A molecular marker-assisted breeding method for disease-resistant Tibetan sheep

Abstract

The present invention belongs to the field of molecular biological detection technology, and in particular, relates to a molecular marker-assisted breeding method for Tibetan sheep with strong disease resistance. The present invention obtains a molecular marker for assisting the breeding of Tibetan sheep with strong disease resistance through screening, and the molecular marker is located at the 164719075th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is T or C. The molecular marker can be used to obtain the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M of Tibetan sheep individuals, and provides a new molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes. Provide a basis for breeding Tibetan sheep with high immunity.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to a molecular marker-assisted breeding method for Tibetan sheep with strong disease resistance. Background Art

[0002] The characteristics of the Qinghai-Tibet Plateau are: high altitude, low air pressure, strong ultraviolet rays, lack of oxygen, etc. The environment in the region is harsh, and Tibetan sheep with higher disease resistance are needed to adapt to such an environment. Therefore, the selection of Tibetan sheep with high disease resistance needs to be solved urgently.

[0003] Starting from the genetic basis of disease resistance, we screen resistance genes, carry out disease-resistant breeding at the molecular level, improve the disease resistance of Tibetan sheep genetically, and enhance immunity to improve the disease resistance of Tibetan sheep.

[0004] Immune indicators can reflect the disease resistance of animals. Immune indicators include antibody levels, immune cell quantity and function, etc. Antibodies are protein molecules produced by B cells that can specifically bind to or neutralize pathogens and enhance immune responses. The quantity and function of immune cells are also indicators that reflect the state of the immune system. When the immune system is challenged, immune cells will be activated and begin to proliferate to prevent the invasion of pathogens. Immune cells will differentiate into more effector cells, such as macrophages and cytotoxic T cells, to eliminate pathogens.

[0005] It can be seen that immune indicators can be used as a reference for evaluating the disease resistance and health status of animals. By monitoring the changes in immune indicators, animal immune problems can be discovered in a timely manner, and corresponding measures can be taken to improve their disease resistance, prevent and treat diseases.

[0006] With the rapid development of molecular marker technology, the foundation for the study of the genetic mechanism of disease resistance of Tibetan sheep at the molecular level has been established. Screening and obtaining corresponding molecular markers for more efficient use in disease-resistant breeding of Tibetan sheep is an important issue in this field. In the prior art, there are not many molecular markers related to Tibetan sheep immunity for molecular marker-assisted selection related to disease resistance. Therefore, it is particularly important to provide a molecular marker related to the immune traits of Tibetan sheep for use in molecular marker-assisted breeding of Tibetan sheep. Summary of the invention

[0007] The purpose of the present invention is to provide a molecular marker-assisted breeding method for Tibetan sheep with strong disease resistance.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] The invention provides a molecular marker for assisting in breeding Tibetan sheep with strong disease resistance. The molecular marker is located at the 164719075th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is T or C.

[0010] Preferably, the genotype of the Tibetan sheep with the mutant base T is TT or TC;

[0011] The genotype of Tibetan sheep with the mutant base C is CC;

[0012] The levels of immunoglobulin A and immunoglobulin G in Tibetan sheep with CC genotype were significantly higher than those in Tibetan sheep with TC or TT genotypes.

[0013] The levels of immunoglobulin A and immunoglobulin G in Tibetan sheep with genotype TC were significantly higher than those in Tibetan sheep with genotype TT.

[0014] The content of immunoglobulin M in Tibetan sheep with genotype TC or CC was significantly higher than that in Tibetan sheep with genotype TT.

[0015] There was no significant difference in the content of immunoglobulin M between Tibetan sheep with genotype TC and that with genotype CC.

[0016] The present invention also provides the use of the molecular marker in preparing a product for assisting in breeding Tibetan sheep with strong disease resistance.

[0017] The present invention also provides a primer pair for amplifying the molecular marker, and the primer pair is shown as SEQ ID NO.1-2.

[0018] The present invention also provides the use of the primer pair in preparing a product for assisting in breeding Tibetan sheep with strong disease resistance.

[0019] The present invention also provides a molecular marker-assisted breeding method for Tibetan sheep with strong disease resistance, comprising the following steps:

[0020] (1) Extracting Tibetan sheep genomic DNA;

[0021] (2) using the genomic DNA obtained in step (1) as a template and using the primer pair to amplify to obtain a PCR amplification product;

[0022] (3) Performing genotyping analysis on the PCR amplification products to obtain Tibetan sheep with different genotypes, associating the genotypes of Tibetan sheep with immunoglobulins, screening Tibetan sheep with high immunoglobulin content, and obtaining Tibetan sheep with strong disease resistance;

[0023] The genotype of Tibetan sheep with molecular marker locus T is TT or TC;

[0024] The genotype of Tibetan sheep with molecular marker locus C is CC.

[0025] Preferably, the amplification system in step (2) is: 21-23 μL of Gold Mix (green), 0.8-1.2 μL of upstream and downstream primers, and 0.8-1.2 μL of template.

[0026] Preferably, the amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 56.5°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

[0027] The present invention also provides the application of the Tibetan sheep molecular marker-assisted breeding method in screening Tibetan sheep with high disease resistance.

[0028] The present invention also provides a kit for assisting in breeding Tibetan sheep with high disease resistance, comprising the molecular marker or the primer pair.

[0029] The present invention provides a molecular marker-assisted breeding method for Tibetan sheep with strong disease resistance. The present invention relates to a molecular marker for assisting the breeding of Tibetan sheep with strong disease resistance, wherein the molecular marker is located at the 164719075th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is T or C. When the 164719075th base is T, the genotype is TT or TC; when the 164719075th base is C, the genotype is CC; through the association analysis between different genotypes and the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it was found that the contents of immunoglobulin A and immunoglobulin G in Tibetan sheep individuals with genotype CC were significantly higher than those in Tibetan sheep individuals with genotype TC or TT (p<0.05); the contents of immunoglobulin A and immunoglobulin G in Tibetan sheep individuals with genotype TC were significantly higher than those in Tibetan sheep individuals with genotype TT (p<0.05); the content of immunoglobulin M in Tibetan sheep individuals with genotype TC or Tibetan sheep individuals with genotype CC was significantly higher than that in Tibetan sheep individuals with genotype TT (p<0.05); there was no significant difference in the content of immunoglobulin M between Tibetan sheep individuals with genotype TC and Tibetan sheep individuals with genotype CC. The present invention also provides a primer pair that can amplify the gene fragment at the 164719075th base. The primer pair and the Tibetan sheep molecular marker-assisted breeding method of the present invention are used to detect the base at the 164719075th nucleotide site on the third chromosome of the Tibetan sheep, and the content of immunoglobulin A, immunoglobulin G and immunoglobulin M of the Tibetan sheep individual can be obtained, providing a new molecular marker resource for Tibetan sheep immune trait marker-assisted selection for non-diagnostic purposes. Provide a basis for the breeding of Tibetan sheep with high immunity and high disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 is the PCR amplification product; M represents Marker; 1, 2, and 3 represent three groups of repetitions.

[0031] Figure 2 The peak diagram and sequence are obtained after the PCR product is purified and sequenced. DETAILED DESCRIPTION

[0032] The invention provides a molecular marker for assisting in breeding Tibetan sheep with strong disease resistance. The molecular marker is located at the 164719075th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is T or C.

[0033] In the present invention, the genotype of the Tibetan sheep with the mutant base T is TT or TC;

[0034] The genotype of Tibetan sheep with the mutant base C is CC;

[0035] The levels of immunoglobulin A and immunoglobulin G in Tibetan sheep with CC genotype were significantly higher than those in Tibetan sheep with TC or TT genotypes.

[0036] The levels of immunoglobulin A and immunoglobulin G in Tibetan sheep with genotype TC were significantly higher than those in Tibetan sheep with genotype TT.

[0037] The content of immunoglobulin M in Tibetan sheep with genotype TC or CC was significantly higher than that in Tibetan sheep with genotype TT.

[0038] There was no significant difference in the content of immunoglobulin M between Tibetan sheep with genotype TC and that with genotype CC.

[0039] The present invention also provides the use of the molecular marker in preparing a product for assisting in breeding Tibetan sheep with strong disease resistance.

[0040] The present invention also provides a primer pair for amplifying the molecular marker, and the primer pair is shown as SEQ ID NO.1-2.

[0041] SEQ ID NO.1 is an upstream primer, the sequence is: 5'-GAGAACAAATTTATGGTTCCCAA-3', SEQ ID NO.2 is a downstream primer, the sequence is: 5'-TTAAACCTCCCACATCTCCT-3'. The primer pair was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0042] The present invention also provides the use of the primer pair in preparing a product for assisting in breeding Tibetan sheep with strong disease resistance.

[0043] The present invention also provides a molecular marker-assisted breeding method for Tibetan sheep with strong disease resistance, comprising the following steps:

[0044] (1) Extracting Tibetan sheep genomic DNA;

[0045] (2) using the genomic DNA obtained in step (1) as a template and using the primer pair to amplify to obtain a PCR amplification product;

[0046] (3) Performing genotyping analysis on the PCR amplification products to obtain Tibetan sheep with different genotypes, associating the genotypes of Tibetan sheep with immunoglobulins, screening Tibetan sheep with high immunoglobulin content, and obtaining Tibetan sheep with strong disease resistance;

[0047] The genotype of Tibetan sheep with molecular marker locus T is TT or TC;

[0048] The genotype of Tibetan sheep with molecular marker locus C is CC.

[0049] In the present invention, the amplification system in step (2) is: Gold Mix (green) 21-23 μL, preferably 22 μL; upstream and downstream primers 0.8-1.2 μL each, preferably 1.0 μL; template 0.8-1.2 μL, preferably 1.0 μL. In the present invention, the amplification system is preferably 25 μL.

[0050] In the present invention, the amplification procedure in step (2) is: 98°C for 2 min; 98°C for 10 s, 56.5°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

[0051] In the present invention, the length of the amplified product obtained by amplification is 348 bp, and the molecular marker site is located at the 240th position of the amplified product sequence length.

[0052] The present invention also provides the application of the Tibetan sheep molecular marker-assisted breeding method in screening Tibetan sheep with high disease resistance.

[0053] The present invention also provides a kit for assisting in breeding Tibetan sheep with high disease resistance, comprising the molecular marker or the primer.

[0054] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0055] Example 1

[0056] 1. Sample collection

[0057] The samples came from Tibetan sheep populations under natural grazing conditions, including 58 samples from Gannan Tibetan Autonomous Prefecture, Gansu Province, 64 samples from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 50 samples from Shigatse City, Tibet Autonomous Region. 5 mL of blood samples were collected from 172 fasting Tibetan sheep and placed in a clean pro-coagulant vacuum blood collection tube, left to stand for 30 minutes, and then centrifuged at 3500r / min for 15 minutes. The supernatant was aspirated into a clean PE tube, which was sealed and stored in a -20℃ low-temperature refrigerator. Another 5 mL of blood sample was collected in a blood collection tube with EDTA-K2 anticoagulant added. After the blood sample was collected, it was quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, it was frozen in a -20℃ refrigerator for extraction of genomic DNA.

[0058] 2 Main reagents and instruments

[0059] Blood collection tubes with EDTA-K2 anticoagulant were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebaugh Technology Co., Ltd.; Gold Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. Immunoglobulin A (IgA) (E027-1-1), immunoglobulin G (IgG) (E026-1-1), and immunoglobulin M (IgM) (E025-1-1) detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0060] 3 Methods

[0061] 3.1 IgA, IgG, and IgM testing

[0062] According to the IgA, IgG, and IgM detection kits of Nanjing Jiancheng Bioengineering Institute, the determination was performed using a spectrophotometer. First, a standard curve was established using a standard product; secondly, distilled water, a standard solution, and 7 μL of the sample to be tested were added to the blank tube, standard tube, and measurement tube, respectively, and R1 solution was added to 900 μL, incubated at 37°C for 5 minutes, and the reading at a wavelength of 340 nm was recorded as A1; then 180 μL of R2 solution was added to each tube, incubated at 37°C for 5 minutes, and the reading at a wavelength of 340 nm was recorded as A2; finally, △A was calculated as A2-A1, and △A was substituted into the standard curve equation to calculate the sample IgA, IgG, and IgM concentrations.

[0063] 3.2 Extraction of genomic DNA from blood

[0064] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was greater than 20 ng / μL and OD260 / OD280 was between 1.7 and 1.9, which met the experimental requirements. It was stored at -20°C for future use.

[0065] 3.3 Primer design

[0066] Referring to the gene sequence of chromosome 3 of the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019460.2), a pair of specific primers were designed using primerpremier5.0 software, including the g164719075T>CSNP site. The nucleotides of the primer pair are shown in SEQ ID NO.1-2. SEQ ID NO.1 is the upstream primer, and its sequence is: 5'-GAGAACAAATTTATGGTTCCCAA-3'; SEQ ID NO.2 is the downstream primer, and its sequence is: 5'-TTAAACCTCCCACATCTCCT-3'.

[0067] The length of the amplified fragment was 348 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0068] 3.4 PCR amplification and sequencing

[0069] PCR amplification system 25 μL: Gold Mix (green) 22 μL, upstream and downstream primers 1 μL each, template DNA 1 μL.

[0070] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 56.5°C for 10 s, 72°C for 10 s, for a total of 40 cycles; extension at 72°C for 2 min.

[0071] The PCR product was detected by 1.5% agarose gel electrophoresis. After the PCR product was qualified by agarose gel electrophoresis, it was sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO.3, and the SNP marker is located at position 240 of the nucleotide sequence described in SEQ ID NO.3.

[0072] The biological analysis software MEGA 6.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0073] SEQ ID NO.3: GAGAACAAATTTATGGTTCCCAAAGAGGAAAGAGGGGTAGGGAAGGGATAAATGAAGAGCTTGGGATTAACATATACACACTACTATATATTTAAAAAAAAAAAGCAACAAGAGCCTACTGTATAGCACAGGGAACTATATTCAGTATCTTGTGATAACCTATAATGGAAA AGAATCTGAAAAGAATATATATAAGTGTGTGTATCTACACACACATATATATATGCATTAACTGAATCACTTTTCTATACACAAAAACATTGTAAAATCAACTACTCTTCAATTAAAAAATTATGAGCTACATTATGAAGCCAGACTTCTTGGAAGAGGAGATGTGGGAGGTTTAA.

[0074] 4 Statistical analysis

[0075] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g164719075T>C gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0076] 5 Results

[0077] 5.1 PCR amplification and sequencing results

[0078] The amplified product of the g164719075T>CSNP locus on chromosome 3 of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 348bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0079] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that the TC mutation occurred at the g164719075T>CSNP site, and there are three genotypes: TT, TC, and CC.

[0080] 5.2 Statistical analysis results

[0081] The genotype and allele frequencies of the g164719075T>CSNP locus on chromosome 3 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g164719075T>CSNP locus, the TT genotype frequency was the highest, which was the dominant genotype, and the T allele frequency was 92.7%, which was a dominant allele. The χ2 fitness test showed that the SNP locus significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this locus was 1.156, the PIC was 0.126, and the PIC was <0.25, which was a low degree of polymorphism.

[0082] Table 1 Polymorphism of g164719075T>CSNP locus on chromosome 3 of Tibetan sheep

[0083]

[0084] 5.3 Association analysis between different genotypes and IgA, IgG, and IgM

[0085] The general linear model in IBMSPSSStatistics22 software was used to analyze the association between different genotypes of Tibetan sheep and the content of immunoglobulins IgA, IgG, and IgM. The results showed that the immunoglobulins IgA and IgG of Tibetan sheep individuals with CC genotype were significantly higher than those of individuals with TC and TT genotypes (p<0.05), the immunoglobulins IgA and IgG of Tibetan sheep individuals with TC genotype were significantly higher than those of individuals with TT genotype (p<0.05), the immunoglobulins IgM of Tibetan sheep individuals with TC and CC genotypes were significantly higher than those of individuals with TT genotype (p<0.05), and the immunoglobulins IgM of Tibetan sheep individuals with TC and CC genotypes were not significantly different. This indicates that the bases of the g164719075T>CSNP site on chromosome 3 of Tibetan sheep are significantly correlated with IgA, IgG, and IgM of Tibetan sheep, and are SNP markers related to IgA, IgG, and IgM of Tibetan sheep. The results are shown in Table 2.

[0086] Table 2 Relationship between different genotypes and immunoglobulins A, G and M

[0087]

[0088] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0089] The present invention provides a molecular marker-assisted breeding method for Tibetan sheep with strong disease resistance. The present invention relates to a molecular marker for assisting the breeding of Tibetan sheep with strong disease resistance, wherein the molecular marker is located at the 164719075th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is T or C. When the 164719075th base is T, the genotype is TT or TC; when the 164719075th base is C, the genotype is CC; through the association analysis between different genotypes and the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it was found that the contents of immunoglobulin A and immunoglobulin G in Tibetan sheep individuals with genotype CC were significantly higher than those in Tibetan sheep individuals with genotype TC or TT (p<0.05); the contents of immunoglobulin A and immunoglobulin G in Tibetan sheep individuals with genotype TC were significantly higher than those in Tibetan sheep individuals with genotype TT (p<0.05); the content of immunoglobulin M in Tibetan sheep individuals with genotype TC or Tibetan sheep individuals with genotype CC was significantly higher than that in Tibetan sheep individuals with genotype TT (p<0.05); there was no significant difference in the content of immunoglobulin M between Tibetan sheep individuals with genotype TC and Tibetan sheep individuals with genotype CC. The present invention also provides a primer pair that can amplify the gene fragment at the 164719075th base. The primer pair and the molecular marker-assisted breeding method for Tibetan sheep of the present invention are used to detect the base at the 164719075th nucleotide site on the third chromosome of Tibetan sheep, and the content of immunoglobulin A, immunoglobulin G and immunoglobulin M of Tibetan sheep individuals can be obtained, providing a new molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes. Provide a basis for breeding Tibetan sheep with high immunity and high disease resistance.

[0090] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of a reagent for detecting molecular markers in the preparation of a product for detecting the immunity of Tibetan sheep, characterized in that: The molecular marker is located at the 164719075th base on chromosome 3 of the sheep reference genome Oar_v4.0 version, and the mutant base is T or C; According to molecular marker alleles, Tibetan sheep have three genotypes: TT, TC, or CC; The levels of immunoglobulin A and immunoglobulin G in Tibetan sheep with CC genotype were significantly higher than those in Tibetan sheep with TC or TT genotypes. The levels of immunoglobulin A and immunoglobulin G in Tibetan sheep with genotype TC were significantly higher than those in Tibetan sheep with genotype TT. The content of immunoglobulin M in Tibetan sheep with genotype TC or CC was significantly higher than that in Tibetan sheep with genotype TT. The reagent is a primer pair, and the primer pair is shown in SEQ ID NO.1~2.

Images