A method for constructing an atherosclerotic humanized mouse model

Abstract

The present application relates to a kind of construction method of atherosclerosis humanized mouse model, belong to genetic engineering and genetic modification technical field.The present application is first in ApoE and Ldlr double gene knockout mouse background and obtains NOD-4G gene knockout mouse by knockouting Prkdc and Il2rg gene in mouse, humanized atherosclerosis model is constructed by injecting human umbilical cord blood CD133+stem cell and high-fat feed feeding.Through to atherosclerosis degree analysis, it is found that the aorta and aortic root of the humanized atherosclerosis model constructed have a large number of plaque formation, and contain human CD45 + Leukocyte.This atherosclerosis humanized mouse model provides better animal genetic model for the analysis of the role of human immune cells in the occurrence and development of atherosclerosis disease, and has important significance for the research of human disease and the development of new therapy.

Description

TECHNICAL FIELD

[0001] The present application relates to a method for constructing an atherosclerosis humanized mouse model, and belongs to the field of genetic engineering and genetic modification. BACKGROUND

[0002] Atherosclerosis (AS) refers to the deposition of blood components such as lipids in the intima of the artery, the proliferation of smooth muscle cells and the increase of collagen fibers, forming a lipid-containing necrotic lesion and vascular wall hardening, which is one of the main causes of cardiovascular diseases. Atherosclerotic cardiovascular disease has become the leading cause of global population mortality, and its incidence and mortality have been continuously rising. Coronary atherosclerosis-induced myocardial infarction and cerebral atherosclerosis-induced cerebral infarction are the most harmful to humans and are the highest mortality cardiovascular diseases.

[0003] Chronic inflammation is a key factor leading to atherosclerosis, and immune cells continuously migrate to the vascular wall, and aggregate with lipids to cause the formation of atherosclerotic plaques. After the rupture of the plaque, thrombosis occurs, leading to cerebral infarction, coronary atherosclerotic heart disease and other disabling and fatal consequences. As can be seen, the immune system plays a crucial role in the occurrence and development of atherosclerosis. Therefore, it is essential to construct an immune system humanized mouse model to simulate the occurrence and development of human atherosclerosis, which is crucial for better understanding the mechanism of the disease and finding methods for treating the disease.

[0004] The most commonly used inbred C57BL / 6 mice have the advantages of consistent genetic background, short breeding cycle and mature genetic modification operation methods, and have become an important animal model for immunological research. ApoE gene knockout and ApoE gene functional deletion in C57BL / 6 background lead to mice susceptible to atherosclerosis, and are widely used in cardiovascular disease research. However, there are significant differences between mice and humans, and the morphology of atherosclerotic lesions and the proportion of inflammatory cells in the plaque are different, which to some extent limits the research of atherosclerotic disease immune mechanisms, the transformation of immunotherapy and drug screening. Therefore, how to use a mouse model to simulate the formation of human atherosclerotic plaques and the interaction with the immune system has also become a crucial link in the research of cardiovascular disease immunotherapy and drug screening.

[0005] However, the best background of the current humanized mouse, NOD mouse, has strong resistance to atherosclerosis, i.e. it is difficult to induce atherosclerosis in NOD mice, and even ApoE or LDLR-deficient NOD mice fed with high-fat diet are not easy to induce atherosclerosis. SUMMARY

[0006] The application aims to provide a method for constructing an atherosclerosis humanized mouse model, and provide a method for constructing an atherosclerosis humanized mouse model with a higher success rate.

[0007] To achieve the above-mentioned purpose, the technical scheme of the method for constructing an atherosclerosis humanized mouse model is as follows:

[0008] The method for constructing an atherosclerosis humanized mouse model comprises the following steps:

[0009] 1) A CRISPR / Cas9 genome editing technology is used to knockout Prkdc and Il2rg genes in the background of ApoE and Ldlr double gene knockout mice, to obtain a first constructed mouse, and the first constructed mouse is backcrossed and self-crossed to obtain a NOD-4G gene knockout mouse model;

[0010] (2) Human stem cells are injected into the bone marrow cavity of the mouse model obtained in step (1), and the mouse model is fed with high-fat feed to obtain an atherosclerosis humanized mouse model.

[0011] The above-mentioned technical scheme has the beneficial effects as follows: the method for constructing an atherosclerosis humanized mouse model is a development-oriented invention. Since NOD genetic background mice have a strong resistance to atherosclerotic diseases, in order to obtain a gene knockout mouse model capable of producing an atherosclerosis humanized mouse in the background of NOD genetic background mice, the Prkdc and Il2rg genes in the mouse are knocked out in the background of ApoE and Ldlr double gene knockout mice. Specifically, a new severe immunodeficient and atherosclerosis mouse model (referred to as NOD-4G gene knockout mouse) is obtained by editing the Prkdc and Il2rg gene sites in the background of ApoE and Ldlr double gene knockout mice through a CRISPR / Cas9 genome editing technology, and a humanized atherosclerosis model is constructed by injecting human umbilical cord blood stem cells and feeding with high-fat feed.

[0012] Further, it is the first time to knockout Prkdc, Il2rg, ApoE and Ldlr four genes in NOD genetic background mice using a CRISPR / Cas9 system, which has a high originality and a very important basic research and practical application value, and also provides a good mouse genetic model for researching atherosclerosis, type I diabetes and complications thereof. The atherosclerosis humanized mouse model provides a better animal genetic model for analyzing the role of human immune cells in the occurrence and development of atherosclerotic diseases, and has important significance for researching human diseases and developing new therapies.

[0013] NOD is the abbreviation of Non Obese Diabetes. NOD mice are a kind of spontaneous type I diabetes model mice.

[0014] Specifically, the founder mouse in step (1) is constructed by the following method: selecting Prkdc and Il2rg gene knockout targets, synthesizing sgRNA and Cas9 mRNA; co-injecting the sgRNA and Cas9 mRNA into in vitro fertilized egg cells, and transplanting into ApoE and Ldlr double gene knockout pseudopregnant female mice to obtain the founder mouse.

[0015] As a further improvement, the Prkdc and Il2rg gene knockout sites in step (1) are as follows:

[0016] Il2rg-sgRNA: GGAGCAACAGAGATCGAAGCTGG (as shown in SEQ ID NO. 1);

[0017] Prkdc-sgRNA1: CAGTAGCCAACACCGTACGCCGG (as shown in SEQ ID NO. 2);

[0018] Prkdc-sgRNA2: GATCCTCAGAAGCATCTGCGTGG (as shown in SEQ ID NO. 3).

[0019] As a further improvement, step (1) includes identification of the genotype of the founder mouse.

[0020] The primer sequences used in the identification of the genotype of the founder mouse are as follows:

[0021] Il2rg-F: 5'-AGTAGCCAAGAGAGCAGGGA-3' (as shown in SEQ ID NO. 4);

[0022] Il2rg-R: 5'-ATGGTGGGAGAGGCAAAGTG-3' (as shown in SEQ ID NO. 5);

[0023] Prkdc-F1: 5'-CATTTGCGTTGTCCCGAGTG-3' (as shown in SEQ ID NO. 6);

[0024] Prkdc-R1: 5'-GACGTTGACTACACGCACCA-3' (as shown in SEQ ID NO. 7);

[0025] Prkdc-F2: 5'-GCCAGCGCATAGTGAGAACT-3' (as shown in SEQ ID NO. 8);

[0026] Prkdc-R2: 5'-TCTGCAAGCAAGTTTCTGGGA-3' (as shown in SEQ ID NO.9).

[0027] As a further improvement, the human stem cells in step (2) are human CD133+ stem cells.

[0028] The beneficial effects of the above technical solution are as follows: By injecting CD133+ stem cells into the bone marrow cavity of NOD-4G gene knockout mice, this invention has found that a large number of plaques are formed in the aorta and aortic root of the constructed humanized atherosclerosis model, and these plaques contain a large amount of human CD45. + leukocyte.

[0029] As a further improvement, the high-fat feeding in step (2) is a high-fat diet with a fat content of 20-25% and a cholesterol content of 1-1.5%.

[0030] As a further improvement, the high-fat feeding period shall be no less than 16 weeks. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of the Il2rg gene knockout in Example 1 of the present invention and a Sanger sequencing result diagram;

[0032] Figure 2 This is a schematic diagram of Prkdc gene knockout in Example 1 of the present invention and a Sanger sequencing result diagram;

[0033] Figure 3 The results of peripheral blood flow cytometry analysis of immune cell populations in NOD-4G mice in Example 1 of this invention;

[0034] Figure 4 For the pathological examination of the aorta in humanized mice with atherosclerosis in Example 3 of the present invention (wherein, (A) is NOD Prkdc – / – IL2rg – / – Apoe – / – Ldlr – / – (NOD-4G), NOD Apoe – / – Ldlr – / – NOD Apoe – / – and NODPrkdc – / – IL2rg – / –(A) shows the gross Oil Red stained images and plaque statistics of the descending aorta of four groups of mice after 16 weeks of high-fat diet; (B) shows the HE and Oil Red O stained images and plaque statistics of the aortic root of the four groups of mice, *** indicates P<0.001, ns indicates no significant difference);

[0035] Figure 5 This is a test of human CD45+ leukocytes in the aortic root of a humanized mouse with atherosclerosis, as described in Example 3 of this invention. Detailed Implementation

[0036] Mice, as model animals, have advantages such as consistent genetic background, short breeding cycle, and mature gene modification techniques, making them important animal models for immunological research. Among them, humanized mouse models of atherosclerosis are crucial for understanding the disease mechanism and finding treatments for atherosclerosis. However, the optimal humanized mouse background, NOD mice, exhibits strong resistance to atherosclerosis; that is, it is difficult to induce atherosclerosis in NOD mice, and even high-fat fed ApoE or LDLR single-gene defective NOD mice are not easily induced to develop atherosclerosis. Based on this, this invention provides a method for constructing a humanized mouse model of atherosclerosis.

[0037] This invention, through CRISPR / Cas9 genome editing technology, for the first time obtained a novel humanized mouse model (NOD-4G gene knockout mouse) by knocking out the Prkdc and Il2rg genes in ApoE and Ldlr double gene knockout mice. A humanized atherosclerosis model was then constructed by injecting human umbilical cord blood CD133+ stem cells and feeding the mice a high-fat diet. Analysis of the degree of atherosclerosis revealed that the constructed humanized atherosclerosis model had extensive plaque formation in the aorta and aortic root, containing a large amount of human CD45. + leukocyte.

[0038] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto; however, these embodiments are merely examples and do not constitute any limitation on the scope of the present invention. Modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the present invention, but such modifications and substitutions all fall within the scope of protection of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, such as those described in Sambrook et al.'s *Molecular Cloning: A Laboratory Manual* (Sambrook J & Russell DW. *Molecular Cloning: A Laboratory Manual*. 2001), or the instructions provided by the product manufacturer. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent manufacturers.

[0039] NOD ApoE used in the following examples – / – Ldlr – / – The method for constructing mice (with simultaneous knockout of ApoE and Ldlr genes in NOD genetic background mice) includes the following steps: Simultaneous knockout of the ApoE and Ldlr genes in NOD mice yields the mouse. For specific construction methods, please refer to the Chinese invention patent application document published on July 6, 2018, with publication number CN108251456A.

[0040] A specific embodiment of the method for constructing a humanized mouse model of atherosclerosis according to the present invention:

[0041] This invention is the first to utilize CRISPR / Cas9 genome editing technology to edit NOD ApoE. – / – Ldlr – / – NOD-4G mice were obtained by knocking out the Prkdc and Il2rg gene loci in mice. A humanized atherosclerosis model was then constructed by injecting human umbilical cord blood CD133+ stem cells and feeding the mice with a high-fat diet. The specific procedures are as follows:

[0042] Example 1: Construction of the NOD-4G gene knockout mouse model

[0043] This embodiment designs targeting sgRNAs (such as exon4 of the mouse Il2rg gene, exon1 and exon12 of the Prkdc gene) to target exon2. Figure 1 and Figure 2 As shown in the figure, sgRNA and Cas9 mRNA were injected into mouse zygotes using a microinjection system, and the surviving zygotes were transplanted into the oviducts of pseudopregnant female mice to construct a mouse model. The specific steps included:

[0044] 1. Determination of the firing sequence

[0045] Based on the CRISPR / Cas9 system principles, the NOD ApoE was determined using the CRISPOR online design software. – / – Ldlr – / – The specific target sites Il2rg-sgRNA, Prkdc-sgRNA1, and Prkdc-sgRNA2 of the mouse genes to be knocked out (Gene ID: 96551) and (Gene ID: 104779).

[0046] Specifically, the mouse Il2rg (Transcript ID: ENSMUST00000033664.14) and Prkdc (Transcript ID: ENSMUST00000023352.9) gene DNA sequences were found in the mouse genome database ensembl (http: / / asia.ensembl.org). Then, using the online design software CRISPOR (http: / / crispor.tefor.net / crispor.cgi), one specific site was selected in exon4 (exon ID: ENSMUSE00001294258) of the mouse Il2rg gene, and one specific site was selected each in exon1 (exon ID: ENSMUSE00001271905) and exon12 (exon ID: ENSMUSE00001243557) of the Prkdc gene as the target sequences for sgRNA. The target sequences are as follows:

[0047] Il2rg-sgRNA: GGAGCAACAGAGATCGAAGCTGG (as shown in SEQ ID NO.1);

[0048] Prkdc-sgRNA1: CAGTAGCCAACACCGTACGCCGG (as shown in SEQ ID NO.2);

[0049] Prkdc-sgRNA2: GATCCTCAGAAGCATCTGCGTGG (as shown in SEQ ID NO.3).

[0050] 2. Biosynthesis to obtain sgRNA and Cas9 mRNA

[0051] The biosynthesis was provided by Nanjing Genscript Biotech Co., Ltd.

[0052] 3. Microinjection

[0053] The obtained sgRNA and Cas9 mRNA were injected into mouse zygotes using a microinjection system.

[0054] Specifically, through analysis of NOD ApoE in 8-week-old infants – / – Ldlr – / – Background: Female mice were injected with hormones, and fertilized oocytes were obtained after superovulation and mating. Three sgRNA mRNAs and Cas9 mRNA were diluted to a final concentration of 50 ng / μL using RNase-free ultrapure water (Invitrogen, 10977015), mixed, and injected into NODApoE via a microinjection system. – / – Ldlr– / – In the background, mouse fertilized egg cells are placed in an incubator (37°C, CO2 concentration of 5%) for 1 hour, and the surviving cells are selected and transplanted into the oviduct of pseudopregnant ICR female mice. After 20 days, the Founder mice can be obtained.

[0055] 4. Genotyping and sequencing verification of Founder mice

[0056] The tails of the obtained Founder mice were cut off, and DNA was extracted. This DNA was then used as a template for PCR amplification using primers. The primer sequences used were:

[0057] Il2rg-F: 5'-AGTAGCCAAGAGAGCAGGGA-3' (as shown in SEQ ID NO.4);

[0058] Il2rg-R: 5'-ATGGTGGGAGAGGCAAAGTG-3' (as shown in SEQ ID NO.5);

[0059] Prkdc-F1: 5'-CATTTGCGTTGTCCCGAGTG-3' (as shown in SEQ ID NO. 6);

[0060] Prkdc-R1: 5'-GACGTTGACTACACGCACCA-3' (as shown in SEQ ID NO.7);

[0061] Prkdc-F2: 5'-GCCAGCGCATAGTGAGAACT-3' (as shown in SEQ ID NO. 8);

[0062] Prkdc-R2: 5'-TCTGCAAGCAAGTTTCTGGGA-3' (as shown in SEQ ID NO.9).

[0063] The PCR reaction system was as follows: 20 ng of mouse tail DNA was added as template; 2 μL of upstream primer was added; 2 μL of downstream primer was added; 25 μL of 2×Taq Master Mix (purchased from vazyme, P111-01) was added; and H2O was added to a total volume of 50 μL.

[0064] The PCR reaction program was as follows: 94℃, 5 min; 94℃, 30 s; 60℃, 30 s; 72℃, 30 s; 72℃, 10 min; 30 cycles. The Il2rg wild-type DNA template amplification fragment was 501 bp in length (as shown in SEQ ID NO. 10), the Prkdc wild-type DNA template amplification fragment (for exon 1) was 448 bp in length (as shown in SEQ ID NO. 11), and the Prkdc wild-type DNA template amplification fragment (for exon 12) was 591 bp in length (as shown in SEQ ID NO. 12).

[0065] After obtaining the PCR product, take 2 μL of the product for electrophoresis detection. If there is a band, send the PCR product for sequencing.

[0066] Depend on Figure 1 and Figure 2 It can be seen that in the obtained Founder mice, the Il2rg gene is missing 7 bases, the Prkdc gene exon1 is missing 39 bases, and the Prkdc gene exon12 is missing 6 bases.

[0067] 5. Four gene knockout homozygous mice were obtained by backcrossing and selfcrossing the Founder mice.

[0068] Founder mice, which were identified as having successfully knocked out the Il2rg and Prkdc genes, were compared with NOD ApoE mice. – / – Ldlr – / – After backcrossing mice, NOD ApoE can be obtained. – / – Ldlr – / – Il2rg + / – Prkdc + / – Mice, then selected NOD ApoE – / – Ldlr – / – Il2rg + / – Prkdc + / – Mouse self-crossing resulted in the acquisition of four gene knockout homozygous NOD ApoE mice. – / – Ldlr – / – Il2rg – / – Prkdc – / – (i.e., NOD-4G mice).

[0069] Flow cytometry was used to detect peripheral blood immune cells in NOD-4G mice: Peripheral blood was collected from NOD-4G mice and wild-type control NOD mice, and then labeled with specific antibodies for detection using flow cytometry. Specifically, an antibody mixture (CD3E-FITC; IgM-PE; CD19-Super Bright 600; CD335-PE-Cyanine7; B220-APC; CD45-APC-eFluor 780) was first prepared, then 40 μL of fresh blood was drawn, and 10 μL of the antibody mixture was added. After thorough mixing, the mixture was incubated at 4°C in the dark for 30 min. After incubation, 400 μL of erythrocyte lysis buffer was added, and after thorough mixing, the mixture was incubated at room temperature in the dark for 10 min. After the reaction was completed, flow cytometry was used for detection. The results showed that ( Figure 3 NOD-4G mice no longer have T cells (CD3e+), B cells (CD19+), and NK cells (CD335+) in their peripheral blood.

[0070] Example 2: Isolation of CD133+ stem cells from human umbilical cord blood and intramedullary injection in mice

[0071] In this embodiment, CD133+ stem cells were isolated from human umbilical cord blood and injected into the NOD-4G gene knockout mouse model obtained as in Example 1. The specific steps included are as follows:

[0072] 1. Isolation of CD133+ stem cells from human umbilical cord blood

[0073] (1) Dilute the blood: Add 20 mL of Ficoll separation solution to each 50 mL centrifuge tube, and then slowly add the diluted blood (20 mL of blood and 20 mL of Buffer 1 (PBS containing 2% FBS)) along the tube wall;

[0074] (2) After centrifuging at 800g for 20 minutes at room temperature, add the white membrane layer to a new centrifuge tube and add an equal volume of Buffer 1. Centrifuge again at 300g for 8 minutes at room temperature. Discard the supernatant, wash twice with 10mL Buffer 1, add 10mL Buffer 2 (PBS containing 0.5% FBS) to resuspend the cells and count them.

[0075] (3) Bead sorting: After counting, centrifuge at 300g at room temperature for 10min, resuspend cells in Buffer 2 (10×8 / 300μL), then add 100μL FCR Blocking Reagent and 100μL CD133+ magnetic beads (Mittennis), mix well and incubate at 4℃ for 30min; add 2mL PBS to wash, centrifuge at 300g for 10min; discard the supernatant and add 500μL PBS to resuspend cells (10×8 cells per cell); place the MS separator on a magnetic rack, and place a 5mL centrifuge tube below to collect waste liquid; wash the column twice with PBS, add cell suspension, and then wash the column three times with Buffer 2; remove the column from the magnetic field, transfer it to a 1.5mL centrifuge tube, add 1mL Buffer 2, pressurize with a stopcock, and collect the target cells;

[0076] (4) After counting the cells, centrifuge at 300g for 10 min, and then dilute the cells with PBS (10×5 / 20μL).

[0077] Note: The isolation kit used was the CD133 sorting kit (Mitteni, catalog number: 130-100-830).

[0078] 2. Intraosseous injection of CD133+ stem cells into mice

[0079] (1) After anesthetizing mice with 5% tribromoethanol (0.6mL / 30g), shave the hair at the knee of the left or right leg to expose the white ligament. Insert the needle through the white ligament, with the needle parallel to the tibia, and rotate the syringe along the direction of the tibia to insert it.

[0080] (2) After the injection, place a layer of sterile absorbent paper in the mouse cage, place the mouse on it, cover it with absorbent paper, and finally place it in the isolation chamber. Check the mouse's condition 6 hours later.

[0081] Note: Simultaneously with intraosseous injection of CD133+ stem cells into NOD-4G gene knockout mice, NOD-background ApoE and Ldlr double gene knockout mice (hereinafter referred to as NOD Apoe) were selected. – / – Ldlr – / – (Mouse), NOD background ApoE gene knockout mice (hereinafter referred to as NOD Apoe) – / – (Mouse) and NOD-background double knockout mice of the Prkdc and Il2rg genes (hereinafter referred to as NOD Prkdc) – / – IL2rg – / – Mice were injected with CD133+ stem cells into the bone marrow cavity using the same procedure.

[0082] Example 3: Construction of a humanized mouse model of atherosclerosis and analysis of the degree of atherosclerosis

[0083] In this embodiment, mice that underwent intraosseous injection in Example 2 underwent high-fat feeding were used to construct a humanized mouse model of atherosclerosis. The degree of atherosclerosis was analyzed using Oil Red staining. The specific steps included:

[0084] 1. Construction of a humanized mouse model of atherosclerosis

[0085] NOD Prkdc, which was administered via intraosseous injection in Example 2, was used. – / – IL2rg – / – Apoe – / – Ldlr – / – (NOD-4G), NODApoe – / – Ldlr – / – NOD Apoe – / – and NOD Prkdc – / – IL2rg – / – Mice were fed a high-fat diet for 16 weeks starting at 7-8 weeks of age. The high-fat diet contained 21% fat and 1.25% cholesterol.

[0086] 2. Oil Red O staining

[0087] After 16 weeks of high-fat diet, mice were anesthetized, weighed, and blood was collected from their eyeballs. The mouse hearts were then harvested and embedded in OCT embedding medium for subsequent frozen sectioning and Oil Red O staining. Simultaneously, the mouse aorta was isolated and subjected to gross Oil Red O staining of the blood vessels. The results are as follows: Figure 4 As shown.

[0088] Both the gross Oil Red O staining results of the aorta and the Oil Red O staining results of the aortic root indicate that NOD Prkdc – / – IL2rg – / – Mice showed almost no plaque formation, NOD Apoe – / – Mice showed a small number of plaque formations, NOD Apoe – / – Ldlr – / – Both the humanized NOD-4G mice and the humanized NOD-4G mice showed extensive plaque formation.

[0089] 3. Flow cytometry analysis

[0090] A complete mouse aorta was removed and placed in a cell culture dish. 400 μL of PBS was added, and the aorta was cut into a chyme-like consistency using ophthalmic scissors and transferred to 2 mL tubes. 10 μL of compound collagenase and 10 μL of DNase I were added to each tube. The tubes were incubated at 37°C with shaking at 300 rpm for 30 minutes. The tubes were then washed twice with Facs Buffer (centrifuged at 1500 rpm for 5 minutes at 4°C). 100 μL of 2.4G2 was added, and the tubes were incubated at 4°C for 20 minutes, followed by washing once with Facs Buffer. 100 μL of antibody mixture (anti-hCD45 PE, anti-mCD45 PE, anti-mCD45 BV605, anti-hCD45 FITC, anti-hCD3 BV421, anti-hCD19PE-Cy5.5) was added to each tube, and the tubes were incubated at 4°C in the dark for 30 minutes, followed by washing twice with Facs Buffer. Add 400 μL Sytox Blue, mix thoroughly by pipetting, filter, load onto flow cytometer, and finally analyze the results using FlowJO. Specific results are shown below. Figure 5 As shown.

[0091] Aortic flow cytometry results showed that only NOD-4G mice injected with human CD133+ stem cells had a large number of human CD45+ leukocytes in their aorta, indicating that the humanized mouse model of atherosclerosis was successfully constructed.

[0092] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing a humanized mouse model of atherosclerosis, characterized in that: Includes the following steps: (1) Using CRISPR / Cas9 genome editing technology, Prkdc and Il2rg genes were knocked out in mice under the background of ApoE and Ldlr double gene knockout mice to obtain the first mice, and NOD-4G gene knockout mouse model was obtained by backcrossing and selfcrossing. (2) Human stem cells are injected into the bone marrow cavity of the mouse model obtained in step (1) and fed with high fat to obtain a humanized mouse model of atherosclerosis; the human stem cells are human CD133+ stem cells.

2. The method for constructing a humanized mouse model of atherosclerosis according to claim 1, characterized in that: The sites for Prkdc and Il2rg gene knockout mentioned in step (1) are as follows: Il2rg-sgRNA: GGAGCAACAGAGATCGAAGCTGG (as shown in SEQ ID NO.1); Prkdc-sgRNA1: CAGTAGCCAACACCGTACGCCGG (as shown in SEQ ID NO.2); Prkdc-sgRNA2: GATCCTCAGAAGCATCTGCGTGG (as shown in SEQ ID NO.3).

3. The method for constructing a humanized mouse model of atherosclerosis according to claim 1 or 2, characterized in that: Step (1) includes the identification of the mouse genotype.

4. The method for constructing a humanized mouse model of atherosclerosis according to claim 3, characterized in that: The primer sequences used for identifying the genotype of the first mouse model are as follows: Il2rg-F: 5'- AGTAGCCAAGAGAGCAGGGA -3' (as shown in SEQ ID NO.4); Il2rg-R: 5'-ATGGTGGGAGAGGCAAAGTG -3' (as shown in SEQ ID NO.5); Prkdc-F1: 5'-CATTTGCGTTGTCCCGAGTG -3' (as shown in SEQ ID NO. 6); Prkdc-R1: 5'- GACGTTGACTACACGCACCA -3' (as shown in SEQ ID NO.7); Prkdc-F2: 5'- GCCAGCGCATAGTGAGAACT -3' (as shown in SEQ ID NO. 8); Prkdc-R2: 5'-TCTGCAAGCAAGTTTCTGGGA-3' (as shown in SEQ ID NO.9).

5. The method for constructing a humanized mouse model of atherosclerosis according to claim 1 or 2, characterized in that: The high-fat feeding mentioned in step (2) refers to a high-fat feed with a fat content of 20-25% and a cholesterol content of 1-1.5%.

6. The method for constructing a humanized mouse model of atherosclerosis according to claim 5, characterized in that: The high-fat feeding period shall be no less than 16 weeks.

Images