A strain of morchella sextelata strain ks1, cultivation method and application thereof

Abstract

The present application relates to the edible mushroom cultivation technical field, especially to a strain of Morchella sextelata strain KS1, a cultivation method and application thereof.The strain is preserved in the China General Microbiological Culture Collection Center on November 13, 2023, the preservation number is CGMCC No.40979, and the preservation address is No.3, Xibaixili, Chaoyang District, Beijing.The average yield per mu of the strain KS1 cultivated by the cultivation method provided in the present application is as high as 918.79 kg / mu, and the highest yield per mu is 986.32 kg / mu, which is much higher than that of the parent strain S2;at the same time, the fruiting temperature range of the strain is wide (5-22 ℃), which expands the cultivable area of Morchella, advances the suitable cultivation time of Morchella sextelata, and the strain has the advantages of neat fruiting, good traits and stable yield.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of edible mushroom cultivation, in particular to a Morchella sextelata strain KS1, a cultivation method and application thereof. BACKGROUND

[0002] Morchella esculenta is a rare edible and medicinal fungus, which is rich in nutrition, unique in flavor, and has high nutritional and medicinal value, can enhance immunity, anti-fatigue, anti-viral, anti-tumor, spleen and stomach, etc., and has important research and development value in food, medicine, health care and other aspects.

[0003] With the increasing demand of consumers for Morchella, the market demand for Morchella is increasing. There are still many problems in the Morchella industry, and the limited cultivation varieties of Morchella in China is one of the main problems. As the main Morchella cultivation species in China, Morchella sextelata currently has the problems of few cultivation varieties and high minimum fruiting temperature, which leads to the yield of Morchella sextelata being easily affected by environmental factors. Therefore, it is necessary to find a high-quality Morchella sextelata with stable yield and stable and uniform fruiting.

[0004] Research has found that Morchella contains two mating type genes (MAT1-1 and MAT1-2), and the presence of these two mating type genes may be a prerequisite for the production of fruiting bodies. However, the method of tissue separation is currently commonly used to obtain Morchella strains, but during tissue separation and subculture, the nuclei of Morchella cells are prone to uneven migration, which leads to the reduction or loss of a certain genotype in the strain, thereby leading to a decrease in yield or even no yield. SUMMARY

[0005] In view of the above technical problems, the present application provides a Morchella sextelata strain KS1, a cultivation method and application thereof, the fruiting temperature of the Morchella sextelata strain KS1 is 5-22℃, the fruiting is stable, uniform and high-yield, and has good stress resistance.

[0006] In order to achieve the above application purposes, the technical scheme adopted by the present application is as follows:

[0007] In a first aspect, the present application provides a Morchella sextelata strain KS1, which was preserved in the China General Microbiological Culture Collection Center on November 13, 2023, with a preservation number of CGMCC No. 40979 and a preservation address of No. 3, Beichen West Road, Chaoyang District, Beijing.

[0008] The application adopts hybridization breeding, and through screening of six sister Morchella esculenta and hybridization of high-quality single genotype strains, a high-quality strain KS1 with uniform fruiting, excellent properties and stable and high yield is obtained.

[0009] The second aspect of the application provides a preparation method of the master seed and the original seed of the strain KS1, and the steps include:

[0010] A culture medium is prepared, sterilized, and the strain KS1 is inoculated into a first culture dish containing the culture medium under sterile conditions for culture, so as to obtain the master seed of the strain KS1.

[0011] After the mycelium in the first culture dish is full, the mycelial cake is transferred to a second culture medium for culture under sterile conditions, so as to obtain the original seed of the strain KS1.

[0012] Preferably, the culture medium is a PDA culture medium, which can be composed of 20wt% potatoes, 2wt% glucose and 1.2wt% agar, and the pH is natural.

[0013] Preferably, the sterilization condition is sterilization at 115℃ for 30 minutes.

[0014] Preferably, the culture temperature of the master seed and the original seed is 12-14℃.

[0015] The third aspect of the application provides a preparation method of the cultivation seed of the strain KS1, and the steps include: preparing a cultivation culture medium, loading the cultivation culture medium into a cultivation bag, sterilizing, inoculating the original seed of the strain KS1, and culturing at 12-14℃ until the bag is full, so as to obtain the cultivation seed of the strain KS1.

[0016] The preparation method of the cultivation seed provided by the application can ensure normal growth and reproduction of the original seed under the conditions provided by the method, and is simple to operate and easy to realize industrialization.

[0017] In combination with the third aspect, the cultivation culture medium includes 30wt%-40wt% of culture material and 60wt%-70wt% of water; wherein the culture material includes 50wt%-70wt% of wheat grains, 10wt%-25wt% of bran, 15wt%-35wt% of corn cobs, 0.5wt%-1wt% of gypsum and 0.5wt%-1wt% of quicklime.

[0018] Preferably, the cultivation culture medium includes 40wt% of culture material and 60wt% of water; wherein the culture material includes 60wt% of wheat grains, 21wt% of bran, 17wt% of corn cobs, 1wt% of gypsum and 1wt% of quicklime.

[0019] The fourth aspect of the present application provides a cultivation method of the strain KS1, and the steps include:

[0020] S1, crushing the cultivated species and uniformly sowing or scattering on the surface of the bed according to the sowing amount of 200-250 kg / mu, and covering the soil by 2-3 cm;

[0021] S2, 7-15 days after sowing, when the mycelium germinated on the surface of the bed turns white, placing the nutrient bag according to the standard of 2600-3000 bags / mu;

[0022] S3, covering the perforated mulch film to control the air temperature below 15℃;

[0023] S4, carrying out the mushroom cultivation and management to ensure the normal growth of young mushrooms.

[0024] The cultivation method of the strain KS1 provided by the present application can ensure the vigorous growth of mycelium, and the mushrooms are neat and the yield is stable.

[0025] In step S2, the nutrient bag contains 35wt%-40wt% of nutrients and 60wt%-65wt% of water; wherein the nutrients include 45wt%-55wt% of wheat, 10wt%-20wt% of bran, 15wt%-35wt% of corn cob, 0.5wt%-1wt% of gypsum and 0.5wt%-1wt% of quicklime.

[0026] Preferably, the placement interval of the nutrient bag can be 25-35 cm, and the nutrient bag is placed in an interval, and 2 slits are drawn on one side of the nutrient bag, the slits are downward, and the nutrient bag is buckled on the surface of the bed covered with mycelium, and the mycelium of the morel is fully contacted with the nutrients in the nutrient bag by slightly compacting.

[0027] Exemplarily, the mushroom cultivation is specifically when the weight of the nutrient bag is obviously light, watering the mushroom, and the primordium appears after 1-3 days of watering.

[0028] In combination with the fourth aspect, in step S4, the mushroom management is specifically: maintaining the air humidity in the shed to be 85RH%-95RH%, and the temperature to be 5-22℃.

[0029] The lowest mushroom temperature of the strain KS1 provided by the present application is 5℃, which is lower than the lowest mushroom temperature of 8℃ or 10℃ of the existing six-sister morel, so that the suitable cultivation time of the six-sister morel is obviously advanced.

[0030] The fifth aspect of the present application provides a health care product or food, and the health care product or food contains the strain KS1.

[0031] The sixth aspect of the present application provides a molecular marker for identifying authenticity or infringement of the above-mentioned strain KS1, wherein the molecular marker is a DNA fragment with a length of 715bp, and the nucleotide sequence of the DNA fragment is shown as SEQ ID NO. 4.

[0032] The present application has the following advantages: the present application screens a Morchella sextelata strain KS1 by using hybridization breeding technology, and the average yield per mu of the strain KS1 can be as high as 918.79kg / mu, and the highest yield per mu is 986.32kg / mu, which is much higher than the yield per mu of the parent strain S2; meanwhile, the fruiting temperature range of the strain KS1 is wide (5-22℃), which expands the cultivable area of Morchella, and the strain KS1 has the advantages of neat fruiting, good traits and stable yield. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 Fig. 2 is a photograph of the strain KS1 obtained in Example 2 of the present application, wherein (a) is a photograph of the obtained strain, and (b) is a photograph of the longitudinal section of the strain;

[0034] Figure 2 Fig. 4 is a photograph of the electrophoretic detection result corresponding to the primer sequence No. 4 in Example 2 of the present application, wherein M represents a DL2000 molecular marker, the sizes of the bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp in turn, 1 is the parent strain S2-125, 2 is the strain KS1, and 3 is the parent strain A3-23;

[0035] Figure 3 Fig. 39 is a photograph of the electrophoretic detection result corresponding to the primer sequence No. 39 in Example 2 of the present application, wherein M represents a DL2000 molecular marker, the sizes of the bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp in turn, 1 is the parent strain S2-125, 2 is the strain KS1, and 3 is the parent strain A3-23;

[0036] Figure 4 Fig. 5 is a photograph of the confrontation experiment of the strain KS1 with its parent strains S2-125 and A3-23 in Example 3 of the present application;

[0037] Figure 5 Fig. 6 is a photograph of the cultivated fruiting body of the strain KS1 in Example 5 of the present application. DETAILED DESCRIPTION

[0038] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with specific examples. It should be understood that the specific examples described herein are only used to explain the present application and not to limit the present application.

[0039] In the following examples, the parent strains used are S2-125 and A3-23, which are purchased from Hebei Academy of Sciences Biological Research Institute and obtained from the fruiting bodies of parent strains S2 and A3 through tissue isolation.

[0040] The Morchella sextelata strain KS1 provided by the present application is preserved in the China General Microbiological Culture Collection Center on November 13, 2023, with a preservation number of CGMCC No. 40979 and a preservation address of No. 3, Beichen West Road, Chaoyang District, Beijing.

[0041] In the following examples, PDA solid medium is used, and the specific preparation method is as follows:

[0042] 200g of potatoes is cut into pieces, boiled in boiling water for 30 minutes, and then filtered. 20g of glucose and 12g of agar are added, and then distilled water is added to 1000mL. While stirring, heat to dissolve the agar, and then distribute to 500mL triangular flasks, with each flask containing 250-300mL. Sterilize at 115℃ for 30 minutes.

[0043] Unless otherwise specified, the test methods used in the following examples are conventional methods in the art, and the reagents and culture media used are commonly used reagents and culture media in the art.

[0044] Example 1

[0045] The present application provides a method for isolating and screening the Morchella sextelata strain KS1, which specifically includes:

[0046] 1. Obtaining a single genotype tissue isolated strain

[0047] Nine Morchella sextelata fruiting bodies were collected from different regions. Under sterile conditions, 1mm tissue from the cap or stem of the fruiting body was taken from the part not in contact with the outside world on PDA solid medium, and cultured at 20℃ in the dark. A total of 132 strains were obtained.

[0048] 2. Determination of mycelial growth rate at different temperatures

[0049] After the 132 obtained strains grew on the culture dishes, a 5mm cake was taken from the edge of the culture dish using a puncher, inoculated in the center of a culture dish containing 20mL of PDA solid medium, and placed in 10℃, 20℃ and 30℃ respectively. The mycelial diameter of each strain was measured after two days of culture, and the mycelial growth rate was calculated.

[0050] 3. Mating type identification

[0051] 3.1. Extraction of genomic DNA

[0052] 0.1 g of mycelium of each of the above strains (a total of 132) was weighed and ground in liquid nitrogen, and genomic DNA was extracted using a kit. The specific method is described in the instruction manual of the Plant Genomic DNA Extraction Kit (Centrifugal Column Type) of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0053] Primers MAT1-1-1TF / R (the sequence is shown in SEQ ID NO. 1) and primers MAT1-2-1TF / R (the sequence is shown in SEQ ID NO. 2) were designed according to the literature.

[0054] 3.2. PCR amplification

[0055] A 20 μL system was adopted, and the extracted genomic DNA was used as a template for amplification, wherein 10 μL of 2x Taq PCR MasterMix, 0.5 μL of primers, 20 ng of DNA template, and ddH2O were supplemented to 20 μL. The PCR amplification conditions were 3 min of initial denaturation at 94°C, 30 s of denaturation at 94°C, 15 s of annealing at 60°C, 30 s of extension at 72°C, 35 cycles, and 5 min of extension at 72°C.

[0056] 3.3. Electrophoresis detection

[0057] The PCR amplification products were subjected to electrophoresis detection using 1% agarose gel, and single specific bands were obtained.

[0058] 4. Pairing and screening of high-quality single genotype strains

[0059] According to the fruiting body source, mycelial growth rate, and mating type, 6 MAT1-1 genotype strains and 6 MAT1-2 genotype strains were screened. The 12 single genotype strains screened were paired two by two, and 5 mm of the fungus cake on the antagonistic line was transferred to PDA solid medium 3-5 days after the antagonistic line was generated, and cultured at 12.5°C and 25°C, respectively. The strains with fast mycelial growth rate and strong growth potential were selected, the gametophyte genotype was identified, and 8 double genotype strains were obtained.

[0060] 5. Cultivation and screening

[0061] The 8 strains obtained were subjected to cultivation test, and a target strain KS1 was obtained by comparing the yield, quality, and stress resistance of each strain, and the parent strains of which were S2-125 (MAT1-1 genotype) and A3-23 (MAT1-2 genotype).

[0062] Example 2

[0063] The embodiment of the present application provides a method for identifying the Morchella esculenta strain KS1, and specifically comprises the following steps:

[0064] 1. Morphological observation of the strain KS1

[0065] The fruiting body is single or in a small cluster. The cap is conical, blunt and round at the top, and the longitudinal ridge is not obvious and sparse. The color is brown to dark brown. The cap is 96.45±19.32 mm long and 58.63±16.16 mm wide, and the length / width ratio is 1.69±0.24. The cap thickness is 9.01±0.85 mm. The stipe is 43.45±17.65 mm long and 32.86±18.26 mm in diameter, and the color is white. The junction between the cap and the stipe is not obviously concave, and the longitudinal section of the stipe is trapezoidal. As shown in the following figure.

[0066] 1.69±0.24, the cap thickness is 9.01±0.85 mm. The stipe is 43.45±17.65 mm long and 32.86±18.26 mm in diameter, and the color is white. The junction between the cap and the stipe is not obviously concave, and the longitudinal section of the stipe is trapezoidal. As shown in the following figure. Figure 1

[0067] 2. ITS identification

[0068] 2.1. Extraction of genomic DNA

[0069] 0.1 g of mycelium of the strain KS1 is weighed and ground in liquid nitrogen, and the genomic DNA is extracted by using a kit. The specific method is shown in the instruction manual of the Plant Genomic DNA Extraction Kit (Centrifugal Column Type) of Tian Gen Bio-Engineering Science and Technology (Beijing) Co., Ltd.

[0070] 2.2. PCR amplification

[0071] The universal primer ITS1 (the sequence is shown in SEQ ID NO. 3) is used for amplification by using the extracted genomic DNA as a template. The 20 μL system is used for PCR amplification, wherein 2×Taq PCR Master Mix is 10 μL, the primers are each 0.5 μL, the DNA template is 20 ng, and ddH2O is supplemented to 20 μL. The PCR amplification conditions are as follows: 94℃ pre-denaturation for 2 min, 94℃ denaturation for 40 s, 52℃ annealing for 1 min, 72℃ extension for 1 min, a total of 35 cycles, 72℃ extension for 5 min, and 4℃ storage.

[0072] 2.3. Sequence determination

[0073] ​The PCR product was detected by 0.8% agarose gel electrophoresis, and a single specific band was obtained. The PCR product was sent to Shenguo Bioengineering (Shanghai) Co., Ltd. for sequencing, and the ITS sequence obtained by sequencing is shown as SEQ ID NO. 4, specifically GGGGACTTCAGACACACAGAAAGGGCTGCTATAGGGGCCGGCAGGGCTAGTAGCTTTACGTTGTTGAACGTCCTGTTTGGACCCGTTGGCAGCCCCCATCTAAACCCTCTGCGTACCTGTCCCCCCTTGCTTCCCCCGGCACCTCGCTGGGGGGAGGAACAACAACCAAAACTCTTTGTGAACAAACAGACGTCAGAATTACAAAAACAAAAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTGATTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTAGTTTCCCAATGTCCTAAATAGACGTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATATAGGCTTGCAGTAAAATGCTCACCTTTCTCCATACGCCGATGGCACACCGGTCGCAGTTGCGGGCGTAAATTGGAGTCCTCTTCAGGACCCTCGTGGCCTAGCATCCACCATACATAATTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAAACGGGGAGGAA. The BLAST tool software in GenBank was used for homologous DNA sequence search and comparison, and the results showed that KS1 belongs to Ascomycota, Pezizomycetes, Pezizales, Morchellaceae, Morchella, Morchella sextelata.

[0074] 3. ISSR identification

[0075] According to the People's Republic of China agricultural industry standard "Edible Fungus Strain Authenticity Identification ISSR Method" (NY / T 1730-2009) and the existing literature reports, the authenticity of the strain KS1 is analyzed. The specific identification method includes:

[0076] 3.1, Genomic DNA extraction

[0077] The genomic DNA used in this experiment is extracted by CTAB method, and the specific method is as follows:

[0078] 1) Take 0.2g mycelium of strain KS1, put it in a mortar, and grind it into powder in liquid nitrogen.

[0079] 2) The mycelium powder is quickly transferred into a 1.5mL centrifuge tube, 800μL of 65℃ preheated CTAB extraction buffer is added, mixed well, and placed in a 65℃ water bath for 40min-60min, and gently mix once every 15-20min during the period.

[0080] 3) Add 500μL of chloroform:isopropyl alcohol (24:1) to the lysed DNA, mix gently, stand for 15min, and centrifuge at 4℃x12000rpmx10min.

[0081] 4) Transfer the supernatant to a new 1.5mL centrifuge tube, add an equal volume of-20℃ pre-cooled isopropyl alcohol, mix slowly and then vigorously, so that the DNA forms a lump, and stand at-20℃ overnight.

[0082] 5) Centrifuge the precipitated DNA, conditions: 4℃x12000rpmx10min.

[0083] 6) Remove the supernatant, wash the precipitate with 500μL of 75% ethanol, centrifuge at 4℃x12000rpmx10min, and wash again, centrifuge at 4℃x12000rpmx5min.

[0084] 7) Centrifuge at 4℃x3000rpmx1min, completely evaporate the ethanol, dissolve in 100μL of ddH2O, and stand at 4℃ for dissolution.

[0085] K5800 ultramicro spectrophotometer measures DNA concentration and purity.

[0086] 3.2, PCR amplification

[0087] The total volume of the PCR reaction was 20 μL, containing 1 μL template DNA, 1 μL primer, 10 μL Taq PCR Master Mix, and 8 μL dd H O. The following cycles were performed in a PCR amplifier: initial denaturation at 95°C for 5 min, followed by denaturation at 95°C for 15 s, annealing at 5°C below the primer Tm for 15 s, and extension at 72°C for 20 s, for a total of 35 cycles, followed by extension at 72°C for 5 min, and storage at 4°C.

[0088] Five primers with obvious amplification and good polymorphism were screened from 50 primers. The primer sequences and numbers are shown in Table 1.

[0089] Table 1

[0090] Number Primer sequence Sequence name 4 ACACACACACACACACC SEQ ID NO. 5 17 GCATGAGAGAGAGAGAG SEQ ID NO. 6 29 GAGAGAGAGAGAGAGAC SEQ ID NO. 7 30 GAGAGAGAGAGAGAGAAC SEQ ID NO. 8 39 AGCAGCAGCAGCAGCAGCG SEQ ID NO. 9

[0091] 3.3 Electrophoresis detection

[0092] Detect the PCR amplification product by electrophoresis on a 1% agarose gel: Spot 4 μL of the PCR amplification product and run the electrophoresis at 120 V. Stop the electrophoresis when the bromophenol blue is approximately 1 cm from the leading edge of the gel. Observe and photograph the gel using a gel imager.

[0093] Figure 2 and Figure 3 The following are photos of the electrophoresis detection results corresponding to the primer sequences numbered 4 and 39 in Table 1. It can be seen from the figures that strain KS1 and the parent strains S2-125 (MAT1-1 genotype) and A3-23 (MAT1-2 genotype) are different strains.

[0094] Example 3

[0095] A confrontation experiment was conducted on the strain KS1 provided by the present invention and its parent strains S2-125 and A3-23. The culture medium used was the PDA solid culture medium prepared according to the above method, and a petri dish with a diameter of 9 cm was used. The specific method was as follows: the strain KS1 and its parent strains S2-125 and A3-23 were inoculated into the culture medium in a triangular shape with each being 2 cm away from the center of the petri dish, and cultured at a constant temperature of 12.5°C.

[0096] The results of the confrontation experiment are as follows Figure 4 As shown, it can be seen that at the junction of the colonies, the antagonistic lines of strain KS1 and its parent strains S2-125 and A3-23 are more obvious, indicating that the strain KS1 screened by the present invention and its parent strains S2-125 and A3-23 are not the same strain, and the strain screened by the present invention is a new six-sister morel strain.

[0097] Example 4

[0098] This embodiment provides a method for preparing a mother strain and a stock strain of strain KS1, comprising the following steps:

[0099] Prepare PDA solid culture medium according to the above method, sterilize at 115°C for 30 minutes, and inoculate strain KS1 into the culture medium under sterile conditions for culture to obtain the mother strain of strain KS1; after the mother strain mycelium fills the culture dish, take a 5 mm bacterial cake under sterile conditions and transfer it to another culture medium for culture to obtain the original strain of strain KS1.

[0100] The formula of the PDA culture medium used is: 20wt% potato, 2wt% glucose and 1.2wt% agar, with a natural pH. The culture temperature of the mother culture and the original culture is 12-14°C.

[0101] Example 5

[0102] This embodiment provides a method for preparing a cultivar of strain KS1, comprising the following steps:

[0103] Prepare a cultivation medium: the formula includes 40wt% of culture medium and 60wt% of water, the culture medium includes 60wt% of wheat grains, 21wt% of bran, 17wt% of corn cobs, 1wt% of gypsum and 1wt% of quicklime, wherein the wheat grains and corn cobs are pretreated as follows: soak the wheat grains in lime water with a mass concentration of 1% until there is no white core, and soak the corn cobs with sufficient water for fermentation.

[0104] The prepared cultivation medium was placed into a 16 cm × 33.5 cm × 0.02 cm polypropylene plastic bag (i.e., a cultivation bag), the dry material weight of each bag was controlled at 250-300 g, and sterilized at 121°C. The original strain of strain KS1 was then inoculated and cultured at 12-14°C until the bag was full to obtain the cultivated strain KS1.

[0105] Example 6

[0106] This embodiment provides a cultivation method of strain KS1, comprising the following steps:

[0107] Sowing: Crush the cultivated seeds obtained in Example 5 and evenly sow them on the surface of the bed at a sowing rate of 200-250 kg / mu, and cover with 2-3 cm of soil.

[0108] Placing exogenous nutrition bag: 7-15 days after sowing, when the mycelium germinated on the surface of the bed turns white, place the nutrition bag at a standard of 2600-3000 bags per mu, wherein the formula composition in the nutrition bag includes 40wt% of nutrients and 60wt% of water, and the nutrients specifically include 50wt% of wheat grains, 15wt% of bran, 33wt% of corn cob, 1wt% of gypsum and 1wt% of quicklime. The size of the nutrition bag used is 16cm*33.5cm*0.02cm, the dry weight of each bag is 380-420g, and the nutrition bag is used after sterilization at 121℃. In addition, the nutrition bag is placed at an interval of about 30cm in an interval placement mode, and 2 slits are made on one side of the nutrition bag, the slits are downward, and the nutrition bag is buckled on the surface of the bed covered with mycelium, and the mycelium of the Morchella is pressed slightly to make the mycelium fully contact the nutrients in the nutrition bag.

[0109] Covering the film: the perforated black film is covered on the surface, the ventilation is kept uniform and appropriate, and the air temperature is controlled below 15℃.

[0110] Morchella management: when the weight of the placed nutrition bag is obviously lightened, water is poured to induce Morchella. The primordium appears after 1-3 days of watering. The air humidity in the shed is kept at 85RH%-95RH%, the temperature is kept at 5-22℃ during the fruiting period, the ventilation is kept for 30-60min per day to ensure the normal growth of the young Morchella. The specific growth conditions can be referred to Figure 5 .

[0111] Harvesting management: when the fruiting body of Morchella no longer continues to swell, the ridge and the concave pit edge of the cap are distinct, the cap net has been fully opened, and the cap changes from hard to elastic, it is mature, and harvesting is performed.

[0112] The cultivation period of the strain KS1 provided by the application in the normal cultivation season of the northern warm shed is 98-118 days, and the cultivation period of the northern warm shed early Morchella can be shortened to 80-100 days.

[0113] Comparative Example 1

[0114] The parent strain S2 (double genotype) of the strain KS1 is used as a control strain in this comparative example, and the parent strain S2 is planted according to the preparation methods of the mother strain, the original strain and the cultivation strain and the cultivation method of the cultivation strain provided in Examples 3-5, the external conditions are the same as those in Examples 3-5, and the only difference is that the strain KS1 is replaced by the parent strain S2.

[0115] Test Example

[0116] When the Morchella obtained in Example 5 and Comparative Example 1 is harvested, 3 plots are randomly measured in the planting area of the strain KS1 and the parent strain S2, the area of each plot is 5.6m 2 , the yield of each plot is counted, and the yield per mu is calculated (yield per mu (kg / mu)=plot yield / 5.6m2 *667m 2 *0.7, 0.7 is a conversion factor). The specific statistics are shown in Table 2.

[0117] Table 2

[0118]

[0119] As can be seen from the data in Table 2, the yield per mu of the strain KS1 provided by the present application is significantly improved compared with the parent strain S2, and the average yield per mu is increased by as much as 40.3%.

[0120] The above description is merely preferred embodiments of the present application, but not to limit the present application, and any modification, equivalent replacement or improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. A strain of Six Sister Morel ( Morchella sextelata ) strain KS1, characterized in that It was deposited in the General Microbiology Center of China Culture Collection of Microorganisms on November 13, 2023, with the deposit number CGMCC No.40979, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. A method for preparing the mother strain and the original strain of the strain KS1 according to claim 1, characterized in that the steps include: preparing a culture medium, sterilizing it, and inoculating the strain KS1 into a first culture dish containing the culture medium under sterile conditions for culturing to obtain a mother strain of the strain KS1; After the hyphae in the first culture dish are fully grown, the bacterial cake is transferred to the second culture medium under sterile conditions for culture to obtain the stock of the strain KS1.

3. The preparation method according to claim 2, wherein The culture temperature of the mother strain and the original strain is 12-14°C.

4. A method for preparing a cultivar of the strain KS1 according to claim 1, characterized in that: Prepare a cultivation medium, put it into a cultivation bag, sterilize it, inoculate the original strain of the strain KS1, and cultivate it at 12-14° C. until the bag is full to obtain the cultivar of the strain KS1.

5. The preparation method according to claim 4, wherein The cultivation medium comprises 30 wt% to 40 wt% of culture material and 60 wt% to 70 wt% of water; The culture material includes 50wt% to 70wt% of wheat grains, 10wt% to 25wt% of bran, 15wt% to 35wt% of corn cobs, 0.5wt% to 1wt% of gypsum and 0.5wt% to 1wt% of quicklime.

6. A method for cultivating the strain KS1 according to claim 1, characterized in that the steps include: S1. Crush the cultivated seeds and sow them evenly in furrows or broadcast them on the surface of the bed at a sowing rate of 200-250 kg / mu, and cover them with 2-3 cm of soil. S2. 7 to 15 days after sowing, when the mycelium germinated on the surface of the bed turns white, nutrient bags are placed according to the standard of 2,600 to 3,000 bags per mu; S3. Cover with perforated film and control the temperature below 15℃; S4. Carry out mushroom induction and fruiting management to ensure the normal growth of young mushrooms.

7. The cultivation method of strain KS1 according to claim 6, characterized in that: In step S4, the mushroom production management is specifically as follows: maintaining the air humidity in the greenhouse at 85RH%-95RH%, and the temperature at 5~22°C.

8. A health product or food, characterized in that: The health product or food contains the strain KS1 according to claim 1.

Images