well known to those skilled in the art.

[0045] Experimental strains: Propionibacterium acnes CCSMS1509, Malassezia globosa CCSMS1050, and Malassezia restricta CCSMS1060 were all isolated from healthy human scalp skin in the laboratory.

[0046] Culture medium: TSA: 15 g / L trypticase, 5 g / L soybean papain hydrolysate, 5 g / L sodium chloride, 15 g / L agar, autoclave at 121 °C for 15 min, add 5% sterile defibrinated sheep blood when cooled to about 50 °C, mix well, and pour onto plates.

[0047] Tryptic soy casein broth (TSB): tryptic casein 15 g / L, soybean papain hydrolysate 5 g / L, sodium chloride, autoclave at 121 ℃ for 15 min, set aside.

[0048] Malassezia culture medium: ATCC culture medium: 2693 modified mDixon: malt extract powder 36 g / L, ox bile powder 20 g / L, peptone 6 g / L, glycerol 2 g / L, oleic acid 2 g / L, autoclave at 121 ℃ for 15 min, set aside.

[0049] Preservation medium: 120 g skim milk powder, 880 mL distilled water, autoclave at 121 °C for 15 min, set aside.

[0050] Example 1 Staphylococcus capitis ( 头状葡萄球菌 )Separation, screening and purification of CCSMS0308

[0051] (1) Recruiting volunteers with healthy scalp

[0052] No topical antifungal drugs or corticosteroid preparations have been used on the scalp within two weeks; no oral antifungal drugs have been taken within two months; no atopic dermatitis, psoriasis or other scalp skin diseases; age 18 to 30 years old, regardless of gender.

[0053] (2) Sample collection

[0054] Volunteers were asked not to wash their hair the night before sampling, and samples were generally taken at noon or in the afternoon of the next day. A sterile cotton swab made of polymer fiber material was moistened in a moistening solution (0.9% sodium chloride and 0.1% Tween-20), and rubbed back and forth 50 times on the selected area of ​​the scalp (the cotton swab should be wiped with a certain amount of force), and the sterile cotton swab was placed in the sampling tube with sterile tweezers and sealed with a sealing film. The collected samples were placed in an ice box for refrigeration, brought back to the laboratory and placed in a 4°C refrigerator, and the strains were isolated as soon as possible.

[0055] (3) Sample pretreatment

[0056] In an ultra-clean workbench, use sterile scissors to cut off the sterile cotton swab head with the sample, place it in a 5 mL centrifuge tube (EP tube), draw 5 mL of sterile water into the centrifuge tube, and mix thoroughly.

[0057] (4) Plate screening

[0058] Take 0.5 mL of the above sample solution and add 4.5 mL of sterile water for gradient dilution. Select the appropriate dilution and apply 0.1 mL of the dilution on TSA solid blood agar plates. Apply 2 plates for each dilution and place them in a 37°C incubator for aerobic culture for 24 h.

[0059] (5) Streaking, purification and preservation

[0060] According to the colony characteristics of coagulase-negative staphylococci on blood agar plates, such as the absence of hemolysis zone, colony size, color, moisture, and gloss, single colonies were picked and streaked onto TSA blood agar plates, which were then placed in a 37°C constant temperature incubator for 16 h. After multiple streaking and purification, skim milk powder was used as a protective agent and stored in a preservation tube. After freeze-drying, the agar plates were stored in a -80°C deep freezer.

[0061] The strain CCSMS0308 was screened and obtained by the above screening method.

[0062] Example 2 Staphylococcus capitis ( 头状葡萄球菌 )Microbiological identification of CCSMS0308

[0063] (1) Colony characteristics:

[0064] The strain was streaked on TSA blood agar plates and cultured at 37°C for 16 h. The colony morphology of the strain on the plate was observed. Figure 1 As shown in A, the colonies of Staphylococcus capitis on the TSA blood agar plate are white and small, forming round protrusions with neat edges. The colony diameter is about 0.5~1 mm, and the surface is smooth, moist, and opaque. It can be drawn into threads when picked, and there is no hemolysis zone.

[0065] (2) Bacterial characteristics:

[0066] A small amount of Staphylococcus capitis obtained in step (1) was selected and smeared on a glass slide, and Gram staining was performed. The morphological characteristics of the bacteria were observed under an electron microscope. The results showed that the Gram staining was positive. Figure 1 As shown in B, the bacteria are spherical in shape, with a diameter of about 0.9~1.0 µm, arranged in grape-like shapes or individually, without flagella, unable to move, and without producing spores.

[0067] (3) Cultivation characteristics:

[0068] The strain CCSMS0308 was inoculated into TSB liquid culture medium and cultured at different temperatures. The results showed that the minimum growth temperature of CCSMS0308 was 15 ℃, the maximum growth temperature was 45 ℃, and the best growth temperature was 30-40 ℃. When inoculated into TSB liquid culture medium with different pH values ​​and cultured at 37 ℃, the highest growth pH of the strain CCSMS0308 was 9.0, the lowest growth pH was 4.0, and the optimal growth pH was 6.0.

[0069] (4) Genetic characteristics:

[0070] 16S rDNA sequence analysis of strain CCSMS0308

[0071] Method for extracting genomic DNA of CCSMS0308: Pick a purified single colony of CCSMS0308 and inoculate it into 10 mL of TSB medium. After culturing at 37 °C for 14-16 h, centrifuge the bacterial solution (8000 r / min, 15 min) to collect the bacteria.

[0072] The DNA was extracted using a genomic DNA extraction kit (Shanghai Biotech Co., Ltd.). Two synthetic universal primers (16s-27F: GAGAGTTTGATCCTGGCTCAG, SEQ ID NO: 1; 16s-1492R: CGGCTACCTTGTTACGACTT, SEQ ID NO: 2) were used for PCR amplification. The PCR product was recovered using a column PCR product purification kit (Shanghai Biotech Co., Ltd.) and sent to Meiji Biotech Co., Ltd. for sequencing after purification. The obtained 16S rDNA nucleotide sequence of CCSMS0308 is shown in SEQ ID NO: 3, and the sequence length is 1419 bp.

[0073] The strains were sent to GenBank for Blast analysis. The strain with the highest homology to strain CCSMS0308 was KT720157.1, with a homology of 100%.

[0074] According to Goodfellow and O'Donnell, species with DNA G+C (mol%) ≤ 10% to 12% and 16S rRNA sequence homology ≥ 95% can be classified as one genus, and Embley and Stackebrangdt believed that species with 16S rRNA sequence homology ≥ 97% can be considered as one species. 葡萄球菌属 头状的 belong to the same species. Therefore, strain CCSMS0308 was identified as Staphylococcus capitis ( 葡萄球菌属 头状的 ).

[0075] Based on the above-mentioned microbiological characteristics such as colony, bacterial morphology, culture, physiological and biochemical identification, and its genetic characteristics 16s rDNA, CCSMS0308 was identified as Staphylococcus capitis. 头状葡萄球菌 The strain was deposited in the China General Microbiological Culture Collection Center on January 18, 2024, and its deposit number is CGMCC.29671.

[0076] The activated Staphylococcus capitis bacteria ( 头状葡萄球菌)CCSMS0308 was inoculated into TSB liquid medium at a rate of 2% (v / v), and cultured at 37°C for 48 h. The OD value of the culture medium was measured at 600 nm every 4 h. 600 Plotting the values ​​against time yielded Staphylococcus capitis ( 头状葡萄球菌 ) The growth curve of CCSMS0308 in TSB broth liquid culture medium, the results are as follows Figure 2 As shown, Staphylococcus capitis ( 头状葡萄球菌 ) CCSMS0308 grew rapidly in TSB broth liquid culture medium, entered the logarithmic growth phase in 8 h, and reached the stable phase in 32 h.

[0077] Example 3 Staphylococcus capitis ( 头状葡萄球菌 ) Preparation of CCSMS0308 fermentation supernatant

[0078] Will 头状葡萄球菌 The CCSMS0308 strain was streaked onto a TSA plate and cultured at 37°C for 16 to 20 h, followed by activation twice. 头状葡萄球菌 CCSMS0308 was inoculated into TSB liquid medium and cultured in a shaking incubator at 37°C for 16-20 h. The bacterial OD was adjusted. 600 In the range of 0.55-0.56, the seed solution was used as the seed solution. The seed solution was inoculated into a 250 mL triangular flask at an inoculation amount of 1% to 3% (v / v), placed in a 37°C constant temperature shaking incubator, and cultured at a speed of 160 r / min for 18-20 h to obtain the fermentation liquid of Staphylococcus capitis; the fermentation liquid was centrifuged at 9000 r / min for 10 min, and the centrifuged supernatant obtained was the fermentation supernatant of Staphylococcus capitis.

[0079] Example 4 Staphylococcus capitis ( 头状葡萄球菌 )Determination of short-chain fatty acids in the fermentation supernatant of CCSMS0308

[0080] (1) Sample pretreatment

[0081] Add 2 mL of supernatant, 0.4 mL of 50% H2SO4 and 2 mL of ether to a 10 mL centrifuge tube, mix well, shake on a shaker at 250 r / min for 45 min, then centrifuge at 4 °C and 10,000 r / min for 5 min, take the upper organic phase, filter it through a 0.22 μm organic filter membrane before GC injection, and keep the supernatant at -20 °C for later use.

[0082] (2) Gas chromatography conditions

[0083] GC was used to determine the short-chain fatty acids in the fermentation supernatant. The instrument model was GC-2010plus; the chromatographic column was Agilent DB-WAX UI (60 m×0.25 μm×0.25 mm); the injection port and detector temperature were set to 250 °C; high-purity nitrogen was used as the carrier gas (flow rate 1.2 mL / min), and the splitless detection mode was adopted; the heating conditions were: the sample volume was 1 μL, and the temperature was increased from 75 °C to 180 °C at 10 °C / min and maintained for 1 min, and then increased to 220 °C at 10 °C / min and maintained for 1 min.

[0084] (3) Preparation of standard curve

[0085] Water-soluble fatty acid mixed standard solution (Northern Weiye Metrology Institute): glacial acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid, a total of 6 components, the standard value of each is 1000 μg / mL. Ultrapure water diluted mixed standard, respectively diluted to 5 μg / mL, 10 μg / mL, 20 μg / mL, 50 μg / mL, 100 μg / mL, 200 μg / mL, 500 μg / mL, 800 μg / mL, 1000 μg / mL 9 concentration gradients, stored at -20 ℃ for use.

[0086] (4) Sample content determination

[0087] It was determined that the fermentation supernatant of CCSMS0308 contained 7 short-chain fatty acids, and the specific contents are shown in Table 1 below.

[0088] Table 1 Results of short-chain fatty acid content in the supernatant of CCSMS0308 fermentation

[0089]

[0090] Example 5 Staphylococcus capitis ( 头状葡萄球菌 )Determination of hyaluronidase inhibition rate of CCSMS0308 fermentation supernatant

[0091] (1) Reagents: CaCl2 solution: 2.5mmol / L; NaOH solution: 0.4mol / L; Buffer: Solution A (0.2mol / L acetic acid, 1.155mL glacial acetic acid dissolved in 100mL distilled water) 4.8mL; Solution B (0.2mol / L sodium acetate, 1.64g CH3COONa dissolved in 100mL distilled water) 45.2mL, mixed and diluted to 100mL to prepare acetate buffer solution with pH=5.6; Hyaluronidase solution: 500U / mL; Sodium hyaluronate solution: 0.5mg / mL; Acetylacetone solution: 1.4mL; P-DAB color developer - Ehrlihc reagent.

[0092] (2) Experimental procedures

[0093] 1. Add 100 µL of 2.5 mmol / LCaCl2 solution and 500 µL of 600 U / mL hyaluronidase solution to the test tube and treat at 37 °C for 20 min.

[0094] 2. Add 500 µL of sample solution and incubate at 37 °C for 20 min.

[0095] 3. Add 500 µL of 0.5 mg / mL sodium hyaluronate solution, treat at 37°C for 30 min, and let stand at room temperature for 5 min.

[0096] 4. Add 500 µL of acetylacetone solution and 100 µL of NaOH solution, boil in water bath for 15 min, and ice bath for 5 min.

[0097] 5. Add 1 mL of P-DAB reagent, color develop at room temperature for 20 minutes, take 200 µL from each centrifuge tube and place it on the ELISA plate, and measure its absorbance at a wavelength of 530 nm.

[0098] The experiment was set up with 3 replicate wells and the average value was taken.

[0099] (3) Calculate the hyaluronidase inhibition rate: inhibition rate / % = ((CD)-(AB)) / (CD)×100.

[0100] Where: A: OD of hyaluronidase solution + sample 530 ;

[0101] B: OD of acetate buffer + sample 530 ;

[0102] C: OD of hyaluronidase solution + sample solvent 530 ;

[0103] D: OD of acetate buffer + sample solvent 530 .

[0104] The test results are as follows Figure 3 As shown, Staphylococcus capitis ( 头状葡萄球菌 ) The hyaluronidase inhibition rate of CCSMS0308 fermentation supernatant was 120.14±7.23%, showing a good anti-inflammatory effect.

[0105] Example 6 Staphylococcus capitis ( 头状葡萄球菌 )Determination of T-SOD and GSH-PX enzymes in the supernatant of CCSMS0308 fermentation

[0106] (I) Prepare the required working solution according to the instructions of the glutathione peroxidase (GSH-PX) test kit (Nanjing Jiancheng Bioengineering Institute) and conduct the following experiment:

[0107] (1) Enzymatic reaction: the specific operation is shown in Table 2 below.

[0108] Table 2 Specific operation of enzymatic reaction

[0109]

[0110] (2) Color development reaction. The specific operation is shown in Table 3 below.

[0111] Table 3 Specific operation of color reaction

[0112]

[0113] Mix well, let stand at room temperature for 15 min, and then measure the OD value of each tube at 412 nm, 1 cm optical path, and zero with distilled water.

[0114] Calculation formula: GSH-PX activity = (OD value of non-enzyme tube - OD value of enzyme tube) / (OD value of standard tube - OD value of blank tube) × standard concentration (20 μmol / L) × dilution factor (6×).

[0115] 100 μL of the fermentation supernatant of Staphylococcus capitis CCSMS0308 was taken, and the GSH-PX activity was calculated to be 364.04±10.84 U / mL.

[0116] (ii) Prepare the required working solution according to the instructions of the Total Superoxide Dismutase (T-SOD) Assay Kit (Nanjing Jiancheng Bioengineering Institute), and perform the following experiment according to Table 4.

[0117] Table 4 Specific operation of T-SOD detection

[0118]

[0119] Mix well, let stand at room temperature for 10 min, and perform colorimetry at a wavelength of 550 nm, using a 1 cm optical path cuvette and adjusting to zero with distilled water.

[0120] Calculation formula: Total SOD activity (U / ml) = (control OD value - measured OD value) / (control OD value) ÷ 50% × dilution multiple of the reaction system × dilution multiple of the sample before testing.

[0121] 100 μL of the fermentation supernatant of Staphylococcus capitis CCSMS0308 was aspirated, and the T-SOD activity was calculated to be 26.83±0.56 U / mL.

[0122] Example 7 Staphylococcus capitis ( 头状葡萄球菌 ) ABTS from the fermentation supernatant of CCSMS0308 + Free radical scavenging assay

[0123] Mix equal volumes of 7 mmol / L ABTS and 2.6 mmol / L potassium persulfate solution and keep in the dark at room temperature for 12-16 hours to obtain ABTS + The stock solution was diluted with anhydrous ethanol before use to make its absorbance at 734 nm wavelength 0.70 ± 0.02, and ABTS was obtained. + Working solution. Control solution: Take a 10 mL test tube and add ABTS + 1.0 mL of working solution and 3.0 mL of anhydrous ethanol were added to a test tube to a final volume of 4.0 mL, and the solution was allowed to stand for 30 min. The absorbance was measured at a wavelength of 734 nm and recorded as a0. Sample solution: CCSMS0308 fermentation supernatant was diluted 20, 40, 60, 80, and 100 times, anhydrous ethanol was added to 2.0 mL, and ABTS was added. + The working solution was adjusted to a final volume of 4.0 mL, and the reaction was allowed to stand in the dark for 30 min. The absorbance was measured at a wavelength of 734 nm and recorded as a. C As a positive control, each sample was repeated 3 times, and ABTS + Free radical scavenging rate (%) = (a0-a) / a0×100%.

[0124] The test results are as follows Figure 4 As shown, the fermentation supernatant of Staphylococcus capitis CCSMS0308 was resistant to ABTS + The free radical scavenging ability increased with the increase of fermentation supernatant concentration, and the ABTS + Free radical scavenging IC 50 The concentration was 2.66%. The results showed that the fermentation supernatant of Staphylococcus capitis CCSMS0308 had good antioxidant and free radical scavenging ability.

[0125] Example 8 Staphylococcus capitis ( 头状葡萄球菌 ) DPPH free radical scavenging test of CCSMS0308 fermentation supernatant

[0126] Control group: 1 mL of 2×10 -4 mol / L DPPH solution, add water to make the final volume 4 mL, keep it away from light for 30 minutes at room temperature, and measure the absorbance at 517 nm, which is recorded as a0; sample solution: take 1 mL of DPPH solution and 1 mL of fermentation supernatant with concentrations of 5%, 2.5%, and 1.67%, respectively, and add water to make the final volume 4 mL, keep it away from light for 30 minutes at room temperature, and measure the absorbance of fermentation supernatant with different concentrations, which is recorded as a. C As a positive control, each sample was repeated 3 times, and the DPPH free radical scavenging rate (%) = (a0-a) / a0×100%.

[0127] The test results are as follows Figure 5 As shown in Figure 2, the scavenging ability of the fermentation supernatant of Staphylococcus capitis CCSMS0308 on DPPH free radicals increased with the increase of concentration. The IC 50 It is 32.23% (the original fermentation liquid concentration is 100%), indicating that the fermentation supernatant of Staphylococcus capitis CCSMS0308 has good antioxidant capacity.

[0128] Example 9 Staphylococcus capitis ( 头状葡萄球菌 )Intervention of CCSMS0308 fermentation supernatant on Propionibacterium acnes CCSMS1509

[0129] (1) Fermentation supernatant concentration selection: fermentation supernatant and sterile TSB liquid culture medium were mixed in a 1:1 ratio using the half-dilution method to obtain fermentation supernatant with concentrations of 25, 12.5, 6.25, 3.125, and 1.562%.

[0130] (2) Preparation of bacterial suspension of Propionibacterium acnes CCSMS1509: Take out the freeze-dried tube of P. acnes strain milk powder stored at -80℃, streak TSA solid plate, and place it in a 37℃ constant temperature incubator for anaerobically cultured for 48-60 h; after activation twice, pick a single colony of P. acnes activated twice and inoculate it into a test tube containing 5 mL of TSB liquid culture medium, place it in a 37℃ incubator, anaerobically culture for 48-60 h, and adjust the bacterial OD 600 Around 0.3-0.4, keep aside.

[0131] (3) In the experimental group, 50 μL of bacterial solution, 50 μL of sample and 100 μL of TSB were added to each well of the 96-well plate. In the blank group, 100 μL of TSB and 100 μL of sample were added. In the sterile control well, 200 μL of TSB was added. In the growth control well, 150 μL of TSB and 50 μL of bacterial solution were added. Four replicate wells were made for each group.

[0132] (4) Incubate the 96-well plate at 37°C for 48 h and measure the OD using an ELISA reader. 600 The inhibition rate was calculated as 1-(OD value of the experimental group-OD value of the experimental blank group) / (OD value of the growth control well-OD value of the sterile control well) × 100%.

[0133] The test results are as follows Figure 6 The results showed that the fermentation supernatant of Staphylococcus capitis CCSMS0308 inhibited the growth of Propionibacterium acnes at low concentrations and promoted its growth at high concentrations. At a concentration of 25%, the growth rate of Propionibacterium acnes CCSMS1509 was 17.34±4.91%, indicating that it significantly promoted the growth of Propionibacterium acnes in the normal scalp flora, regulated the scalp microecology, and helped improve scalp health.

[0134] Example 10 Intervention test of the fermentation supernatant of Staphylococcus capitis CCSMS0308 on Malassezia globosa CCSMS1050

[0135] (1) Selection of fermentation supernatant concentration: The fermentation supernatant was mixed with sterile Dixon medium in a ratio of 1:1 using the half-dilution method to obtain fermentation supernatants with concentrations of 25, 12.5, 6.25, 3.13, and 1.56%.

[0136] (2) Preparation of Malassezia suspension: Take out the freeze-dried milk powder tube of Malassezia coli CCSMS1050 strain stored at -80℃, streak the Dixon agar plate, streak it using the three-zone streak method, place it in a 32℃ constant temperature incubator and culture it for 72 hours to make the first-generation activation plate, pick a single colony from the colonies grown on the first-generation plate, streak it on the second-generation plate, place it in a 32℃ constant temperature incubator and culture it aerobically for 72 hours, and set it aside. Pick a single colony of the Malassezia that has been activated for two generations and inoculate it into a conical flask containing 100 mL of Dixon liquid culture medium, place it in a 32℃ shaker, and shake and culture it at a speed of 150 r / min for 72 hours. Adjust the bacterial OD 600 In the range of 0.7-0.8, for standby use.

[0137] (3) In the experimental group, 50 μL of bacterial solution, 50 μL of sample and 100 μL of Dixon were added to each well of the 96-well plate. In the blank group, 100 μL of Dixon and 100 μL of sample were added. In the sterility control well, 200 μL of Dixon was added. In the growth control well, 150 μL of Dixon and 50 μL of bacterial solution were added. Four replicate wells were made for each group.

[0138] (4) Incubate the 96-well plate at 32 °C for 72 h and measure the OD using an ELISA reader. 600 The inhibition rate was calculated as 1-(OD value of the experimental group-OD value of the experimental blank group) / (OD value of the growth control well-OD value of the sterile control well) × 100%.

[0139] The test results are as follows Figure 7 The results showed that the fermentation supernatant of Staphylococcus capitis CCSMS0308 inhibited the growth of Malassezia globosa CCSMS1050 at low concentrations and promoted its growth at high concentrations, and the proliferation rate increased with increasing concentrations. At a concentration of 25%, the growth proliferation rate of Malassezia globosa CCSMS1050 was 17.09±3.00%, indicating that the fermentation supernatant of Staphylococcus capitis CCSMS0308 can significantly promote the growth of Malassezia globosa at low concentrations, regulate the scalp microecology, and help improve scalp health.

[0140] Example 11 Intervention test of the fermentation supernatant of Staphylococcus capitis CCSMS0308 on Malassezia restricta CCSM1060

[0141] (1) Selection of fermentation supernatant concentration: the fermentation supernatant was mixed with sterile Dixon medium at a ratio of 1:1 using the half-dilution method to obtain fermentation supernatants with concentrations of 25, 12.5, 6.25, 3.13, and 1.56%;

[0142] (2) Preparation of Malassezia bacterial suspension: Take out the -80℃ storage restricted Malassezia CCSM1060 strain milk powder freeze-dried tube, streak the Dixon agar plate, streak it using the three-zone streak method, place it in a 32℃ constant temperature incubator and culture it for 72 h to make a first-generation activation plate, pick a single colony from the colonies grown on the first-generation plate, streak it on the second-generation plate, place it in a 32℃ constant temperature incubator and culture it aerobically for 72 h, and set it aside. Pick a single colony of the Malassezia that has been activated for two generations and inoculate it into a conical flask containing 100 mL of Dixon liquid culture medium, place it in a 32℃ shaker, and shake and culture it at a speed of 150 r / min for 72 h. Adjust the bacterial OD 600 In the range of 0.7-0.8, for standby use.

[0143] (3) In the experimental group, 50 μL of bacterial solution, 50 μL of sample and 100 μL of Dixon were added to each well of the 96-well plate. In the blank group, 100 μL of Dixon and 100 μL of sample were added. In the sterility control well, 200 μL of Dixon was added. In the growth control well, 150 μL of Dixon and 50 μL of bacterial solution were added. Four replicate wells were made for each group.

[0144] (4) Incubate the 96-well plate at 32 °C for 72 h and measure the OD using an ELISA reader. 600 The inhibition rate was calculated as 1-(OD value of the experimental group-OD value of the experimental blank group) / (OD value of the growth control well-OD value of the sterile control well) × 100%.

[0145] The test results are as follows Figure 8 The results showed that the fermentation supernatant of Staphylococcus capitis CCSMS0308 had certain antifungal ability, and the inhibition rate of the fermentation supernatant on Malassezia restricta CCSM1060 was about 20%. When the concentration was 25%, the growth inhibition rate of Malassezia restricta CCSM1060 was 25.66±6.60%, indicating that the fermentation supernatant of Staphylococcus capitis CCSMS0308 significantly inhibited the growth of Malassezia restricta, had potential in regulating the scalp microecology, and helped to improve scalp health.

[0146] The fermentation supernatant of Staphylococcus capitis CCSMS0308 contains a variety of active ingredients such as short-chain fatty acids, T-SOD enzyme and GSH-PX enzyme, which have good anti-inflammatory and antioxidant abilities, and can significantly promote the growth of resident scalp fungi Propionibacterium acnes, as well as the growth of Malassezia globosa, and has a certain inhibitory effect on the growth of Malassezia restricta. These characteristics give Staphylococcus capitis CCSMS0308 good application prospects in the development of scalp care products that regulate the scalp microecology, laying the foundation for the exploration of functional skin bacteria.

[0147] The above embodiments are only for illustrating the technical concept and features of the present invention, and their purpose is to enable people familiar with the technology to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. A strain of Staphylococcus capitis ( Staphylococcus capitis ) CCSMS0308, characterized in that, The Staphylococcus capitis Staphylococcus capitis ) CCSMS0308 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on January 18, 2024, with the deposit number CGMCC No. 29671.

2. A bacterial agent, characterized in that The bacterial agent comprises the Staphylococcus capitis described in claim 1 ( Staphylococcus capitis ) CCSMS0308 and the Staphylococcus capitis ( Staphylococcus capitis ) CCSMS0308, either or both of the cultures, the Staphylococcus capitis ( Staphylococcus capitis ) The culture of CCSMS0308 comprises the fermentation supernatant of the Staphylococcus capitis CCSMS0308.

3. The Staphylococcus capitis of claim 1 ( Staphylococcus capitis ) Use of the bacterial agent described in CCSMS0308 or claim 2 in the preparation of a scalp care product, wherein the scalp care product is a medicine.

4. Use of a bacterial agent in the preparation of a scalp care product, wherein the scalp care product is a cosmetic, and the cosmetic does not contain live bacteria, and the bacterial agent comprises the Staphylococcus capitis described in claim 1 ( Staphylococcus capitis ) Fermentation supernatant of CCSMS0308.

5. The use according to claim 3 or 4, characterized in that: The scalp care product has any one or more effects of anti-inflammation, anti-oxidation and regulating scalp microecology.

6. The use according to claim 5, characterized in that The anti-inflammatory effect is specifically manifested as: the Staphylococcus capitis ( Staphylococcus capitis ) The fermentation supernatant of CCSMS0308 has the ability to inhibit hyaluronidase.

7. The use according to claim 5, characterized in that The antioxidant is specifically manifested as: the Staphylococcus capitis ( Staphylococcus capitis )The fermentation supernatant of CCSMS0308 contains T-SOD and GSH-PX, and has an effect on ABTS + Free radicals and DPPH radicals have scavenging effects.

8. The use according to claim 5, characterized in that The regulation of scalp microecology is specifically manifested in: regulating the balance between bacteria and fungi in the scalp, regulating the balance of scalp flora, reducing the growth and reproduction of harmful bacteria, and promoting the reproduction of beneficial bacteria; wherein the harmful bacteria include restrictive Malassezia; the beneficial bacteria include any one or two of Propionibacterium acnes and Malassezia globosa.

9. A scalp care product, characterized in that: The scalp care product comprises the Staphylococcus capitis of claim 1 ( Staphylococcus capitis ) CCSMS0308 and any one or both of the bacterial agents described in claim 2, wherein the scalp care product is a medicine.

10. A scalp care product, characterized in that: The scalp care product comprises a bacterial agent, wherein the bacterial agent comprises the Staphylococcus capitis described in claim 1 ( Staphylococcus capitis ) The fermentation supernatant of CCSMS0308, the scalp care product is a cosmetic, and the cosmetic does not contain live bacteria.

Images