MdHEMH2 gene for promoting apple anthocyanin synthesis and application thereof

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to a MdHEMH2 gene for promoting apple anthocyanin synthesis and application thereof. The present application uses molecular biology means to screen a gene MdHEMH2 capable of regulating apple anthocyanin accumulation from apples. Through GUS reporter gene expression, biological information analysis, subcellular localization, transient and stable genetic expression and other tests, it is proved that the MdHEMH2 gene plays a positive regulation role in the accumulation of anthocyanin induced by ALA, and has the function of promoting the accumulation of apple anthocyanin. In addition, exogenous ALA can induce the expression of MdHEMH2 gene and participate in the accumulation of apple anthocyanin. The use of MdHEMH2 gene can improve fruit quality and provide a molecular basis for breeding new plant varieties.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a MdHEMH2 gene for promoting apple anthocyanin synthesis and application thereof. BACKGROUND

[0002] Apple, as a member of Rosaceae, is the largest cultivated area and the highest yield deciduous fruit tree, and enjoys worldwide reputation. Anthocyanin, as the main pigment in apple peel, not only gives the fruit an attractive red appearance, improves its market appeal and commodity value, but also has significant antioxidant activity and many health benefits.

[0003] The biosynthesis of anthocyanins is regulated by many physical and chemical factors, including visible light and UV-B irradiation, low temperature, nutrient elements and plant hormones. As an important precursor of heme, chlorophyll, cytochrome and vitamin B12, 5-aminolevulinic acid (ALA) was found to promote fruit anthocyanin synthesis, and this effect has been verified in apple (Malus domestica), pear (Pyrus spp.), peach (Prunus persica), grape (Vitis vinifera), strawberry (Fragaria × ananassa), pomegranate (Punica granatum), litchi (Litchi chinensis) and cherry (Prunus avium). In apple, ALA promotes fruit coloring by up-regulating the expression of structural genes and transcription factors involved in anthocyanin biosynthesis and transport pathways, or by shortening the fruit ripening period, and also promotes fruit coloring by interacting with other hormones, and promotes anthocyanin accumulation by down-regulating porphyrin metabolism.

[0004] Exogenous ALA treatment can promote the synthesis of chlorophyll and heme in plants, but whether ALA-induced heme rise is related to anthocyanin accumulation has not been reported. SUMMARY

[0005] To solve the above problems, the present application provides a MdHEMH2 gene for promoting apple anthocyanin synthesis and application thereof. The present application finds a key gene MdHEMH2 in the endogenous ALA metabolic pathway to form heme in apple, which not only has the function of promoting apple anthocyanin synthesis, but also is promoted by exogenous ALA, and exogenous ALA supplementation can increase the expression of the MdHEMH2 gene.

[0006] To achieve the above purpose, the present application provides the following technical scheme:

[0007] The application provides application of an MdHEMH2 gene in regulation of anthocyanin synthesis in plants, wherein an amino acid sequence of a protein encoded by the MdHEMH2 gene is shown as SEQ ID NO. 1.

[0008] Preferably, the regulation is that increasing the expression amount of the MdHEMH2 gene promotes anthocyanin synthesis in plants, or decreasing the expression amount of the MdHEMH2 gene inhibits anthocyanin synthesis in plants.

[0009] Preferably, the substance for increasing the expression amount of the MdHEMH2 gene comprises a recombinant vector containing the MdHEMH2 gene and / or 5-aminolevulinic acid; and the substance for decreasing the expression amount of the MdHEMH2 gene comprises a silencing vector for silencing the MdHEMH2 gene.

[0010] Preferably, the plants comprise peaches, litchis, grapes or apples.

[0011] The application provides a recombinant vector for promoting anthocyanin synthesis in apples, comprising a basic vector and an MdHEMH2 gene inserted into the basic vector, wherein an amino acid sequence of a protein encoded by the MdHEMH2 gene is shown as SEQ ID NO. 1.

[0012] The application provides an MdHEMH2 gene silencing vector for inhibiting anthocyanin synthesis in apples, comprising a basic silencing vector and a target sequence inserted into the basic silencing vector, wherein a nucleotide sequence of the target sequence is shown as SEQ ID NO. 18.

[0013] Preferably, the basic silencing vector comprises a pHELLSGATE4 vector.

[0014] The application provides application of the recombinant vector or the MdHEMH2 gene silencing vector in apple breeding.

[0015] The application provides a method for promoting anthocyanin synthesis in apples, comprising: introducing the recombinant vector into apple tissues or plants.

[0016] Preferably, the method further comprises: supplementing 5-aminolevulinic acid to the apple tissues or plants.

[0017] Beneficial effects:

[0018] The application provides application of an MdHEMH2 gene in regulation of synthesis of anthocyanins in plants, and an amino acid sequence of a protein encoded by the MdHEMH2 gene is shown in SEQ ID NO. 1. The application uses a molecular biology method to screen a gene MdHEMH2 capable of regulating accumulation of anthocyanins in apples from the apples. It is proved by GUS reporter gene expression, biological information analysis, subcellular localization, transient and stable genetic expression and other tests that the MdHEMH2 gene plays a positive regulation role in ALA-induced anthocyanin accumulation and has a function of promoting accumulation of anthocyanins in apples. In addition, exogenous ALA can induce expression of the MdHEMH2 gene and participate in accumulation of anthocyanins in apples. The MdHEMH2 gene can be used to improve fruit quality and provide technical support for breeding of new plant varieties, and the MdHEMH2 gene can also be overexpressed in other fruit trees (peach, litchi or grape) to improve the content of anthocyanins. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows.

[0020] Figure 1 The results of effects of ALA treatment on coloring of apple leaves and callus; wherein A is the results of effects of ALA treatment on coloring of apple leaves, and B is the results of effects of ALA treatment on coloring of apple callus;

[0021] Figure 2 The vector structure of ProMdHEMH2:GUS (A) and the results of ALA-promoted GUS staining enhancement effect (B);

[0022] Figure 3 The results of subcellular localization analysis of MdHEMH2-GFP;

[0023] Figure 4 The schematic diagram of recombination reaction principle of the interference type recombinant plasmid RNAi-MdHEMH2;

[0024] Figure 5 The results of effects of overexpression or inhibited expression of MdHEMH2 on accumulation of anthocyanins in apple fruits, leaves and callus. DETAILED DESCRIPTION

[0025] The application provides application of an MdHEMH2 gene in regulation of synthesis of anthocyanins in plants, and an amino acid sequence of a protein encoded by the MdHEMH2 gene is shown in SEQ ID NO. 1, and the specific application is as follows:

[0026] MAAESIAMLPWTISSAVPSDHRLPPRGGLLCGSHIHTSAAPVRNCVVARYSSTQSALLFSKNSLRKCLPPLKALVASETLDAPSTPFSGEDKVGVLLLNLGGPETLDDVQPFLFNLFADPDIIRLPRLFRFLQKPLAQFISVLRAPKSKEGYASIGGGSPLRRITDEQAEELRKALYAKDVPAKVYVGMRYWHPFTEEAIEQIKRDGITKLVVLPLYPQFSISTSGSSLRLLESIFREDEYLVNMQHTVIPSWYQREGYITAMANLIEKELQCFDSPEKVMIFFSAHGVPLAYVEEAGDPYKAEMEECIDLIMEELEKRKITNAYTLAYQSRVGPVEWLKPYTDETIIELGKKGVKRLLAVPISFVSEHIETLEEIDVEYKELALKSGIEVWGRVPALGCEPTFISDLADAVIESLPYVGAMAVSHLEARQSLVPLGSVEELLATYDSQRRELPAPVTVWEWGWTKSAETWNGRAAMLAVVVLLVLEVTTGEGFLHQWGILPLHR.

[0027] In the present application, the regulation preferably refers to: increasing the expression amount of the MdHEMH2 gene to promote anthocyanin synthesis of the plant, or decreasing the expression amount of the MdHEMH2 gene to inhibit anthocyanin synthesis of the plant. The substance for increasing the expression amount of the MdHEMH2 gene preferably includes: a recombinant vector containing the MdHEMH2 gene and / or 5-aminolevulinic acid; the substance for decreasing the expression amount of the MdHEMH2 gene preferably includes: a silencing vector for silencing the MdHEMH2 gene; the plant preferably includes peach, litchi, grape or apple, more preferably apple; the nucleotide sequence of the MdHEMH2 gene is preferably as shown in SEQ ID NO. 2, specifically as follows:

[0028]

[0029] In the process of studying 5-aminolevulinic acid (ALA) induced apple anthocyanin accumulation, it was found that the key gene MdHEMH2 in the metabolic pathway of 5-aminolevulinic acid (ALA) induced apple anthocyanin accumulation, that is, the key link that the iron chelating enzyme FECH encoded by MdHEMH2 converts protoporphyrin IX into Heme. The gene has a login number of MD12G1256700 on GDR (Rosaceae Genome Database), and a CDS length of 1518 bp (base pairs). The encoded protein iron chelating enzyme (FECH) is composed of 505 amino acids, located on chromosome 12, with a molecular weight of 56.33 kDa and an isoelectric point of 5.3. The extinction coefficient is 1.433, and the stability coefficient is 50.08. In the amino acid composition, the contents of leucine (Leu) and glutamic acid (Glu) are the highest, accounting for 12.3% and 9.1%, respectively. The total average hydrophilic index is -0.009, which is a hydrophilic protein. Subcellular localization analysis shows that the MdHEMH2 protein is located in chloroplast. In the GUS detection analysis, exogenous ALA treatment significantly activates the MdHEMH2 promoter and promotes the expression of proMdHEMH2:GUS. This shows that exogenous ALA can activate the MdHEMH2 promoter activity and promote the transcription of MdHEMH2 gene. The transient transformation of MdHEMH2 gene (including overexpression OE-MdHEMH2 and inhibition expression RNAi-MdHEMH2) in apple fruit and apple tissue culture seedling leaves shows that OE-MdHEMH2 can promote the accumulation of apple anthocyanin; on the contrary, RNAi-MdHEMH2 inhibits the accumulation of apple anthocyanin. In addition, through the stable transformation of apple callus and the treatment of exogenous ALA, the results show that OE-MdHEMH2 can significantly promote the accumulation of anthocyanin in apple callus, and the anthocyanin content increases significantly after exogenous ALA treatment; while the anthocyanin content of RNAi-MdHEMH2 apple callus decreases significantly, and the anthocyanin content also has no significant change under ALA treatment. Based on the above results, it can be known that MdHEMH2 is a new key gene for regulating apple anthocyanin accumulation, and the overexpression of MdHEMH2 gene promotes the synthesis of FECH enzyme, thereby improving the accumulation of anthocyanin, and plays a key role in the regulation of apple anthocyanin accumulation by ALA. This discovery has far-reaching significance for the production of agriculture and forestry, and provides technical support for the application of ALA in the field of agricultural production.

[0030] Based on the above advantages, the application provides a recombinant vector for promoting apple anthocyanin synthesis, which comprises a basic vector and a MdHEMH2 gene inserted into the basic vector, and the amino acid sequence of the protein encoded by the MdHEMH2 gene is preferably as shown in SEQ ID NO. 1. In the application, the basic vector preferably comprises a pCAMBIA1300 vector; and the MdHEMH2 gene is preferably inserted between the Bam HI and Xba I enzyme cutting sites of the pCAMBIA1300 vector. The recombinant vector provided by the application can overexpress the MdHEMH2 gene in apples, thereby promoting apple anthocyanin synthesis.

[0031] Based on the above advantages, the application provides a MdHEMH2 gene silencing vector for inhibiting apple anthocyanin synthesis, which comprises a basic silencing vector and a target sequence inserted into the basic silencing vector, and the nucleotide sequence of the target sequence is as shown in SEQ ID NO. 18, and specifically as follows:

[0032] 5'-ATGGCGGCTGAATCCATAGCAATGCTACCGTGGACAATATCCTCCGCCGTCCCCTCCGACCACCGCCTGCCGCCGCGCGGAGGATTACTCTGCGGTTCTCACATCCACACCTCCGCAGCTCCAGTTAGAAATTGCGTCGTCGCCAGATACTCCTCGACGCAATCTGCTCTGCTTTTCTCCAAGAACTCGCTCCGGAAATGCCTGCCGCCGCTAAAGGCGTTGGTGGCGTCGGAAACTCTGGACGCTCCGTCGACGCCGTTTAGTGGGGAGG-3'.

[0033] In the application, the basic silencing vector preferably comprises a pHELLSGATE4 vector; and the target sequence is preferably recombined onto the pHELLSGATE4 vector by using a BP reaction and replaces the ccdB gene on the pHELLSGATE4 vector. The MdHEMH2 gene silencing vector provided by the application can reduce the expression amount of the MdHEMH2 gene in apples, thereby inhibiting apple anthocyanin synthesis.

[0034] Based on the above advantages, the application provides the use of the recombinant vector described in the above technical solution or the use of the MdHEMH2 gene silencing vector described in the above technical solution in apple breeding. The recombinant vector provided by the application can promote apple anthocyanin synthesis and can be used for cultivating transgenic apples with high anthocyanin content; and the MdHEMH2 gene silencing vector provided by the application can inhibit apple anthocyanin synthesis and can be used for cultivating transgenic apples with low anthocyanin content.

[0035] Based on the above advantages, the application provides a method for promoting apple anthocyanin synthesis, comprising:

[0036] The recombinant vector is introduced into apple tissue or a plant.

[0037] In the application, the apple tissue preferably comprises leaves or callus; the method preferably further comprises: supplementing 5-aminolevulinic acid exogenously to the apple tissue or plant; the working concentration of the 5-aminolevulinic acid is preferably 0.25-200 mg / L, further preferably 10-35 mg / L, and more preferably 25 mg / L. After the recombinant vector is introduced into the apple tissue, the apple tissue into which the recombinant vector is introduced is preferably cultivated into a transgenic apple plant.

[0038] In order to further illustrate the application, the application of the MdHEMH2 gene for promoting apple anthocyanin synthesis is described in detail below in combination with the accompanying drawings and examples, but they should not be understood as limiting the protection scope of the application.

[0039] Example 1

[0040] ALA induces apple leaf anthocyanin accumulation and its promoting effect on MdHEMH2 expression

[0041] The in vitro leaves of 'Fuji' apple tissue culture seedlings were cultured on MS medium added with 25 mg / L ALA (treatment group, denoted as ALA), and the control group of leaves was cultured on MS medium (denoted as Control). Both the treatment group and the control group were pretreated in the dark for 24 h. Then they were transferred to 17℃, light intensity 200 μmol·m -2 ·s -1 The incubator was continuously illuminated for 5 d, and samples were taken at 1 d, 3 d and 5 d, respectively. Anthocyanins were extracted with a hydrochloric acid-methanol solution with a volume concentration of 1%, and the absorbance values of OD 530 , OD 620 and OD 650 were measured, and the anthocyanin content was calculated. The calculation method is shown in

Zheng J., et al., 2021, Front. Plant Sci., 12: 640606. doi: 10.3389 / fpls.2021.640606

[0042] MdHEMH2-F: 5'-CAGCAAGGCCAAGGACAAA-3', SEQ ID NO. 3;

[0043] MdHEMH2-R: 5'-TTACTGCCAATGCCCGAAC-3', SEQ ID NO. 4;

[0044] MdActin-F: 5'-TGACCGAATGAGCAAGGAAATTACT-3', SEQ ID NO. 5;

[0045] MdActin-R: 5'-TACTCAGCTTTGGCAATCCACATC-3', SEQ ID NO. 6.

[0046] The control group and the treatment group were set with 3 biological replicates, and 3 leaves were placed in each replicate. The anthocyanin content determination results are shown in Table 1, and the MdHEMH2 gene expression determination results are shown in Table 2.

[0047] Table 1 Anthocyanin content of leaves treated at different times (unit: nmol·g -1 Fresh weight)

[0048] Treatment time (d) 1 3 5 Control group (Control) 22.40±0.84e 47.63±0.86d 76.50±0.83b Treatment group (Control) 24.40±0.81e 68.80±0.67c 113.40±1.62a

[0049] Note: The anthocyanin content in the table is the average value ± standard error of three biological replicates. Different lowercase letters after the data represent significant differences at P = 0.05 level.

[0050] Table 2 Relative expression of MdHEMH2 gene in leaves treated at different times

[0051]

[0052] The results show that ALA treatment can significantly promote the accumulation of anthocyanins in apples (Table 1). The difference between the treatment group and the control group reached the significant level of P = 0.05 after 3 days of illumination; the anthocyanin content of the ALA treatment was 48.24% higher than that of the control after 5 days of illumination. At the same time, ALA also significantly increased the relative expression of MdHEMH2 gene (Table 2).

[0053] The apple leaves and callus of the control group and the treatment group at different times were respectively cultured on MS solid medium, and the light intensity was 240 μmol m -2 s -1 The coloring results of the leaves and callus cultured in the incubator for 3 days (leaves) and 14 days (callus) under continuous light are shown in Figure 1 According to Table 1 and Table 2 and Figure 1It can be seen that ALA can promote the redness of apple leaves and the significant increase of anthocyanin content in leaves. At the same time, ALA can also promote the up-regulation of MdHEMH2 gene expression, indicating that there is a close relationship between the expression amount of MdHEMH2 and the accumulation of anthocyanin in leaves. In addition, the expression of MdHEMH2 rises earlier, while the anthocyanin in leaves rises later, so there is a time sequence between the changes of the two.

[0054] Example 2

[0055] ALA stimulates the promoter activity of MdHEMH2 gene

[0056] (1) The MdHEMH2 gene promoter was connected to the upstream of the GUS reporter gene in the pBI121 vector (see Fig. 1), to obtain ProMdHEMH2:GUS, and the specific method is as follows: Figure 2 wherein ATG is the initiation codon of the GUS gene, and 2000bp is the length of the MdHEMH2 promoter), and the specific method is as follows:

[0057] MdHEMH2 promoter cloning: The 'Fuji' apple peel DNA extracted by the improved CTAB method was used as the template, and specific primer pairs were designed for amplification of the MdHEMH2 promoter, and the primer sequences are as follows:

[0058] The forward primer is shown in SEQ ID NO. 7, and the specific sequence is as follows:

[0059] 5'-GACCATGATTACGCCAAGCTTCTTCAGTTTCCGTCTCGCTG-3';

[0060] The reverse primer is shown in SEQ ID NO. 8, and the specific sequence is as follows:

[0061] 5'-ACCACCCGGGGATCCTCTAGATGCCCGAGGCCTCGA-3';

[0062] The reaction system for amplification was: 100 ng DNA, 2x PhantaMix 25 μL, 1 μL forward primer, 1 μL reverse primer, and ddH2O to 50 μL. The reaction program for amplification was: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 15 s, 60 °C annealing for 15 s, 72 °C extension for 2 min, 36 cycles; 72 °C extension for 5 min. The PCR amplification product was recovered by 1% agarose gel electrophoresis, and the promoter DNA fragment was recovered by AxyGEN small gel recovery kit (Axygen Biotech Co., Ltd., China) according to the instructions. The target promoter DNA fragment was ligated with the double enzyme-digested (HindIII and BamHI) linearized pBI121 vector using recombinase ClonExpress II One Step Cloning Kit (Novagen Biotech Co., Ltd., China, C112-01). The recombinant ProMdHEMH2:GUS plant expression vector was obtained.

[0063] (2) Apple leaf transient transformation and ALA treatment

[0064] The recombinant vector ProMdHEMH2:GUS constructed in step (1) was transformed into Agrobacterium EHA105 by freeze-thaw method, and then the Agrobacterium was pressed into apple leaves by vacuum pump. The pressure of the vacuum pump was set to -0.1 MPa, and each extraction lasted for 5 min, a total of 2 times. Then dark culture was carried out for 1 d, and transient ProMdHEMH2:GUS transgenic apple leaves were obtained.

[0065] ALA treatment: apple leaves with ProMdHEMH2:GUS gene were placed on MS medium containing 25 mg / L ALA, and control (Control) leaves were placed on regular MS medium, and placed in a light incubator (temperature was 17 °C, light intensity was 200 μmol·m -2 ·s -1 ), and the culture time was 3 d.

[0066] The two kinds of apple leaves treated in different ways were immersed in GUS staining solution, and kept in a 37 °C incubator for 24 h. After taking out, the surface staining solution was washed with water, and then immersed in 75% ethanol solution to remove chlorophyll. The GUS staining solution contained 100 mM phosphate buffer (pH = 7.0), 0.1% (v / v) Triton X-100, 10 mM EDTA, 0.5 mM K3Fe(CN)6, 0.5 mM K4Fe(CN)6 and 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide. The results are shown in Figure 2 B.

[0067] The results showed that ALA treatment resulted in deeper GUS staining in apple leaves transformed with the ProMdHEMH2:GUS gene, indicating that ALA can significantly improve the activity of the MdHEMH2 promoter.

[0068] The relative expression of the GUS gene in the treatment group and the control group was determined by qRT-PCR, and the results are shown in Table 3. The reference gene was MdActin, and the primer sequences of the reference gene are shown in SEQ ID NO. 5 and SEQ ID NO. 6. The primer sequences of the GUS gene are as follows:

[0069] GUS-F: 5'-GTAACCACGCGTCTGTTGACTG-3', SEQ ID NO. 9;

[0070] GUS-R: 5'-CTCTGTCTGGCTTTTGGCTGTG-3', SEQ ID NO. 10.

[0071] Table 3 Effect of ALA treatment on the relative expression of the GUS gene

[0072] Treatment GUS gene expression Standard error 5% difference 1% difference Control 1.00 0.04 b B ALA 2.19 0.06 a A

[0073] Note: The gene expression in the table is the average value and standard error of three biological replicates. Different letters represent significant differences at P = 0.01 and 0.05 levels

[0074] The results in Table 3 show that ALA treatment significantly promotes the expression of the GUS gene controlled by the MdHEMH2 promoter, indicating that the MdHEMH2 promoter is positively regulated by exogenous ALA.

[0075] (3) Subcellular localization of MdHEMH2 protein

[0076] Total RNA of 'Fuji' apple was extracted using Fast Pure Plant Total RNA Isolation Kit (Novagen Biotech Co., Ltd., China, RC401-01), and cDNA was synthesized using First-Strand cDNA Synthesis SuperMix (Beijing Zhenbenjin Biological Technology Co., Ltd., China, AE301-02) reverse transcription kit (operation according to the instructions). The obtained cDNA was used for amplification of the full-length of the MdHEMH2 gene. MdHEMH2-specific primers were designed to clone the full-length sequence of the MdHEMH2 gene by PCR, and the primer sequences are as follows:

[0077] The forward primer is shown in SEQ ID NO. 11, and is as follows:

[0078] 5'-GAGAACACGGGGGACTCTAGAATGGCGGCTGAATCCATAGC-3';

[0079] The reverse primer is shown in SEQ ID NO. 12, and is specifically as follows: 5'-GCCCTTGCTCACCATGGATCCGCGATGTAAGGGTAATATGCCCC-3';

[0080] The amplification reaction system is the same as in Example 1. The amplification reaction procedure is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 60 s, 36 cycles; and extension at 72°C for 5 min. The PCR amplification product is recovered by 1% agarose gel electrophoresis, and then the gene fragment is recovered by using an AxyGEN small gel recovery kit (Axygen Biotech Hangzhou Co., Ltd., China). The recovered gene fragment is connected to a double-enzyme-digested (Bam HI and Xba I) linearized pCAMBIA1300 vector by using a recombination enzyme Clon Express IIOne Step Cloning Kit (Novizen Biotech Co., Ltd., China, C112-01), to obtain a recombinant vector (denoted as MdHEMH2-GFP) in which a green fluorescent protein gene (GFP) is connected to the 35S promoter.

[0081] After the recombinant vector is transformed into EHA105 Agrobacterium, it is used to infect apple and transiently infect Nicotiana benthamiana. The control is a tobacco plant (denoted as GFP) infected by Agrobacterium of the empty pCAMBIA1300 vector. After 60 h, the tobacco leaves are placed under a laser confocal microscope to observe the fluorescence distribution, and the results are shown in Figure 3 The results show that the 35S:GFP fluorescence does not have specific cell localization, while the MdHEMH2-GFP fluorescence is mainly distributed in chloroplasts. This result shows that MdHEMH2 is a protein located in chloroplasts.

[0082] Example 3: Effect of overexpression and interference of the MdHEMH2 gene on anthocyanin accumulation in apple fruits

[0083] (1) Construction of an OE-MdHEMH2 recombinant vector, the construction method of which is the same as step (3) in Example 2, and the obtained recombinant vector is denoted as recombinant vector OE-MdHEMH2 in this example. The recombinant vector OE-MdHEMH2 obtained by construction is transformed into EHA105 Agrobacterium, and then used to infect apple.

[0084] (2) Preparation of an interference-type recombinant plasmid RNAi-MdHEMH2

[0085] According to the nucleotide sequence of MdHEMH2 gene (SEQ ID NO. 2), the conserved domain sequence is predicted by means of the SMART online website as shown in SEQ ID NO. 13, and the specific process is as follows:

[0086] 5'- ATATCCTCCGCCGTCCCCTCCGACCACCGCCTGCCGCCGCGCGGAG GATTACTCTGCGGTTCTCACATCCACACCTCCGCAGCTCCAGTTAGAAATTGCGTCGTCGCCAGATACTCCTCGACGCAATCTGCTCTGCTTTTCTCCAAGAACTCGCTCCGGAAATGCCTGCCGCCGCTAAAGGCGTTGGTGGCGTCGGAAACTCTGGACGCTCCGTCGACGCCGTTTAGTGGGGAGGATAAAGTCGGAGTCTTGCTGCTTAACCTCGGTGGGCCCGAGACCCTCGACGACGTCCAGCCCTTCTTGTTTAACCTCTTCGCTGATCCGGATATCATTAGACTGCCGAGGCTGTTTCGGTTCCTTCAGAAGCCATTGGCGCAATTTATATCCGTTCTGAGGGCGCCAAAGAGCAAAGAAGGCTACGCCTCCATTGGCGGCGGCTCTCCTCTTCGACGGATAACTGATGAACAGGCGGAAGAATTGAGGAAGGCCCTTTATGCGAAGGATGTCCCAGCAAAAGTGTATGTTGGTATGCGTTATTGGCATCCGTTTACTGAAGAAGCTATAGAACAGATAAAAAGAGATGGAATTACAAAGCTTGTCGTCCTTCCTCTTTATCCACAATTTTCAATATCAACTAGTGGTTCAAGCCTTCGGCTCCTGGAGAGTATATTCCGGGAGGACGAATATCTTGTCAACATGCAGCACACAGTAATACCATCTTGGTACCAGCGTGAAGGGTACATAACGGCAATGGCAAATTTGATTGAAAAAGAGCTTCAATGTTTTGACAGCCCTGAAAAAGTAATGATATTCTTTAGCGCACATGGAGTGCCACTTGCATATGTGGAAGAGGCTGGTGATCCGTACAAGGCGGAGATGGAGGAATGCATAGATTTGATAATGGAGGAGTTAGAAAAGAGAAAAATAACTAATGCGTACACCCTTGCCTATCAGAGCAGAGTTGGACCTGTGGAGTGGTTAAAACCCTACACAGATGAGACAATAATTGAGCTTGGAAAAAAGGGAGTCAAAAGACTGCTGGCAGTCCCTATAAGCTTTGTCAGCGAGCATATTGAAACTCTAGAAGAAATCGATGTTGAGTACAAAGAATTGGCTCTGAAATCTGGTATAGAGGTTTGGGGGCGTGTTCCCGCACTAGGATGTGAACCCACCTTCATTTCAGATTTGGCAGATGCGGTGATTGAGAGCTTGCCATATGTTGGAGCTATGGCAGTCTCACATCTTGAAGCTCGACAGTCTTTAGTTCCACTTGGGAGTGTGGAAGAGTTGTTAGCAACATATGATTCACAGCGTAGGGAGCTACCGGCACCTGTGACTGTTTGGGAATGGGGTTGGACAAAAAGTGCCGAGACTTGGAATGGAAGAGCAGCTATGTTGGCAGTGGTGGTTCTACTGGTCCTAGAAGTCACCACCGGGGAGGGGTTTTTGCACCAA-3'. According to the design of the conserved domain, the forward and reverse primers (F and R) are added at the 5' end, respectively, and the sequences of the attB1 and attB2 sites are added, which are as follows:

[0087] F: 5'-ggggacaagtttgtacaaaaaagcagg ATGGCGGCTGAATCCATAGC-3', SEQ ID NO. 14;

[0088] R: 5'-ggggaccactttgtacaagaaagctgg CCTCCCCACTAAACGGCG-3', SEQ ID NO. 15.

[0089] Among them, 5'-ggggacaagtttgtacaaaaaagcagg-3', SEQ ID NO. 16 in the forward primer (F) is the sequence of the attB1 site, and 5'-ggggaccactttgtacaagaaagctgg-3', SEQ ID NO. 17 in the reverse primer (R) is the sequence of the attB2 site.

[0090] The method in step (3) of Example 2 is used to amplify the primers shown in SEQ ID NO. 14 and SEQ ID NO. 15 to obtain the amplification product.

[0091] The amplified product and the donor vector (pHELLSGATE4 vector) containing attP1 and attP2 are subjected to recombination reaction under the action of BP reaction recombinase (see the recombination schematic diagram in Figure 4 ), and the amplified gene fragment is recombined into the pHELLSGATE4 vector, and the ccdB gene which can kill the common strain of Escherichia coli is replaced, to obtain the expression interference recombinant plasmid RNAi-MdHEMH2.

[0092] However, when the recombination reaction occurs between the attB candidate gene fragment and the attP donor vector, there are two experimental results: one is the correct recombination required by the experiment, and the direction of the intron does not change, and after the plant is transformed, the hairpin structure can be normally formed, the splicing function is exerted, and the functional RNAi fragment is formed (see the left side in Figure 4 ); the other is the trans-intron reaction between attB2 and attP2, which causes the direction of the intron to be converted, and becomes the wrong recombination which loses the splicing function (see the right side in Figure 4 ). Therefore, the obtained recombinant plasmid is subjected to single enzyme digestion verification of Xba I and Xho I using 1% agarose gel electrophoresis, and the plasmids with the same band size produced by the two enzyme digestion are correct recombinant plasmids. The interference recombinant plasmid RNAi-MdHEMH2 verified by enzyme digestion is transformed into Agrobacterium EHA105, and then the apple is infected.

[0093] (3) Effect of transient transformation of apple by OE-MdHEM and RNAi-MdHEMH2 on accumulation of anthocyanin in fruit peel

[0094] The Agrobacterium containing the empty pCAMBIA1300 vector (Empty vector, EV) and the Agrobacterium containing the overexpression 35S:MdHEMH2 vector (OE-MdHEM) are inoculated into LB liquid medium containing 100 mg / L Kan (kanamycin) and 100 mg / L rifampicin, respectively, and the Agrobacterium containing the inhibition expression P4-MdHEMH2 vector (RNAi-MdHEMH2) is inoculated into LB liquid medium containing 100 mg / L Spe (spectinomycin) and 100 mg / L rifampicin. The culture is shaken at 28°C and 200 rpm until the OD 600nmThe value reached about 0.5. The bacteria were separated by centrifugation, and the supernatant was removed. The bacteria were resuspended in a buffer containing 10 mM magnesium chloride, 10 mM 2-(N-morpholino)ethanesulfonic acid and 120 μM acetosyringone. Three kinds of Agrobacterium were injected into the peel of 'Guangguang' apple fruit using a disposable syringe. After injection, the apples were placed in a dark environment for 24 h. Then, they were transferred to a light incubator with a light intensity of 200 μmol m -2 s -1 Figure 5

[0095] Table 4 Effect of overexpression or suppression of MdHEMH2 on the content of anthocyanins in apple peel

[0096] Treatment Anthocyanins (nmol·g -1 )]]> EV 36.22±1.24b OE-MdHEMH2 94.27±0.39a RNAi-MdHEMH2 25.64±0.65c

[0097] Note: The anthocyanin content in the table is the average value ± standard error of three biological replicates. Different lowercase letters after the data represent significant differences at P = 0.05 level.

[0098] The results showed that OE-MdHEMH2 increased the anthocyanin content by 160.3%, while RNAi-MdHEMH2 injection made the anthocyanin content in the peel only 70.8% of that of EV. This result showed that overexpression of MdHEMH2 gene promotes the accumulation of anthocyanins in apple peel, while suppression of MdHEMH2 gene inhibits the accumulation of anthocyanins in apple peel.

[0099] Example 4

[0100] Effect of overexpression and suppression of MdHEMH2 gene on the accumulation of anthocyanins in apple callus and the effect of exogenous ALA treatment

[0101] The Agrobacterium containing the OE-MdHEMH2 recombinant vector and the Agrobacterium containing the RNAi-MdHEMH2 recombinant plasmid prepared in Example 3 were used to infect 'Wanglin' apple callus, respectively, and the specific steps were as follows:

[0102] ​​The Agrobacterium liquid containing OE-MdHEMH2 and the Agrobacterium liquid containing RNAi-MdHEMH2 were added to 14d-old 'Wanlin' apple callus culture, and dark culture (infection) was carried out for 1-2d. Then, the OE-MdHEMH2 infected callus was transferred to a selection MS medium containing hygromycin, and the RNAi-MdHEMH2 infected callus was transferred to a selection MS medium containing spectinomycin, and the culture was continued for 40-50d, and resistant cells were obtained respectively. The newly grown resistant cells were subcultured, and their DNA was extracted, and positive identification was carried out using the forward primer sequence (SEQ ID NO. 11) and the reverse primer sequence (SEQ ID NO. 12) for PCR amplification, and the obtained cells were confirmed to be OE-MdHEMH2 or RNAi-MdHEMH2 transgenic apple callus.

[0103] ALA treatment: the wild type (WT) cells, OE-MdHEMH2 and RNAi-MdHEMH2 transgenic apple callus were transferred to MS medium containing 25mg / L ALA respectively, and the culture was carried out at 17℃ with a light intensity of 200μmol·m-2s-1for 14d. -2 -1 The culture was carried out under continuous light in an incubator for 14d. At the same time, the effect of ALA on anthocyanin accumulation in apple callus was observed using conventional MS medium without ALA as a control (Control), and the results are shown in Fig. B. The anthocyanin content of cells of different genotypes and different treatments was determined using the method in Example 1, and the results are shown in Table 5. Figure 5

[0104] Table 5 Effect of ALA treatment on anthocyanin content of apple callus cells of different genotypes

[0105] Group Control group (nmol g -1 Fresh weight) ALA (nmol·g -1 Fresh weight) WT 9.16±0.71d 22.11±0.75b OE-MdHEMH2 17.14±0.75c 42.97±1.46a RNAi-MdHEMH2 3.59±0.07e 5.45±0.12e

[0106] Note: the anthocyanin content in the table is the average value ± standard error of three biological replicates. Different lowercase letters after the data represent significant differences at P=0.05 level.

[0107] ​​The results showed that the anthocyanin content of OE-MdHEMH2 transformed callus was 87.1% higher than that of WT control, and the anthocyanin content of callus treated with exogenous ALA was 141.3% higher than that of WT control. If the callus was treated with ALA, the anthocyanin content of OE-MdHEMH2 transformed callus was 369.1% higher than that of WT control. These results indicated that OE-MdHEMH2 gene significantly promoted the accumulation of apple anthocyanin, and exogenous ALA could further promote the accumulation of apple anthocyanin by promoting the expression of MdHEMH2. On the contrary, the anthocyanin content of RNAi-MdHEMH2 transformed callus was only 39.2% of that of WT control. Although exogenous ALA treatment could increase the anthocyanin content of callus, the effect was not significant, indicating that when the expression of MdHEMH2 gene was inhibited, the effect of ALA on promoting the accumulation of apple anthocyanin was seriously hindered. Therefore, MdHEMH2 is a key regulatory gene in the process of ALA-induced apple anthocyanin synthesis.

[0108] Example 5 Effect of overexpression and interference of MdHEMH2 on apple leaf anthocyanin accumulation and effect of exogenous ALA treatment

[0109] The Agrobacterium liquid of OE-MdHEMH2 and RNAi-MdHEMH2 obtained in Example 3 and the Empty vector Agrobacterium were forced into apple leaves by vacuum pump method. The pressure of vacuum pump method was set to-0.1 MPa, and each extraction was 5 min, a total of 2 times. Then dark culture for 1 d, obtain transient overexpression (OE-MdHEMH2) MdHEMH2 transgenic apple leaves, interference expression MdHEMH2 transgenic apple leaves (RNAi-MdHEMH2) and empty vector control apple leaves.

[0110] Different genotypes of 'Fuji' apple leaves were placed on MS medium containing 25 mg / L ALA, and the light intensity was 200 μmol·m -2 ·s -1 Incubator continuous light culture for 3 d. At the same time, the conventional MS medium without ALA was used as a control to compare the effect of ALA treatment, and the results are shown in Figure 5 C. The anthocyanin content of different leaves was determined by the method in Example 1, and the results are shown in Table 6.

[0111] Table 6 Effect of ALA treatment on anthocyanin content of different genotypes of apple leaves in vitro

[0112] Group Control (nmol g -1 Fresh weight) ALA (nmol·g -1 Fresh weight) Empty vector 39.16±0.83d 71.60±0.97b OE-MdHEMH2 57.13±0.76c 132.3±1.13a RNAi-MdHEMH2 20.60±1.21f 27.1±1.44e

[0113] Note: The anthocyanin content in the table is the average value ± standard error of three biological replicates. Different lowercase letters after the data represent significant differences at P=0.05 level.

[0114] The results showed that the anthocyanin content of OE-MdHEMH2 was 45.9% higher than that of EV, and the anthocyanin content of EV treated with ALA was 82.7% higher than that of EV. If the OE-MdHEMH2 leaves were treated with exogenous ALA, the anthocyanin content was 230.7% higher than that of EV. These results again showed that the OE-MdHEMH2 gene could promote the accumulation of apple anthocyanin, and exogenous ALA could further enhance the accumulation of apple anthocyanin by promoting the expression of MdHEMH2. On the contrary, the anthocyanin content of RNAi-MdHEMH2 was only 52.6% of that of EV. If the RNAi-MdHEMH2 leaves were treated with exogenous ALA, the anthocyanin content was 31.6% higher than that of RNAi-MdHEMH2, but still lower than that of other samples. These results showed that MdHEMH2 was an important gene affecting apple anthocyanin accumulation, especially ALA-induced apple anthocyanin accumulation, which largely depended on the expression of MdHEMH2 gene. Once interfered, the accumulation of anthocyanin was severely inhibited.

[0115] These results showed that MdHEMH2 was a new key factor for regulating apple anthocyanin accumulation. It was downstream of ALA metabolism, and the gene promoter was positively regulated by exogenous ALA, which played an important role in ALA-induced apple anthocyanin accumulation. Reasonable use of this characteristic not only could breed new apple varieties, but also could further exert the effect of ALA on improving fruit quality, which had important application value in modern fruit production.

[0116] In summary, ALA metabolism and its product Heme were closely related to anthocyanin accumulation. In the process of ALA metabolism, FECH catalyzed the conversion of PPIX to Heme. The gene MdHEMH2 encoding FECH was an important ALA-regulated gene. This finding provided a new way and idea for the mechanism of ALA promoting anthocyanin accumulation.

[0117] Although the above embodiments have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which belong to the protection scope of the present application.

Claims

1. Application of the MdHEMH2 gene in regulating anthocyanin synthesis in plants, wherein the amino acid sequence of the protein encoded by the MdHEMH2 gene is shown in SEQ ID NO.1; the regulation is: increasing the expression level of the MdHEMH2 gene to promote anthocyanin synthesis in plants, or decreasing the expression level of the MdHEMH2 gene to inhibit anthocyanin synthesis in plants; wherein the plant is apple.

2. The application according to claim 1, characterized in that, Substances that increase the expression level of the MdHEMH2 gene include: a recombinant vector containing the MdHEMH2 gene; substances that decrease the expression level of the MdHEMH2 gene include: a silencing vector that silences the MdHEMH2 gene.

3. The application of a recombinant vector that promotes anthocyanin synthesis or a MdHEMH2 gene silencing vector that inhibits anthocyanin synthesis in regulating anthocyanin synthesis; wherein the recombinant vector that promotes anthocyanin synthesis comprises a base vector and an MdHEMH2 gene inserted into the base vector, the amino acid sequence of the protein encoded by the MdHEMH2 gene being shown in SEQ ID NO.1; wherein the MdHEMH2 gene silencing vector that inhibits anthocyanin synthesis comprises a base silencing vector and a target sequence inserted into the base silencing vector, the nucleotide sequence of the target sequence being shown in SEQ ID NO.

18.

4. The application according to claim 3, characterized in that, The basic silencing vector includes the pHELLSGATE4 vector.

5. A method for promoting the synthesis of apple anthocyanins, characterized in that, include: The recombinant vector that promotes the synthesis of anthocyanins in apples was introduced into apple tissues or plants. The recombinant vector that promotes the synthesis of apple anthocyanins includes a base vector and an MdHEMH2 gene inserted into the base vector, the amino acid sequence of the protein encoded by the MdHEMH2 gene being shown in SEQ ID NO.

1.

6. The method according to claim 5, characterized in that, The method further includes: exogenously supplementing the apple tissue or plant with 5-aminolevulinic acid.

Images