A rapid detection method for NL-lactyl-L-phenylalanine, a cell metabolite

Abstract

The invention provides a rapid detection method for cell metabolite N-L-lactyl-L-phenylalanine, the sensor adopts L-lactic acid aptamer and L-phenylalanine aptamer to modify two gates on electrolyte gate-controlled graphene field effect transistor (SGGT) respectively; when detecting, the configuration of the aptamer on the gate changes after capturing two target substances, L-lactic acid and L-phenylalanine, thereby generating a shift of the Dirac point of the transfer curve, thereby detecting the two target substances respectively, and relying on the concentration model of the target system, finally realizing the detection of N-L-lactyl-L-phenylalanine. The sensor solves the disadvantage of weak selectivity of electrochemical gate-controlled graphene field effect transistor, and can be used for rapid detection of one or more substances in lactic acid, phenylalanine or lactic acid phenylalanine in cell culture medium by the combination and disassembly of the gate, and can be used for cell experiment detection, with certain practical value.

Description

Technical Field

[0001] The present invention belongs to the development of a cell detection device, and specifically relates to a rapid detection method for a cell metabolite NL-lactyl-L-phenylalanine. Background Art

[0002] After strenuous exercise, the animal body produces NL-lactyl-L-phenylalanine through cell metabolism, and its concentration is positively correlated with lactate concentration, and is restored after the exercise. This indicates that NL-lactyl-L-phenylalanine can be used as a marker for exercise status and effect after exercise. Therefore, more and more studies focus on the metabolic level of NL-lactyl-L-phenylalanine at the cellular level. However, the existing detection methods are mainly through liquid chromatography and liquid chromatography-mass spectrometry, which are difficult to be portable and have more complicated sample pretreatment steps. Therefore, the development of a rapid detection method for NL-lactyl-L-phenylalanine, a cell metabolite, will help to quickly detect cell samples.

[0003] Electrochemical detection methods have been increasingly valued in recent years because of their much higher sensitivity than traditional detection methods, and their detection costs and equipment operating costs are also lower than traditional liquid phase, mass spectrometry and spectroscopy detection methods. With the increasing demand for rapid detection and on-site detection in recent years, the development of electrochemical detection technology has received great attention. Transistor is a solid semiconductor device with the main functions of detection, rectification, amplification, switching, voltage regulation and signal modulation. It has a wide range of applications in the field of electronic information due to its small size, no need for preheating and strong and reliable characteristics. Field effect transistor (FET) is a type of transistor, mainly composed of source, drain and gate structures. FET sensors have developed more types, greatly expanding the application range of biosensors. Compared with traditional FET sensors, electrolyte gated graphene field effect transistor (SGGT) uses graphene to cover the channel and uses electrolyte solution to replace the insulating layer in traditional FET sensors, so that the three electrodes are in the electrolyte environment at the same time, so that the gate / electrolyte and electrolyte / channel interfaces form two double electron layers, which are equivalent to two capacitors. Therefore, during the use of the entire system, even a small change in gate voltage can produce a large change in channel current. In addition, compared to FET, SGGT can achieve detection of different targets by modifying the gate. In existing studies, SGGT sensors have been used to detect some ions in liquids, as well as targets such as histamine, thrombin, and DNA in organisms. In these experiments, SGGT has shown advantages such as rapidity, real-time, high sensitivity, and high throughput.

[0004] Traditional biomolecule monitoring uses antigen-antibody specific binding, but antibodies are prone to inactivation and take a long time to prepare. In contrast, nucleic acid aptamers have good self-stability, relatively simple preparation and synthesis, and flexible application, making them very suitable for use in biological detection, diagnosis, and pharmaceutical research. So far, a variety of electrochemical aptamer sensors for analytical detection have been developed. For example, one consists of a probe modified with methylene blue and an unlabeled capture probe. When the target DNA hybridizes with the unlabeled capture probe, the labeled signal probe will be released. Therefore, the aptamer can fix the DNA on the gate surface of SGGT through the Au-S bond, and the modification of different aptamers can be achieved through the Au-S bond to detect different targets. Summary of the invention

[0005] Technical problems to be solved: In response to the above technical problems, this study plans to design and prepare an SGGT-based NL-lactyl-L-phenylalanine electrochemical sensor, establish a detection method for L-lactic acid (Lac), L-phenylalanine (Phe) and NL-lactyl-L-phenylalanine and an in vitro concentration relationship model, and realize the rapid detection of NL-lactyl-L-phenylalanine in cellular metabolites.

[0006] Technical solution: A rapid detection method for NL-lactyl-L-phenylalanine, a cell metabolite, comprising the following steps:

[0007] (1) SGGT electrode modification: L-lactic acid aptamer and L-phenylalanine aptamer were modified on the gate surface respectively to obtain SGGT-based NL-lactyl-L-phenylalanine sensor;

[0008] (2) Standard curve determination of L-lactic acid and L-phenylalanine: L-lactic acid and L-phenylalanine standards were diluted with culture medium to different concentrations, and then added dropwise to the NL-lactyl-L-phenylalanine sensor. The detection range of the sensor was determined based on the sensor transfer curve, and the standard curve was fitted by the gate voltage change value at the Dirac point and the logarithm of the concentration.

[0009] (3) Detection of the concentration of L-lactic acid and L-phenylalanine in the cell culture medium: adding a cell culture medium mixed with L-lactic acid and L-phenylalanine standards to the detection system for determination, quantifying according to the standard curve in step (2), and determining the recovery rate using liquid chromatography and a kit;

[0010] (4) Construction of NL-lactyl-L-phenylalanine concentration model in cell culture medium: The concentrations of L-lactic acid, L-phenylalanine and NL-lactyl-L-phenylalanine in the cell culture medium of macrophages were quantified and fitted to construct a concentration relationship model;

[0011] (5) Actual sample detection: Cell culture medium for culturing macrophages is added to the detection system for detection. The detection recovery rate is calculated based on the actual measurement results, and the concentration of NL-lactyl-L-phenylalanine is obtained by applying the concentration relationship model.

[0012] Furthermore, the step (1) is specifically as follows: at room temperature, 1-5 μL 5-15 mM tri(2-carboxyethyl)phosphine is mixed with 1-5 μL 0.5-5 mM aptamer, after static activation for 1-6 hours, the mixture is added dropwise to the gate surface of the electrolyte-gated graphene field effect transistor device, and modified at 4-20°C for 0.5-10 hours; after washing the gate, the surface active sites are blocked with 100-300 μL 5-30 mM mercaptoethanol for 6-18 hours; and the mixture is rinsed with deionized water to obtain an SGGT-based NL-lactyl-L-phenylalanine sensor.

[0013] Furthermore, the aptamers are L-lactic acid nucleic acid aptamers and L-phenylalanine nucleic acid aptamers.

[0014] Further, the L-lactic acid aptamer sequence is

[0015] GACGACGAGTAGCGCGTATGAATGCTTTTCTATGGAGTCGTC; the L-phenylalanine aptamer sequence is CGACGAGGCTGGATGCATCCGGATGTTCGATGTCG.

[0016] Furthermore, in the step (2), the different concentrations are: the concentration of L-lactic acid is 0, 300pM, 1nM, 3nM, 10nM, 30nM, 100nM and 300nM; the concentration of L-phenylalanine is 0, 3nM, 10nM, 30nM, 100nM, 300nM and 1000nM.

[0017] Furthermore, the step of establishing the concentration relationship model in step (4) is as follows: culturing RAW 264.7 cells in DMEM complete medium containing 10% fetal bovine serum, sampling after 24 hours, and determining the content of L-lactic acid in the sample using a lactate kit after sample pretreatment, and establishing a liquid chromatography-mass spectrometry method to detect the content of L-phenylalanine and NL-lactyl-L-phenylalanine; analyzing the relationship between the concentrations of L-lactic acid, L-phenylalanine and NL-lactyl-L-phenylalanine, and establishing a concentration relationship model. Furthermore, the concentration relationship model is [Lac-Phe] = 1.73E -4 [Lac][Phe]+4.17, [Lac-Phe] is the Lac-Phe concentration, [Lac] and [Phe] are the Lac concentration and Phe concentration respectively.

[0018] Furthermore, the cell culture medium in step (5) is the cell culture medium after culturing RAW264.7 cells for 24 hours.

[0019] Beneficial effects:

[0020] 1. The sensor of the present invention solves the disadvantage of weak selectivity of electrochemical gate-controlled graphene field-effect transistors. The gate of SGGT is modified by L-lactic acid aptamer and L-phenylalanine aptamer at the same time. The sensor can be used for rapid detection of one or more substances in L-lactic acid, L-phenylalanine or NL-lactyl-L-phenylalanine in cell culture medium samples by splitting and combining the gates.

[0021] 2. The L-lactic acid aptamer and L-phenylalanine aptamer used in the sensor prepared by the present invention have chiral selectivity, which can avoid the interference caused by lactic acid and phenylalanine of different chirality; and the lactic acid and phenylalanine detected by the sensor are only L-configuration, so by establishing a cell concentration model, the signal interference caused by lactic acid and phenylalanine of different configurations can also be avoided;

[0022] 3. The sensor prepared by the present invention can be directly used for detection using culture medium samples, without the need for complicated sample pretreatment, and is simple to operate;

[0023] 4. The NL-lactyl-L-phenylalanine sensor prepared in the present invention is suitable for the detection of NL-lactyl-L-phenylalanine in cells, which helps to quickly analyze the metabolic level of NL-lactyl-L-phenylalanine in cells and has certain practical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The graphs are the relationship between the change in Dirac point gate voltage and the logarithm of the concentration of L-lactic acid, L-phenylalanine and NL-lactyl-L-phenylalanine respectively detected by the L-lactic acid and L-phenylalanine sensors, wherein a and b are the detection results of L-lactic acid by the L-lactic acid sensor; c and d are the detection results of NL-lactyl-L-phenylalanine by the L-lactic acid sensor; e and f are the detection results of L-phenylalanine by the L-phenylalanine sensor; g and h are the detection results of NL-lactyl-L-phenylalanine by the L-phenylalanine sensor;

[0025] Figure 2 The standard curve stability of the SGGT sensor with aptamer-modified gate, where a is the L-lactic acid sensor and b is the L-phenylalanine sensor;

[0026] Figure 3 The selectivity test results of the aptamer-functionalized sensor are shown in Figure 1, where a is an L-lactic acid sensor and b is an L-phenylalanine sensor;

[0027] Figure 4 The figure shows the recovery rate of the spiked culture medium sample and the actual sample detected by the L-lactic acid and L-phenylalanine sensors, where a is the recovery rate of the spiked sample and b is the recovery rate of the actual sample.

[0028] Figure 5 This is a model diagram of the relationship between the concentrations of L-lactic acid, L-phenylalanine and NL-lactyl-L-phenylalanine in the RAW 264.7 cell model culture medium;

[0029] Figure 6 Testing process for functionalized sensors. DETAILED DESCRIPTION

[0030] The present invention proposes a rapid detection method for NL-lactyl-L-phenylalanine, a cell metabolite. To make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention will be further described in detail with reference to the following examples. It should be understood that the specific examples described herein are only used to explain the present invention and are not intended to limit the present invention.

[0031] Example 1

[0032] (1) Preparation of SGGT sensor

[0033] 1) Preparation of modified electrode: At room temperature, 1 μL 10 mM tris(2-carboxyethyl)phosphine (TCEP) was mixed with 1 μL 1 mM thiol aptamer, and the mixture was left to activate for 1 h. The activated mixed solution was added dropwise to the gate surface of the electrolyte graphene field effect transistor device, and the mixture was kept moist at 4°C for 1 h. After the gate was washed, the surface active sites were blocked with 10 mM mercaptoethanol (MCH) for 12 h. Finally, the surface of the modified electrode was rinsed with Tris-HCl buffer containing 0.5 M NaCl.

[0034] 2) After fixing the modified electrode with a fixture, immerse it in a PBS system and use a 2400 digital source meter to measure the transfer curve.

[0035] (2) Detection of standard curve

[0036] The detection range of the SGGT sensor prepared above was evaluated: DMEM cell culture medium mixed with different concentrations of L-lactic acid and L-phenylalanine standards was used for detection, and the sensor transfer characteristic curve was carried out in 10mL PBS buffer and detected by Keithley2400 digital source meter. The channel current was measured under different gate voltages (-0.8~0.8V) and fixed drain voltage (0.05V), and the sample addition interval was 5min.

[0037] Test results and analysis:

[0038] The experimental results are as follows Figure 1 As shown in a and e, as the concentration of the substance to be tested increases in the solution system, the gate voltage corresponding to the lowest point (Dirac point) of the transfer curve decreases with the increase in the concentration of the substance to be tested. Therefore, the SGGT sensor using the aptamer-functionalized gate electrode can detect L-lactic acid and L-phenylalanine within a certain concentration range.

[0039] The fundamental reason for the shift of the Dirac point is that after the analyte is captured by the aptamer modified on the gate surface, the aptamer structure changes, which in turn causes the double electric layer of the SGGT sensor to change, resulting in a shift in the transfer curve. When different concentrations of L-lactic acid or L-phenylalanine are added to the reaction system, the gate voltage (Gate-Source Voltage, VGS) at the Dirac point changes and the concentration will show a correlation. In order to make the data more intuitive, we further processed the data, and the results are as follows Figure 1 b and f show the relationship between the change in the Dirac point gate voltage and the initial Dirac point gate voltage (ΔVGS) and the logarithm of the L-lactic acid or L-phenylalanine concentration. Figure 1 It can be seen from b that the prepared L-lactic acid sensor shows a good linear relationship in the concentration range of 300pM-300nM (R 2 =0.99), and Figure 1 The L-phenylalanine sensor in f has a good linear relationship in the concentration range of 3nM-1000nM (R 2 =0.99). However, the results of using the L-lactic acid sensor and the L-phenylalanine sensor to detect NL-lactyl-L-phenylalanine, respectively, are as follows Figure 1 c, d, g, h, where Figure 1 c, d are L-lactic acid sensors, Figure 1 g, h are L-phenylalanine sensors. As can be seen from the figure, these two sensors have no detection effect on NL-lactyl-L-phenylalanine. In addition, the stability of the standard curve is as follows Figure 2 As shown, Figure 2 a is L-lactic acid sensor, Figure 2 b is the L-phenylalanine sensor, and it can be seen that the prepared sensor has a certain stability.

[0040] (3) Selective testing

[0041] The selectivity of the prepared SGGT sensor was tested. Considering the possible interference of the sensor in the actual detection process, we selected some interfering substances that may exist in the culture medium for selectivity testing. 10 μL of 100 nM L-lactic acid, tryptophan, NaC1, KCl, urea, glucose, glycine, Na2SO4 and 10 μL of blank DMEM complete culture medium were added to the 1×PBS system where the SGGT sensor with the gate modified by L-lactic acid aptamer was located to measure the transfer curve, and the measurement was repeated three times;

[0042] Similarly, 10 μL of 100 nM L-phenylalanine, tryptophan, NaCl, KCl, urea, glucose, glycine, tyrosine, Na2SO4 and 10 μL of blank DMEM complete culture medium were added to the 1×PBS system where the SGGT sensor behind the L-phenylalanine aptamer modified gate was located, and the transfer curve was measured, and the measurement was repeated three times.

[0043] Test results and analysis:

[0044] The results are as follows Figure 3 ,in, Figure 3 a is the ΔVGS value of the transfer curve of the SGGT sensor with L-lactic acid aptamer modified gate after the addition of 100 nM L-lactic acid, tryptophan, NaCl, KCl, urea, glucose, glycine, Na2SO4 and 10 μL blank DMEM complete medium, among which the ΔVGS generated by 100 nM L-lactic acid is the highest compared with other interferents; Figure 3 b is the ΔVGS value of the transfer curve generated by the SGGT sensor with L-phenylalanine aptamer modified gate detecting 100nM L-phenylalanine, tryptophan, NaCl, KCl, urea, glucose, glycine, tyrosine, Na2SO4 and 10μL blank DMEM complete medium. The ΔVGS generated by 100nM L-phenylalanine is also the highest compared with other interferents. Therefore, the SGGT modified by the aptamer has a selective response to L-lactic acid and L-phenylalanine.

[0045] (4) Determination of detection recovery rate

[0046] In order to verify the accuracy of the sensor in detecting actual samples, the detection recovery rate of the prepared SGGT sensor was tested. The experiment used BMDM culture medium with added standards and culture medium after culturing RAW264.7 cells for detection. The system used was PBS solution. The detection accuracy was calculated based on the added concentration and the test results of the kit and the instrument.

[0047] Test results and analysis:

[0048] The concentration was calculated by substituting the ΔVGS of the transfer curve after adding the culture medium sample into the detection system into the standard curve formula. The experimental results are as follows: Figure 4 As shown in the figure, a is the detection recovery rate of the spiked samples of the two sensors, and b is the detection recovery rate of the actual samples of the two sensors. Therefore, it can be considered that the detection results of the sensors are relatively accurate.

[0049] (5) Establishment of concentration relationship model and detection of NL-lactyl-L-phenylalanine

[0050] The prepared SGGT sensor was selected to establish a relationship model between the concentrations of L-lactic acid, L-phenylalanine and NL-lactyl-L-phenylalanine in the culture medium of RAW 264.7 cells. RAW 264.7 cells were cultured in DMEM complete culture medium containing 10% fetal bovine serum, and samples were taken at the 24h time point. After sample pretreatment, a liquid chromatography-mass spectrometry method was established and combined with a lactate kit to detect the contents of L-lactic acid, L-phenylalanine and NL-lactyl-L-phenylalanine in the samples. The relationship between the concentrations of L-lactic acid, L-phenylalanine and NL-lactyl-L-phenylalanine was analyzed, and a concentration relationship model was established.

[0051] Test results and analysis:

[0052] RAW 264.7 cells were used as a cell model, and the concentrations of L-lactic acid, L-phenylalanine, and NL-lactyl-L-phenylalanine in the culture medium at different times were measured using a lactate kit and liquid mass spectrometry. The results are shown in Figure 5 As shown. Calculations have found that NL-lactyl-L-phenylalanine has a linear relationship with the product of L-lactic acid and L-phenylalanine concentrations [Lac-Phe] = 1.73E -4 [Lac][Phe]+4.17, where [Lac-Phe] is the Lac-Phe concentration, [Lac] and [Phe] are the Lac concentration and Phe concentration, respectively (R 2 =0.72), K value is 1.73E -4 Thus, NL-lactyl-L-phenylalanine can be detected by measuring L-lactic acid and L-phenylalanine.

[0053] Figure 6 To functionalize the sensor detection process, there are two double electrical layers (EDL1 and EDL2) between the gate / electrolyte and the electrolyte / graphene in the detection system. When the detection target binds to the aptamer, the aptamer will fold, such as Figure 6 When the aptamer folds, the thickness of EDL1 decreases, as shown by the dotted line. Since the capacitance is inversely proportional to the EDL thickness, C G-EAccording to the calculation formula of SGGT channel current, when Lac-Phe is captured, C G-E An increase in VG will result in a lower VG being required to ensure stable channel current, so the transfer curve will move toward negative voltage.

Claims

1. A rapid detection method for NL-lactyl-L-phenylalanine, a cell metabolite, comprising the following steps: (1) SGGT electrode modification: L-lactic acid aptamer and L-phenylalanine aptamer were modified on the gate surface respectively to obtain SGGT-based L-lactic acid and L-phenylalanine aptamer modified sensors; (2) Standard curve determination of L-lactic acid and L-phenylalanine: After adding gradient dilutions of L-lactic acid, L-phenylalanine and NL-lactyl-L-phenylalanine standards to the detection system, the detection was carried out. The gate voltage change value and the concentration logarithm at the Dirac point of the sensor can be fitted to the standard curve of L-lactic acid and L-phenylalanine; (3) Detection of the concentration of L-lactic acid and L-phenylalanine in the cell culture medium: Add the cell culture medium mixed with L-lactic acid and L-phenylalanine standards into the detection system for determination, and calculate the detection recovery rate; (4) Construction of NL-lactyl-L-phenylalanine concentration model in cell culture medium: The concentrations of L-lactic acid, L-phenylalanine and NL-lactyl-L-phenylalanine in the cell culture medium of macrophages were quantified and fitted to construct a concentration relationship model; (5) Actual sample detection: Cell culture medium for culturing macrophages is added to the detection system for detection. The detection recovery rate is calculated based on the actual measurement results, and the concentration of NL-lactyl-L-phenylalanine is obtained by applying the concentration relationship model.

2. A rapid detection method for NL-lactyl-L-phenylalanine, a cell metabolite, according to claim 1, characterized in that: The in vitro concentration relationship model established in step (4) is [Lac-Phe] = 1.73E -4 [Lac][Phe]+4.17, [Lac-Phe] is the Lac-Phe concentration, [Lac] and [Phe] are the Lac concentration and Phe concentration respectively.

Images