A combination of genes expressed in series in plants and its use in improving the cadmium tolerance of plants

Abstract

The present application belongs to the technical field of plant genetic engineering, and particularly relates to a gene combination expressed in plants in series and application thereof in improving the cadmium tolerance of plants. The gene combination expressed in plants according to the present application comprises a PPKS gene, an MT2aS gene and an MT2bS gene; the nucleotide sequences of the PPKS gene, the MT2aS gene and the MT2bS gene are respectively shown as SEQ ID NO. 2, SEQ ID NO. 4 and SEQ ID NO. 6. The present application improves the heavy metal enrichment capacity and tolerance of plants to heavy metals including cadmium by expressing the gene combination in plants, not only improves the heavy metal absorption capacity of plants near the rhizosphere, but also avoids the toxicity of excessive absorption of heavy metals to plants, thereby improving the tolerance of plants to heavy metals including cadmium.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a gene combination expressed in series in plants and its application in improving the cadmium tolerance of plants. Background Art

[0002] Cadmium (Cd) is primarily produced during the processing and smelting of non-ferrous metals. It is widely present in environmental media such as water, soil, and food. It is an extremely toxic heavy metal pollutant and ranks first among inorganic soil pollutants. Due to its high mobility and solubility, Cd is easily absorbed by plants. This not only affects plant metabolism and reduces plant quality, but can also harm the human skeleton, lungs, kidneys, and central nervous system through transmission and accumulation within the food chain, and can even threaten life. Statistics show that the point-level excess rate of Cd in soil is as high as 7.0%, ranking first among inorganic pollutants. Cadmium contamination of soil has led to significant reductions in grain production and severe economic losses.

[0003] Currently, the main remediation technologies for heavy metal contaminated soil include physical remediation, chemical remediation, and bioremediation. Compared to traditional physical and chemical remediation techniques, bioremediation technology can be used to repair heavy metal-contaminated soil. The products produced do not harm the plant growth environment. Furthermore, bioremediation technology offers advantages such as low cost, high efficiency, no secondary pollution, simple operation, and wide applicability. Therefore, bioremediation technology has become a research hotspot in recent years.

[0004] Among bioremediation technologies, plant-based heavy metal remediation is the most common. Plant detoxification of heavy metals includes acidification, compartmentalization, chelation, free radical scavenging, and transport. Reports indicate that polyphosphate kinase (PPK) can enhance plant accumulation of metal ions and reduce metal ion concentrations in the environment. However, excessive accumulation of heavy metal ions in plants can be highly toxic, reducing their tolerance to heavy metals. This not only impairs plant growth and development but also defeats the purpose of remediating heavy metal-contaminated soil. Summary of the Invention

[0005] The purpose of the present invention is to provide a gene combination expressed in tandem in plants and its application in improving plant cadmium tolerance. The gene combination of the present invention can effectively improve the plant's ability to accumulate and tolerate heavy metals, thereby achieving the effect of repairing heavy metal-contaminated soil.

[0006] The present invention provides a gene combination for tandem expression, which comprises a PPK gene, a MT2a gene and a MT2b gene. The nucleotide sequences of the PPK gene, the MT2a gene and the MT2b gene are shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5, respectively.

[0007] The present invention also provides a gene combination expressed in tandem in plants, wherein the gene combination expressed in tandem in plants comprises a PPKS gene, a MT2aS gene, and a MT2bS gene, wherein the nucleotide sequences of the PPKS gene, the MT2aS gene, and the MT2bS gene are shown in SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6, respectively.

[0008] Preferably, the PPKS gene, MT2aS gene and MT2bS gene are sequentially connected in series in the order from the 5' end to the 3' end.

[0009] The present invention also provides a multi-gene expression cassette, comprising a PPKS gene expression cassette, an MT2aS gene expression cassette, and an MT2bS gene expression cassette; the PPKS gene expression cassette comprises a PPKS gene, the MT2aS gene expression cassette comprises an MT2aS gene, and the MT2bS gene expression cassette comprises an MT2bS gene; the nucleotide sequences of the PPKS gene, MT2aS gene, and MT2bS gene are shown as SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6, respectively.

[0010] Preferably, the two ends of the PPKS gene, MT2aS gene and MT2bS gene are connected to the CaMV35S promoter and the NOS terminator respectively.

[0011] The present invention also provides a recombinant expression vector, which includes a basic vector and a target gene inserted into the basic vector; the target gene is the gene combination expressed in series in plants as described in the above technical solution or the multi-gene expression cassette as described in the above technical solution.

[0012] The present invention also provides an engineered bacterium, which includes an initial strain and a recombinant expression vector introduced into the initial strain, and the recombinant expression vector is the recombinant expression vector described in the above technical solution.

[0013] The present invention also provides the use of the gene combination expressed in tandem as described in the above technical solution, the gene combination expressed in tandem in plants as described in the above technical solution, the multi-gene expression cassette as described in the above technical solution, the recombinant expression vector as described in the above technical solution, or the engineered bacteria as described in the above technical solution in one or more of improving the ability of plants to enrich heavy metals, improving the heavy metal tolerance of plants, and repairing heavy metal contaminated soil.

[0014] Preferably, the heavy metal includes cadmium; and the plant includes rice.

[0015] The present invention also provides a method for cultivating plants with resistance to heavy metals and / or high ability to accumulate heavy metals, which increases the expression level of target genes in target plants to obtain the plants with resistance to heavy metals and / or high ability to accumulate heavy metals; the target genes are the gene combinations expressed in series in the genes described in the above technical solution.

[0016] Beneficial effects:

[0017] The present invention provides a tandemly expressed gene combination comprising a PPK gene, a MT2a gene, and a MT2b gene. The nucleotide sequences of the PPK gene, MT2a gene, and MT2b gene are shown in SEQ ID NO. 1, SEQ ID NO. 3, and SEQ ID NO. 5, respectively. Furthermore, a gene combination capable of plant expression is formed by codon-optimizing the PPK gene, MT2a gene, and MT2b gene. The plant-expressed gene combination comprises a PPKS gene, a MT2aS gene, and a MT2bS gene. The nucleotide sequences of the PPKS gene, MT2aS gene, and MT2bS gene are shown in SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6, respectively. By expressing the gene combination expressed in plants in plants, the plant's ability to accumulate and tolerate heavy metals, including cadmium, is improved. This not only improves the plant's ability to absorb heavy metals near the rhizosphere, but also avoids the toxicity to the plant caused by excessive absorption of heavy metals, thereby improving the plant's tolerance to heavy metals, including cadmium, and is effectively used for bioremediation of heavy metal-contaminated soil. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0019] Figure 1 Schematic diagram of the structure of the multigene plant transformation vector pCAMBIA1301:PPKS:MT2aS:MT2bS containing three genes in Example 1;

[0020] Figure 2 Figure 2 is the PCR detection result of the genomic DNA of the transformed rice plants;

[0021] Figure 3 Figure 3 is a graph showing the cadmium resistance phenotype of the wild-type rice and engineered rice lines in Example 3;

[0022] Figure 4 Graph showing the detection results of cadmium content in the soil of the engineered rice planted in Example 3 (t-test, *P<0.05, **P<0.01). DETAILED DESCRIPTION

[0023] The present invention provides a gene combination for tandem expression, which comprises a PPK gene, a MT2a gene and a MT2b gene. The nucleotide sequences of the PPK gene, the MT2a gene and the MT2b gene are shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5, respectively.

[0024] The PPK gene of the present invention is derived from Escherichia coli, while the MT2a and MT2b genes are derived from grapes (Vitis vinifera). In the present invention, the PPK gene encodes polyphosphate kinase, an enzyme that can enhance plants' ability to absorb and accumulate cadmium. The MT2a and MT2b genes encode metallothioneins, which can chelate metal ions, thereby reducing their toxic effects on plant cells.

[0025] The nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5 of the present invention are as follows:

[0026] SEQ ID NO.1:

[0027]

[0028] SEQ ID NO.3:

[0029] 5'-ATGTCTTGCTGCGGAGGAAACTGCGGTTGTGGGTCTGGCTGCACCT GCGGCAGCGGCTGTGGAGGATGCAAGATGTACCCGGACTTGAGTTTCTCTGAGGGCGCCACCACCACTGAGACCATCATTGCTGGTGTTGCACCAGTGAAGACGCACTTTGAGGGATCTGAGATGGGCGTGGGAGCTGAGAACGGATGCAAGTGTGGATCCAACTGCTCGTGTGATCCTTGCACTTGCAAATGA-3';

[0030] SEQ ID NO.5:

[0031] 5'-ATGCCTGGCTGCGGAGGAGACTGTGATTGTGGGTCTAGCTGCAAGT GCGGCAGCGGCTATGGAGGATGCGGATGCAAGATGTACCGGGACAAGAGTTTCTCAGAGGGCAGCACCACCACCGAGACCATCATTGCCGGTGTTGCACCTGTGAAGACGCACTTTGAGGGAGCTGAGATGGGCGTGGGAGCAGAGAACGGATGCAAGTGCGGAGCCAACTGCCAGTGTGATCCCTGCACTTGCAAATGA-3'。

[0032] The present invention also provides a gene combination expressed in tandem in plants, wherein the gene combination expressed in tandem in plants comprises a PPKS gene, a MT2aS gene, and a MT2bS gene, wherein the nucleotide sequences of the PPKS gene, the MT2aS gene, and the MT2bS gene are shown in SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6, respectively. The PPKS gene, MT2aS gene and MT2bS gene of the present invention are preferably obtained by codon optimization of the PPK gene, MT2a gene and MT2b gene, respectively. The principles of the codon optimization are preferably as follows: (1) optimizing gene codons according to the codon preference of the target plant to improve gene translation efficiency, and the target plant is preferably rice; (2) eliminating the recognition sites of commonly used restriction endonucleases within the gene to facilitate the construction of the expression cassette; (3) eliminating inverted repeat sequences, stem-loop structures and transcription termination signals to balance the GC / AT ratio within the gene and improve the stability of RNA; (4) making the gene-encoded protein conform to the N-terminal principle to improve the stability of the translated protein; and (5) optimizing the mRNA secondary structure free energy to improve gene expression efficiency.

[0033] The nucleotide sequences shown in SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.6 of the present invention are as follows:

[0034] SEQ ID NO.2:

[0035]

[0036] SEQ ID NO.4:

[0037] 5'-ATGTCTTGTTGTGGTGGTAACTGTGGTTGTGGTTCTGGTTGTACTTG TGGTTCTGGTTGTGGTGGTTGCAAGATGTACCCTGACCTGTCTTTCTCTGAGGGTGCAACTACTACTGAGACTATCATTGCTGGTGTTGCACCTGTCAAGACGCACTTCGAGGGTTCCGAGATGGGTGTTGGTGCTGAGAACGGTTGCAAGTGTGGTTCCAACTGTTCCTGTGATCCATGCACTTGCAAGTAA-3';

[0038] SEQ ID NO.6:

[0039] 5'-ATGCCTGGTTGTGGTGGTGATTGTGACTGTGGTTCTTCTTGTAAGTG TGGTTCTGGTTACGGTGGTTGTGGTTGCAAGATGTACCGTGACAAGTCCTTCTCTGAGGGTTCTACCACTACTGAGACCATCATTGCTGGTGTTGCACCTGTCAAGACCCACTTCGAGGGTGCTGAGATGGGTGTTGGTGCTGAGAACGGTTGCAAGTGTGGTGCTAACTGTCAGTGTGATCCTTGCACTTGCAAGTAA-3'。

[0040] In the present invention, the PPKS gene, MT2aS gene and MT2bS gene are preferably connected in series in sequence from the 5'-end to the 3'-end.

[0041] The present invention also provides a multi-gene expression cassette, comprising a PPKS gene expression cassette, an MT2aS gene expression cassette, and an MT2bS gene expression cassette; the PPKS gene expression cassette comprises a PPKS gene, the MT2aS gene expression cassette comprises an MT2aS gene, and the MT2bS gene expression cassette comprises an MT2bS gene; the nucleotide sequences of the PPKS gene, MT2aS gene, and MT2bS gene are shown as SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6, respectively. The PPKS, MT2aS, and MT2bS genes described herein are preferably fused to the CaMV 35S promoter and NOS terminator at both ends, respectively. Specifically, the codon-optimized PPKS gene is preferably fused to the 35S promoter and NOS terminator to form a PPKS gene expression cassette; the codon-optimized MT2aS gene is fused to the 35S promoter and NOS terminator to form an MT2aS gene expression cassette; and the codon-optimized MT2bS gene is fused to the 35S promoter and NOS terminator to form an MT2bS gene expression cassette. The 35S promoter described herein is preferably derived from cauliflower mosaic virus, and the NOS terminator is preferably derived from Agrobacterium tumefaciens.

[0042] The present invention also provides a recombinant expression vector comprising a base vector and a target gene inserted into the base vector; the target gene is the combination of genes for tandem plant expression described in the above technical solution or the multi-gene expression cassette described in the above technical solution. The base vector of the present invention preferably comprises a plasmid vector, more preferably pCAMBIA1301. In the recombinant expression vector of the present invention, the PPKS gene expression cassette, the MT2aS gene expression cassette, and the MT2bS gene expression cassette are preferably arranged in tandem in order from the 5' end to the 3' end. When the base vector is pCAMBIA1301, the target gene is preferably inserted between the EcoRI and HindIII restriction sites of pCAMBIA1301 to form the pCAMBIA1301:PPKS:MT2aS:MT2bS recombinant expression vector. The present invention does not specifically limit the construction method of the recombinant expression vector; conventional methods for constructing recombinant expression vectors in the art can be used.

[0043] The present invention also provides an engineered bacterium comprising an initial bacterial strain and a recombinant expression vector introduced into the initial bacterial strain, wherein the recombinant expression vector is the recombinant expression vector described in the above technical solution. The initial bacterial strain of the present invention preferably comprises Agrobacterium tumefaciens, more preferably Agrobacterium tumefaciens EHA105. The present invention does not specifically limit the method for constructing the engineered bacterium; conventional methods for constructing engineered bacteria in the art can be employed.

[0044] The present invention also provides the use of the tandemly expressed gene combination described in the above technical solution, the tandemly expressed gene combination in plants described in the above technical solution, the multi-gene expression cassette described in the above technical solution, the recombinant expression vector described in the above technical solution, or the engineered bacteria described in the above technical solution for one or more of improving a plant's ability to accumulate heavy metals, improving a plant's tolerance to heavy metals, and remediating heavy metal-contaminated soil, more preferably for improving a plant's ability to accumulate heavy metals, improving a plant's tolerance to heavy metals, and remediating heavy metal-contaminated soil. The heavy metal of the present invention preferably includes cadmium; and the plant preferably includes rice.

[0045] The present invention also provides a method for cultivating plants with heavy metal tolerance and / or high heavy metal accumulation capacity, comprising: increasing the expression level of a target gene in a target plant to obtain the plant with heavy metal tolerance and / or high heavy metal accumulation capacity; the target gene is the combination of genes expressed in tandem in the gene described in the above technical solution. The method of increasing the expression level of a target gene in a target plant of the present invention preferably comprises introducing the target gene into the target plant. The means of introduction is not particularly limited and can be performed using conventional transgenic methods in the art. The target plant of the present invention preferably includes rice; and the heavy metal preferably includes cadmium.

[0046] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional molecular biological methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0048] The test materials used in the present invention and their sources include:

[0049] Wild-type rice Zhonghua 11 was cultured in an artificial climate chamber at 26°C with a 16-hour photoperiod. Escherichia coli DH5α was maintained by the Plant Genetic Engineering Laboratory, Institute of Biotechnology, Shanghai Academy of Agricultural Sciences.

[0050] For details of conventional molecular biological operations in the present invention, please refer to Molecular Cloning Experimental Guide, 3rd Edition (translated by Huang Peitang et al., Science Press, China, 2002).

[0051] Example 1

[0052] The steps for constructing a multi-gene plant expression vector are as follows:

[0053] 1. Optimized synthesis of three genes

[0054] Using the PPK gene (SEQ ID NO. 1) of Escherichia coli, the MT2a gene (SEQ ID NO. 3) and the MT2b gene (SEQ ID NO. 5) of grapevine (Vitis vinifera) as templates, the DNA sequence shown in SEQ ID NO. 2, i.e., PPKS, the DNA sequence shown in SEQ ID NO. 4, i.e., MT2aS, and the DNA sequence shown in SEQ ID NO. 6, i.e., MT2bS, were synthesized based on rice codon preference, and their sequences were confirmed by sequencing.

[0055] 2. Construction of multi-gene plant transformation vector: The three optimized genes were fused with the CaMV35S promoter and NOS terminator to construct three gene expression cassettes respectively; the three constructed gene expression cassettes were then connected in sequence (PPKS:MT1S:MT2S) using the ClonExpress MultiS multi-fragment one-step seamless rapid cloning kit (Novozymes) to form a complete sequence containing a multi-gene expression cassette; EcoR I and HindⅢ restriction sites were introduced at both ends of the complete sequence, and the complete sequence was analyzed and determined by nucleotide sequence analysis by Sangon Biotech (Shanghai) Co., Ltd. Finally, the complete synthetic fragment with correct sequencing was double-digested with EcoR I and HindⅢ, and then connected to the same restriction enzyme vector pCAMBIA1301, thus obtaining a multi-gene plant transformation vector pCAMBIA1301:PPKS:MT2aS:MT2bS (containing three genes). Figure 1 );

[0056] The nucleotide sequences of the CaMV35S promoter and NOS terminator are shown in SEQ ID NO.13 and SEQ ID NO.14, respectively:

[0057] SEQ ID NO.13:

[0058] 5'-TGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTC CATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATAACATGGTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCAAAAGGACAGTAGAAAAGGAAGGTGGCACCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGA-3';

[0059] SEQ ID NO.14:

[0060] 5'-CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTG CCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG-3'.

[0061] The gene was fused to the 35S promoter and NOS terminator using a modified overlap extension PCR technique, as described in the reference Rihe Peng, Aisheng Xiong, Quanhong Yao; "A direct and efficient PAGE-mediated overlap extension PCR method for gene multiple-site mulagenesis," Applied Microbiology Biotechnology, 2006, 73:234-240. Phanta Max Super-Fidelity DNA Polymerase, suitable for high-fidelity amplification of long genes, was used (Vazyme Biotech Co., Ltd., Nanjing). The PCR amplification program was as follows: initial denaturation at 95°C for 30 s; denaturation at 95°C for 45 s, annealing at 56-72°C for 45 s, extension at 72°C for 5-20 min (1000 bp / min), for 25-35 cycles; and final extension at 72°C for 10 min.

[0062] Example 2

[0063] The transformation steps for rice are as follows:

[0064] 1. Acquisition and identification of engineered rice

[0065] 1.1 Preparation and electroporation of Agrobacterium

[0066] 1) A single Agrobacterium bacterium was inoculated into 5 mL of LB liquid medium (rifampicin 50 μg / mL, chloramphenicol 100 μg / mL) and cultured at 28°C and 250 rpm for 20 h to obtain a bacterial suspension.

[0067] 2) Take 1 mL of the bacterial solution from step 1) and transfer it into 20-30 mL of LB liquid medium (rifampicin 50 μg / mL, chloramphenicol 100 μg / mL), incubate at 28°C, 250 rpm for about 12 hours, and measure the OD 600 ≈1.5.

[0068] 3) Centrifuge the bacterial solution in step 2) at 8000 rpm, 4°C for 10 min to collect the cells, resuspend them in Agrobacterium transformation infiltration solution (5 wt% sucrose, 0.05 wt% Silwet L-77) and dilute to OD 600 ≈0.8.

[0069] 4) Resuspend the cells obtained in step 3) in 0.5 times the volume of 4°C pre-cooled sterile water. Centrifuge at 3500g for 10 minutes and carefully discard the supernatant. Resuspend the cells in 1-2 mL of 4°C pre-cooled sterile 10% glycerol. This suspension can be used immediately or stored at -70°C.

[0070] 5) Add 40 μL of bacterial suspension and 1-2 μL of plasmid DNA (0.4 pg-0.3 μg) to a 1.5 mL Eppendorf tube. Mix thoroughly in a 0.2 cm diameter electroporation cuvette. Incubate on ice for approximately 1 minute. Adjust the electroporation parameters to 25 μF, 2.5 kV / cm, and 400 Ω. Electroporate for 4-5 msec.

[0071] 6) After electroporation, add 1.0 mL of LB broth (8 g / L tryptone, 4 g / L yeast extract, 8 g / L NaCl, pH 7.0) to the cells, incubate at 29°C for 1 hour, and plate onto YEB plates supplemented with antibiotics (50 μg / mL rifampicin + 50 μg / mL kanamycin). Using the above transformation procedure, the plant expression vector pCAMBIA1301:PPKS:MT2aS:MT2bS was electroporated into Agrobacterium tumefaciens EHA105 to obtain Agrobacterium tumefaciens strain EHA105 (pCAMBIA1301:PPKS:MT2aS:MT2bS).

[0072] 1.2 Agrobacterium infection and co-cultivation with rice callus

[0073] 1) Rice callus induction: Mature seeds of Zhonghua 11 rice (hulled) were first soaked in 70% v / v ethanol for 1 min, rinsed with sterile water, and then disinfected by soaking in 2% sodium hypochlorite for 20 min. After that, they were repeatedly rinsed with sterile water and placed in a sterile culture dish on a clean bench. The water was dried with sterile filter paper, and the mature embryos were peeled with a knife and inoculated onto a culture medium with the scutellum facing up. The embryos were placed on callus induction medium (components and concentrations as follows: MS 4.4 g / L, 2,4-D 2.5 mg / L, casein 600 mg / L, sucrose 30 g / L, and phytagel 5 g / L, adjusted to pH 5.8 with KOH, and sterilized by autoclave) for callus induction. Callus was induced by incubation at 25-28°C in the dark for 8-10 days. When the embryos grew to 1 cm, high-quality scutellum calli were strictly selected and plated on NBD2 (composed of NB and 2 mg / L 2,4-D) medium, culture in the dark at 25-28°C for 4-7 days for subculture.

[0074] 2) Infection with Agrobacterium tumefaciens culture

[0075] Agrobacterium EHA105 carrying the plant expression vector (PPKS:MT2aS:MT2bS) was picked from the YEB plate and inoculated into 5 mL of YEB liquid medium containing 50 mg / L kanamycin. The culture was shaken at 200 rpm at 28°C until the OD 600 = 0.5, and then re-inoculated into fresh YEB medium at a volume ratio of 1:100 and cultured with shaking. The antibiotics and culture conditions in the YEB medium were the same as before. 600 = 0.5, centrifuge the bacterial solution at a relative centrifugal force of 6000 × g at 4 ° C for 10 minutes to collect the Agrobacterium cells, and resuspend the Agrobacterium in 2 / 3 MS + 1 / 3 YEB to OD 600 =0.5, reserve.

[0076] 3) Co-cultivation of Agrobacterium tumefaciens:

[0077] Take the embryonic callus of rice with vigorous growth, cut it into 2mm small pieces, put it into sterile culture dish, add OD 600 = 0.5 Agrobacterium tumefaciens liquid, soak for 25 minutes, dry the surface liquid with sterile filter paper, and then inoculate the rice callus on the co-cultivation medium and culture in the dark at 28°C for 2-3 days.

[0078] 4) Rice callus differentiation and plant regeneration

[0079] The rice callus tissue after co-cultivation was collected, washed three times with sterile water containing 500 mg / L cephalosporin, and excess water was removed by aspiration.

[0080] The callus tissue was transferred to the screening medium (including N6 medium, 0.5 mg / L 2,4-D, 600 mg / L cefotaxime and 25 mg / L hygromycin) and cultured for 12-15 days, of which the first 6-7 days were cultured in the dark and the next 8-9 days were cultured in the light with a light intensity of 45-55 mmoL·m -2 ·S -1 The callus that has differentiated into adventitious buds is then transferred to differentiation medium RE2-H and cultured for 15 days, which allows the adventitious buds to grow into 2-4 cm seedlings.

[0081] Among them, the differentiation medium RE2-H is composed of the following components: MS, sucrose 30g / L, sorbitol 10-20g / L, hydrolyzed casein 2g / L, 6-benzylaminopurine 1mg / L, naphthaleneacetic acid 0.5mg / L, kinetin 0.5mg / L, zeatin 0.2mg / L, hygromycin 50mg / L and plant gel 4.5g / L, with a pH value of 5.8.

[0082] Finally, these seedlings were transferred to rooting medium (1 / 2MS, 20g / L sucrose, 10g / L carrageenan, pH 5.8). After 2 weeks, they took root and were transplanted into long test tubes for culture for 20-30 days. The larger rice plants were transplanted into the fields of the Baihe Transgenic Base of the Shanghai Academy of Agricultural Sciences.

[0083] 2. Identification of genetically modified rice

[0084] 2.1 PCR detection of genomic DNA of transformed plants

[0085] Genomic DNA was extracted from transgenic rice leaves transplanted to the field using the SDS method and used as a template for PCR amplification to detect the exogenous genes PPKS, MT2aS, and MT2bS. The primers used are as follows:

[0086] PPKS: F (SEQ ID No. 7): 5'-GATGTAACGTGCCTTCACAGTGTC-3'; R (SEQ ID No. 8): 5'-GCAATCTCAATCGTGGATCGTTAC-3'.

[0087] MT2aS: F (SEQ ID No. 9): 5'-ATGTCTTGTTGTGGTGGTAAC-3'; R (SEQ ID No. 10): 5'-AAGTGCATGGATCACAGGAAC-3'.

[0088] MT2bS: F (SEQ ID No. 11): 5'-GGTTGTGGTGGGTGATTGTGAC-3'; R (SEQ ID No. 12): 5'-AGGATCACACTGACAGTTAGC-3'.

[0089] The amplification program used was: 95°C initial denaturation for 30 seconds; 95°C denaturation for 45 seconds, 56-72°C annealing for 45 seconds, 72°C extension for 5-20 minutes (1000 bp / min), amplification for 25-35 cycles; final extension at 72°C for 10 minutes. Figure 2 .

[0090] Depend on Figure 2 It can be seen that the transgenic lines can amplify the above three genes, indicating that the exogenous genes are completely integrated into the rice genome.

[0091] Example 3

[0092] The steps for identifying the resistance of transgenic rice plants to cadmium are as follows:

[0093] The rice seeds harvested in Example 2 were self-pollinated for three generations to obtain homozygous transformants, and the seeds were harvested. After sowing, the plants were grown in a 25°C incubator for three weeks and then irrigated with a 20 mM cadmium solution. The irrigating treatment was consistent for both the engineered rice and the wild-type rice. After the water dried up, the engineered rice and the wild-type rice were irrigated again to observe their resistance to cadmium. After three weeks of irrigating, the wild-type rice showed overall weaker growth than the engineered rice line ( Figure 3 , where WT represents wild-type rice, and OE1, OE2, and OE3 represent engineered rice lines).

[0094] The cadmium content of the soil matrix in which the plants were grown was determined according to GB / T 5750.6-2006 and GB 5009.268-2016 after 30 days of treatment with 20mM Cd ion solution. The results showed that under the same concentration treatment, the residual Cd ions in the soil of the engineered rice were reduced by more than half compared with the wild type ( Figure 4 ), indicating that engineered plants have a more ideal soil remediation effect.

[0095] It can be concluded from the above examples that the gene combination of the present invention can effectively improve the accumulation capacity and tolerance of plants to heavy metals, thereby achieving the effect of repairing heavy metal-contaminated soil.

[0096] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Application of a multi-gene expression cassette in improving rice cadmium tolerance and remediating cadmium-contaminated soil; the multi-gene expression cassette comprises PPKS Gene expression cassette, MT2aS Gene expression cassette and MT2bS gene expression cassette; described PPKS Gene expression cassette includes PPKS gene, the MT2aS Gene expression cassette includes MT2aS gene, the MT2bS Gene expression cassette includes MT2bS Gene; described PPKS Gene, MT2aS Genes and MT2bS The nucleotide sequences of the genes are shown in SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6, respectively; described PPKS Gene, MT2aS Genes and MT2bS The two ends of the gene are connected to a CaMV35S promoter and a NOS terminator respectively; the nucleotide sequences of the CaMV35S promoter and the NOS terminator are shown in SEQ ID NO.13 and SEQ ID NO.14 respectively.

2. Use of a recombinant expression vector for improving cadmium tolerance in rice and remediating cadmium-contaminated soil, or both; the recombinant expression vector comprises a base vector and a target gene inserted into the base vector; The target gene is a multi-gene expression cassette, and the multi-gene expression cassette includes PPKS Gene expression cassette, MT2aS Gene expression cassette and MT2bS gene expression cassette; described PPKS Gene expression cassette includes PPKS gene, the MT2aS Gene expression cassette includes MT2aS gene, the MT2bS Gene expression cassette includes MT2bS Gene; described PPKS Gene, MT2aS Genes and MT2bS The nucleotide sequences of the genes are shown in SEQ ID NO. 2, SEQ ID NO. 4, and SEQ ID NO. 6, respectively; described PPKS Gene, MT2aS Genes and MT2bS The two ends of the gene are connected to a CaMV35S promoter and a NOS terminator respectively; the nucleotide sequences of the CaMV35S promoter and the NOS terminator are shown in SEQ ID NO.13 and SEQ ID NO.14 respectively.

Images