Construction and application of sox9 mRNA engineered cell membrane nanovesicles

Abstract

The invention discloses the construction and application of a sox9mRNA engineered cell membrane nanovesicle, and belongs to the field of biomedical technology. The invention obtains sox9-rich mesenchymal stem cells (sox9-MSCs) by transfecting sox9mRNA, and then constructs engineered cell membrane nanovesicles (sox9-NVs) by a step-by-step membrane extrusion method. It is identified that sox9-NVs have a double-layer membrane structure, particle size, Zeta potential and protein expression that are highly similar to cell membrane nanovesicles (NVs), and the sox9 gene and protein levels contained therein are significantly higher than those of NVs, and sox9-NVs can be rapidly taken up by condylar chondrocytes (MCCs), and the matrix synthesis and chondrogenic differentiation ability of chondrocytes can be enhanced by efficiently delivering sox9mRNA.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to the construction and application of sox9 mRNA engineered cell membrane nanovesicles. Background Art

[0002] Osteoarthritis (OA) is the most common musculoskeletal disease in people over 60 years old worldwide, and is often related to age, obesity, joint overuse, joint injury, genetic factors, etc. Its pathological mechanism is complex, involving the overall disorder of the joint, and its main characteristics are loss of articular cartilage matrix, degeneration and wear of articular cartilage, synovial inflammation, ligament degeneration, subchondral bone thickening, and osteophyte formation. Temporomandibular joint osteoarthritis (TMJOA) is an important type of temporomandibular joint disorder. Due to the particularity of its location and function, it often leads to limited mouth opening, chewing disorders, and persistent chronic pain in the joint area and related muscle chain areas, which seriously affects the quality of life of patients. At present, the "gradient sequence treatment" of TMJOA is mainly symptomatic control of pain, stiffness and swelling, and has failed to achieve articular cartilage regeneration and restoration of homeostasis. New treatment strategies are urgently needed.

[0003] RNA-based nucleic acid drugs are a new frontier in OA treatment. They achieve therapeutic effects by directly regulating gene expression in endogenous cell populations and have precise and flexible targeting. Currently, therapeutic RNAs including antisense oligonucleotides (ASOs), siRNA, mRNA, CRISPR guide RNA (gRNA), and microRNA modulators (miRNA mimics and anti-miRNA) are in clinical application. Among them, mRNA is translated into encoded proteins by cell ribosomes after cytoplasmic delivery, which has potential high safety, making it an increasingly popular treatment strategy and vaccine method. However, the application of nucleic acid drugs has problems such as nuclease degradation, short half-life, accumulation in target tissues, transmembrane transport, escape from endosomes and lysosomes, and activation of the innate immune system by free RNA. Therefore, it is urgent to enhance its targeting by optimizing the delivery system, while effectively protecting the stability of nucleic acid drugs in the body. Summary of the invention

[0004] In order to solve the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a construction and application of sox9mRNA engineered cell membrane nanovesicles to solve the problem that existing osteoarthritis treatment methods fail to achieve articular cartilage regeneration and steady-state recovery.

[0005] The technical solution of the present invention to solve the above technical problem is as follows: a sox9 mRNA high-abundance engineered cell membrane nanovesicle is provided, comprising sox9 mRNA, and the sox9 mRNA nucleotide sequence is shown in SEQ ID NO.1.

[0006] The present invention provides a method for constructing a sox9 mRNA high-abundance engineered cell membrane nanovesicle, comprising the following steps:

[0007] (1) taking mesenchymal stem cells, and then adding electroporation buffer to prepare a cell suspension;

[0008] (2) Plasmid pCMV6-AC-GFP-sox9 was added to the cell suspension and then electroporated to produce sox9-MSCs;

[0009] (3) After culturing sox9-MSCs for 44-50 hours, digestion and centrifugation were performed, and then the sox9-MSCs were resuspended in PBS buffer to prepare a sox9-MSCs cell suspension;

[0010] (4) passing the sox9-MSCs cell suspension through the membrane step by step, and then filtering through the filter to obtain sox9-NVs;

[0011] (5) adding sox9-NVs into an ultrafiltration tube, performing centrifugal concentration, and collecting sox9-NVs in the upper centrifugal column after centrifugation to obtain.

[0012] Furthermore, the mesenchymal stem cells are human umbilical cord mesenchymal stem cells.

[0013] Furthermore, the voltage of electrotransfection is 1000-1200V.

[0014] Furthermore, the step-by-step membrane filtering in step (4) includes the following steps: passing the sox9-MSCs cell suspension through filter membranes with pore sizes of 5-10 μm, 1 μm and 0.4 μm in sequence.

[0015] Furthermore, the molecular weight cut-off of the ultrafiltration tube is 90-120 kDa.

[0016] Furthermore, in step (5), the centrifugal speed is 4500-5500 g, and the centrifugal time is 20-40 min.

[0017] The present invention also provides an application of a sox9 mRNA high-abundance engineered cell membrane nanovesicle in the preparation of an anti-inflammatory drug for osteoarthritis.

[0018] The present invention has the following beneficial effects: in articular cartilage, sox9 has a high chondrogenic differentiation potential, is an important marker of chondrogenic progenitor cells, and is also a core indicator for evaluating cartilage regeneration and repair ability. The present invention obtains mesenchymal stem cells (sox9-MSCs) with high sox9 abundance by transfecting sox9mRNA, and then constructs engineered cell membrane nanovesicles (sox9-NVs) by a step-by-step membrane extrusion method. Sox9-NVs not only have a double-layer membrane structure, particle size, Zeta potential and protein expression that are highly similar to cell membrane nanovesicles (NVs), but also contain sox9 genes and protein levels that are significantly higher than NVs. At the same time, sox9-NVs can be rapidly taken up by condylar chondrocytes (MCCs), and can enhance the matrix synthesis and chondrogenic differentiation ability of chondrocytes by efficiently delivering sox9 mRNA. The present invention uses engineered cell membrane nanovesicles as carriers to deliver sox9mRNA, which also provides an experimental basis for exploring cell-free technology to treat cartilage damage. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the preparation of sox9-NVs engineered cell membrane nanovesicles;

[0020] Figure 2 Figure 1 is an identification diagram of engineered cell membrane nanovesicles; Figure A is a fluorescence confocal image of sox9 transfected into human umbilical cord mesenchymal stem cells; Figure B is the sox9 protein expression in MSCs-sox9; Figure C is the sox9 gene expression in MSCs-sox9; Figure D is an electron microscope scanning image of NVs and sox9-NVs; Figure E is a particle size image of NVs and sox9-NVs; Figure F is a Zeta potential image of NVs and sox9-NVs; Figure G is the expression of extracellular vesicle marker proteins and sox9 proteins in NVs and sox9-NVs; Figure H is the sox9 gene expression in NVs and sox9-NVs;

[0021] Figure 3 Figure 1 is a diagram of MCC uptake of sox9-NVs / NVs; Figure A is the uptake of NVs and sox9-NVs by MCC observed under a fluorescence confocal microscope; Figure B is a flow cytometry detection diagram of MCC uptake of NVs and sox9-NVs;

[0022] Figure 4 The effects of sox9-NVs on the proliferation and apoptosis of MCC; Figure A shows the proliferation level of MCC detected by CCK-8 experiment after NVs and sox9-NVs intervened in the culture of MCC; Figure B shows the apoptosis level of MCC detected by flow cytometry after NVs and sox9-NVs intervened in the culture of MCC;

[0023] Figure 5Figure 3 shows the effect of sox9-NVs on the chondrogenic differentiation ability of MCC; Figure A shows the Alecin blue staining of MCC after NVs and sox9-NVs intervened in the culture of MCC; Figure B shows the protein expression levels of COL2, Aggrecan and sox9 in MCC after NVs and sox9-NVs intervened in the culture of MCC. DETAILED DESCRIPTION

[0024] The following examples are only used to explain the present invention and are not intended to limit the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0025] Example 1 Construction of engineered cell membrane nanovesicles with high abundance of sox9 mRNA

[0026] A sox9 mRNA high-abundance engineered cell membrane nanovesicle (denoted as sox9-NVs) comprises mesenchymal stem cells (MSCs) and sox9 mRNA, and the nucleotide sequence of sox9 mRNA is shown in SEQ ID NO.1.

[0027] Its construction method is as follows Figure 1 As shown, the following steps are included:

[0028] (1) P4 human umbilical cord mesenchymal stem cells (MSCs, purchased from Haixing Biotechnology Co., Ltd.) with good growth status were obtained. After routine counting, an appropriate amount of electroporation buffer was used to resuspend the cells and adjust the cell concentration to 1×10 7 / 200μL, and the cell suspension was prepared;

[0029] (2) 5 μg of pCMV6-AC-GFP-sox9 plasmid (purchased from Origene) was added to the cell suspension using a 200 μL electroporation system, mixed thoroughly, and then electroporated at 1200 V to obtain sox9-MSCs.

[0030] (3) The electro-transfected cells were transferred to a culture dish for culture. After 6 hours, the transfection status was observed under a fluorescence microscope. After 48 hours, the cells were fused and digested by centrifugation. The sox9-MSCs were resuspended in PBS buffer to prepare a sox9-MSCs cell suspension.

[0031] (4) passing the sox9-MSCs cell suspension obtained in step (3) through 5 μm, 1 μm and 0.4 μm polycarbonate filter membranes in sequence, and filtering under pressure using a 0.22 μm filter to obtain sox9-NVs;

[0032] (5) The sox9-NVs cell fluid was added to a 100 kDa ultrafiltration tube (Millipore, USA), placed in a centrifuge, and centrifuged at 5000 g for 30 min, followed by concentration and purification at 4°C, and the sox9-NVs in the upper centrifugal column were collected to obtain.

[0033] Example 2 Identification of engineered cell membrane nanovesicles with high abundance of sox9 mRNA

[0034] According to the electrotransfection procedure described in Example 1, pCMV6-AC-GFP-sox9 was transfected into human umbilical cord mesenchymal stem cells. After 24 hours, green fluorescence could be observed under a fluorescence microscope (see Figure 2 Figure A); 24 hours after transfection, discard the old culture medium, add cell lysis solution and lyse the cell sample on ice for 20 minutes, scrape the cells repeatedly to achieve sufficient lysis, collect the cell lysis suspension, centrifuge at 4°C, 12000rpm for 20 minutes, and aspirate the supernatant as the total protein of the cell sample. After the protein concentration was determined by BCA method, the protein expression level of sox9 (antibody dilution ratio was 1:1000) in each group of cells was detected by Western blot. The results showed that the expression level of sox9 protein in MSCs-sox9 was significantly higher than that in MSCs group (see Figure 2 (Fig. B).

[0035] Total RNA was extracted from cells according to the instructions of the column-based RNA extraction kit (TaKaRa MiniBEST Universal RNA Extraction Kit). The RNA concentration was measured by Q3000 and then reverse transcription kit (PrimeScript TM RTMaster Mix) was used for reverse transcription reaction, and the gene expression level of sox9 in cells was detected by qPCR experiment. The results showed that the gene expression level of sox9 in MSCs-sox9 was significantly higher than that in MSCs group (see Figure 2 (Figure C).

[0036] 48-72 hours after transfection, sox9-NVs were obtained by the step-by-step membrane extrusion method described in Example 1. 10 μL of NVs and sox9-NVs were added to the copper grid for precipitation for 1 min, and uranyl acetate was added for staining for 30 s-1 min. The floating liquid was removed with filter paper, dried at room temperature, and observed under a transmission electron microscope at 100 kV for image collection. Figure 2 As can be seen in Figure D, both NVs and sox9-NVs are circular structures with double membranes.

[0037] The number and size of NVs and sox9-NVs were determined using a nanoflow cytometer (NanoFCM N30E, Fuliu Biotech, China). After the instrument passed the quality inspection, samples were taken and loaded onto the machine. The results showed that the mean particle sizes of NVs and sox9-NVs were 76.3 nm and 73.9 nm, respectively (see Figure 2 The potential values ​​of the two samples were detected by Zeta View PMX110 nanoparticle size tracer analyzer (Particle Metrix, Germany). It can be seen that the absolute values ​​of the potentials of the two samples are both around 30 mV, and the structures are relatively stable (see Figure 5). Figure 2 (Fig. F).

[0038] Total protein and total RNA of NVs and sox9-NVs were collected, and the expression levels of sox9 protein and gene (antibody dilution ratio was 1:1000) in the two were detected by Western blot and real-time fluorescence quantitative nucleic acid amplification detection system (qPCR). The expression of exosome marker proteins CD63 (four transmembrane protein, antibody dilution ratio was 1:2000), CD81 (four transmembrane protein, antibody dilution ratio was 1:2000), TSG101 (tumor susceptibility gene 101 protein, antibody dilution ratio was 1:1000) and HSP70 (heat shock protein 70, antibody dilution ratio was 1:1000) were also detected. The results showed that both NVs and sox9-NVs expressed exosome marker proteins. In addition, the gene expression of sox9 in sox9-NVs was significantly higher than that in NVs (see Figure 2 Middle G map and Figure 2 (Fig. H).

[0039] Example 3 Uptake of sox9-NVs by MCC

[0040] Sox9-NVs / NVs were fluorescently labeled with the exosome red fluorescent marker dye PKH26, and an equal amount of labeled sox9-NVs / NVs were used to intervene in the culture of MCC cells. After 3 hours, the MCC cells were fixed with 4% paraformaldehyde and washed with phosphate buffered saline (PBS). The uptake of sox9-NVs / NVs by MCC was observed under a fluorescence confocal microscope. In order to quantitatively compare the uptake rate of sox9-NVs / NVs by MCC, an equal amount of sox9-NVs / NVs were used to intervene in the culture of MCC cells. After 3 hours, 6 hours and 12 hours, the MCC cells were digested respectively, and the MCC cells were resuspended with PBS buffer. The uptake rate of sox9-NVs / NVs by MCC was detected by flow cytometry.

[0041] The results are as follows Figure 3 As shown, Figure 3Figure A in the middle shows that NVs / sox9-NVs were labeled with PKH26 and co-cultured with MCC. After 3 hours, scattered red fluorescence appeared in the cytoplasm of MCC, and yellow fluorescence with overlapping red and green fluorescence was observed in the sox9-NVs group. Figure 3 The flow cytometry results in Figure B show that sox9-NVs can be taken up by MCC earlier than NVs.

[0042] Example 4 Effects of sox9-NVs on MCC proliferation and apoptosis

[0043] CCK-8 experiment: Take MCC with good growth status, digest it routinely, and inoculate it into 96-well plates at a density of 2000 cells / well. After the cells adhere to the wall, replace the medium with serum-free medium and culture the cells for 4 hours. After 4 hours, use 50μg / mL NVs or 50μg / mL sox9-NVs to intervene in the culture of MCC. For 0-3 days of intervention culture, select a plate at the same time every day and replace the culture medium with culture medium containing CCK-8. After incubation at 37℃ in the dark for 2 hours, detect the optical density (OD value) on the microplate reader and record it. The culture medium of the remaining plates is replaced every two days according to the group and routinely cultured until the plate detection on the third day is completed. The results are as follows: Figure 4 As shown in Figure A. Figure 4 Figure A in the middle shows that NVs significantly promote the proliferation of MCC, while sox9-NVs slightly promote the proliferation of MCC, but the difference is not statistically significant.

[0044] Cell apoptosis experiment: MCC was inoculated in a 6-well plate for conventional culture. When the cell fusion reached 80%, 50 μg / mL NVs or 50 μg / mL sox9-NVs were used to intervene in the culture of MCC. After 24 hours of culture, the MCC cells were collected and the apoptosis level of the cells was detected by flow cytometry. The results are shown in Figure 4 As shown in Figure B. Figure 4 Figure B in the middle shows that NVs or sox9-NVs had no significant effect on the apoptotic ability of MCC cells.

[0045] Example 5 Effect of sox9-NVs on the chondrogenic differentiation ability of MCC

[0046] MCC was inoculated in a 6-well plate for conventional culture. When the cells reached 80% fusion, 50 μg / mL NVs or 50 μg / mL sox9-NVs were used to intervene in the culture of MCC. Then, chondrogenic induction solution was added for induction culture. After 7 days of induction culture, Alcian blue staining was performed. The results are shown in Figure 2. Figure 5 As shown in Figure A. Figure 5 As shown in Figure A, NVs and sox9-NVs groups can significantly promote the chondrogenic differentiation of MCC, and the cells in the sox9-NVs group are darker in color than those in the NVs group.

[0047] MCC was inoculated in a 6-well plate for conventional culture. When the cells were fused to 80%, 50 μg / mL NVs or 50 μg / mL sox9-NVs were used to intervene in the culture of MCC. After 48 hours, the old culture medium was discarded, the cell samples were collected, and the total protein was extracted. The expression levels of cartilage-related indicators sox9 (antibody dilution ratio of 1:1000), COL2 (type II collagen antibody, antibody dilution ratio of 1:1000) and Aggrecan (aggregate proteoglycan, antibody dilution ratio of 1:1000) were detected by Western blot. The results showed that sox9-NVs upregulated the protein expression levels of COL2, Aggrecan and sox9 in MCC ( Figure 5 (Fig. B).

[0048] The nucleotide sequence of sox9 mRNA in the present invention is as follows:

[0049] GGAGAGCCGAAAGCGGAGCTCGAAACTGACTGGAAACTTCAGTG

[0050] GCGCGGAGACTCGCCAGTTTTCAACCCCGAAACTTTTCTTTGCAGGAG

[0051] GAGAAGAGAAGGGGTGCAAGCGCCCCACTTTTTGCTCTTTTTCCTCCC

[0052] CTCCTCCTCCTCTCCAATTCGCCTCCCCCACTTGGAGCGGGCAGCTGT

[0053] GAACTGGCCACCCCGCGCCTTCCTAAGTGCTCGCCGCGGTAGCCGGCC

[0054] GACGCGCCAGCTTCCCCGGGAGCCGCTTGCTCCGCATCCGGGCAGCCG

[0055] AGGGGAGAGGAGCCCGCGCCTCGAGTCCCCGAGCCGCCGCGGCTTTCT

[0056] CGCCTTTCCCGGCCACCAGCCCCCTGCCCCGGGCCCGCGTATGAATCT

[0057] CCTGGACCCCTTCATGAAGATGACCGACGAGCAGGAGAAGGGCCTGT

[0058] CCGGCGCCCCCAGCCCCACCATGTCCGAGGACTCCGCGGGCTCGCCCT

[0059] GCCCGTCGGGCTCCGGCTCGGACACCGAGAACACGCGGCCCCAGGAG

[0060] AACACGTTCCCCAAGGGCGAGCCCGATCTGAAGAAGGAGAGCGAGGA

[0061] GGACAAGTTCCCCGTGTGCATCCGCGAGGCGGTCAGCCAGGTGCTCA

[0062] AAGGCTACGACTGGACGCTGGTGCCCATGCCGGTGCGCGTCAACGGCT

[0063] CCAGCAAGAACAAGCCGCACGTCAAGCGGCCCATGAACGCCTTCATG

[0064] GTGTGGGCGCAGGCGGCGCGCAGGAAGCTCGCGGACCAGTACCCGCA

[0065] CTTGCACAACGCCGAGCTCAGCAAGACGCTGGGCAAGCTCTGGAGAC

[0066] TTCTGAACGAGAGCGAGAAGCGGCCCTTCGTGGAGGAGGCGGAGCGG

[0067] CTGCGCGTGCAGCACAAGAAGGACCACCCGGATTACAAGTACCAGCC

[0068] GCGGCGGAGGAAGTCGGTGAAGAACGGGCAGGCGGAGGCAGAGGAG

[0069] GCCACGGAGCAGACGCACATCTCCCCCAACGCCATCTTCAAGGCGCTG

[0070] CAGGCCGACTCGCCACACTCCTCCTCCGGCATGAGCGAGGTGCACTCC

[0071] CCCGGCGAGCACTCGGGGCAATCCCAGGGCCCACCGACCCCACCCAC

[0072] CACCCCCAAAACCGACGTGCAGCCGGGCAAGGCTGACCTGAAGCGAG

[0073] AGGGGCGCCCCTTGCCAGAGGGGGGCAGACAGCCCCCTATCGACTTC

[0074] CGCGACGTGGACATCGGCGAGCTGAGCAGCGACGTCATCTCCAACATC

[0075] GAGACCTTCGATGTCAACGAGTTTGACCAGTACCTGCCGCCCAACGGC

[0076] CACCCGGGGGTGCCGGCCACGCACGGCCAGGTCACCTACACGGGCAG

[0077] CTACGGCATCAGCAGCACCGCGGCCACCCCGGCGAGCGCGGGCCACG

[0078] TGTGGATGTCCAAGCAGCAGGCGCCGCCGCCACCCCCGCAGCAGCCC

[0079] CCACAGGCCCCGCCGGCCCCGCAGGCGCCCCCGCAGCCGCAGGCGGC

[0080] GCCCCCACAGCAGCCGGCGGCACCCCCGCAGCAGCCACAGGCGCACA

[0081] CGCTGACCACGCTGAGCAGCGAGCCGGGCCAGTCCCAGCGAACGCAC

[0082] ATCAAGACGGAGCAGCTGAGCCCCAGCCACTACAGCGAGCAGCAGCA

[0083] GCACTCGCCCCAACAGATCGCCTACAGCCCCTTCAACCTCCCACACTA

[0084] CAGCCCCTCCTACCCGCCCATCACCCGCTCACAGTACGACTACACCGA

[0085] CCACCAGAACTCCAGCTCCTACTACAGCCACGCGGCAGGCCAGGGCA

[0086] CCGGCCTCTACTCCACCTTCACCTACATGAACCCCGCTCAGCGCCCCAT

[0087] GTACACCCCCATCGCCGACACCTCTGGGGTCCCTTCCATCCCGCAGAC

[0088] CCACAGCCCCCAGCACTGGGAACAACCCGTCTACACACAGCTCACTC

[0089] GACCTTGAGGAGGCCTCCCACGAAGGGCGAAGATGGCCGAGATGATC

[0090] CTAAAAATAACCGAAGAAAGAGAGGACCAACCAGAATTCCCTTTGGA

[0091] CATTTGTGTTTTTTTGTTTTTTTATTTTGTTTTGTTTTTTCTTCTTCTTCTT

[0092] CTTCCTTAAAGACATTTAAGCTAAAGGCAACTCGTACCCAAATTTCCAA

[0093] GACACAAACATGACCTATCCAAGCGCATTACCCACTTGTGGCCAATCA

[0094] GTGGCCAGGCCAACCTTGGCTAAATGGAGCAGCGAAATCAACGAGAA

[0095] ACTGGACTTTTTAAACCCTCTTCAGAGCAAGCGTGGAGGATGATGGAG

[0096] AATCGTGTGATCAGTGTGCTAAATCTCTCTGCCTGTTTGGACTTTGTAAT

[0097] TATTTTTTTAGCAGTAATTAAAGAAAAAAGTCCTCTGTGAGGAATATTC

[0098] TCTATTTTAAATATTTTTAGTATGTACTGTGTATGATTCATTACCATTTTGA

[0099] GGGGATTTATACATATTTTTAGATAAAATTAAATGCTCTTATTTTTCCAAC

[0100] AGCTAAACTACTCTTAGTTGAACAGTGTGCCCTAGCTTTCTTGCAACC

[0101] AGAGTATTTTTGTACAGATTTGCTTTCTCTTAAAAAAAAAAAAAAA

[0102] TCCTGTTGTTATTACATTTAAAAACAGAATTGTGTTATGTGATCAGTTTT

[0103] GGGGGTTAACTTTGCTTAATTCCTCAGGCTTTGCGATTTAAGGAGGAGC

[0104] TGCCTTAAAAAAAAAAAGGGCCTTATTTTGCAATTATGGGAGTAAACA

[0105] ATAGTCTAGAGAAGCATTTGGTAAGCTTTATCATATATATATTTTTTAAAG

[0106] AAGAGAAAAAACCCTTGAGCCTTAAAACGGTGCTGCTGGGAAACATT

[0107] TGCACTCTTTTAGTGCATTTCCTCCTGCCTTTGCTTGTTCACTGCAGTCTT

[0108] TAAGAAAGGGTAAAAGGCAAGCAAAGGAGTGAAATCTGTTCTGG

[0109] AATGTTTCAGCAGCCAATAAGTGCCCGAGCACACTGCCCCCGGTTGCC

[0110] TGCCTGGGCCCCATGTGGAAGGCAGATGCCTGCTCGCTCTGTCACCTG

[0111] TGCCTCTCAGAACACCAGCAGTTAACCTTCAAGACATTCCACTTGCTA

[0112] AATTATTTATTTTGTAAGGAGAGGTTTTAATTAAAACAAAAAAAAATT

[0113] CTTTTTTTTTTTTTTTCCAATTTTACCCTTCTTTAAAATAGGTTGTTGGAG

[0114] CTTTCCTCAAAGGGTATGGTCATCTGTTGTTAAATTATGTTCTTAACTGT

[0115] AACCAGTTTTTTTTATTTATCTCTTTAATCTTTTTTTATTATTAAGCA

[0116] AGTTTCTTGTATTCCTCACCCTAGATTTGTATAAATGCCTTTTTGTCCAT

[0117] CCCTTTTTTCTTTGTTGTTTTTGTTGAAAACAAACTGGAAACTTGTTTC

[0118] TTTTTTTGTATAAATGAGAGATTGCAAATGTAGTGTATCACTGAGTCATT

[0119] TGCAGGTGTTTTCTGCCACAGACCTTTGGGCTGCCTTATATTGTGTGTGT

[0120] GTGTGGGTGTGTGTGTGTTTTGACACAACAAAACAATGCAAGCATGTGTC

[0121] ATCCATATTTCTCTGCATCTTCTCTTGGAGGTGAGGGAGGCTACCTGGAG

[0122] GGGATCAGCCCACTGACAGACCTTAATCTTAATTACTGCTGTGGCTAGA

[0123] GAGTTTGAGGATTGCTTTTTAAAAGACAGCAAACTTTTTTTTTTTATT

[0124] TAAAAAAAGATATATTAACAGTTTTAGAAGTCAGTAGAATAAAATCTTA

[0125] AAGCACTCATAATATGGCATCCTTCAATTTCTGTATAAAAGCAGATCTTT

[0126] TTAAAAGATACTTCTGTAACTTAAGAAAACCTGGCATTTAAATCATATTT

[0127] TGTCTTTAGGTAAAAGCTTTGGTTTGTGTTCGTGTTTTGTTTGTTTCACT

[0128] TGTTTCCCTCCCAGCCCCAAACCTTTTGTTCTCTCCGTGAAACTTACCT

[0129] TTCCCTTTTTCTTTCTCTTTTTTTTTTTTGTATATTATTGTTTACAATAAAT

[0130] ATACATTGCATAAAA (SEQ ID NO. 1).

[0131] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A sox9 mRNA high-abundance engineered cell membrane nanovesicle, characterized in that: The invention comprises sox9 mRNA, wherein the nucleotide sequence of the sox9 mRNA is shown in SEQ ID NO.1; the sox9 mRNA high-abundance engineered cell membrane nanovesicles are prepared by the following steps: (1) Take mesenchymal stem cells and add electroporation buffer to prepare a cell suspension; (2) Add the pCMV6-AC-GFP-sox9 plasmid to the cell suspension and then perform electroporation to produce sox9-MSCs; (3) culturing sox9-MSCs, digesting by centrifugation, and then resuspending to prepare a sox9-MSCs cell suspension; (4) The sox9-MSCs cell suspension was passed through the membrane step by step, and then filtered through the filter to obtain sox9-NVs; (5) adding sox9-NVs to an ultrafiltration tube, performing centrifugal concentration, and collecting sox9-NVs in the upper centrifugal column after centrifugation to obtain; The mesenchymal stem cells are human umbilical cord mesenchymal stem cells.

2. The method for constructing sox9 mRNA high-abundance engineered cell membrane nanovesicles according to claim 1, characterized in that: The voltage of the electrotransfection is 1000-1200V.

3. The method for constructing the sox9 mRNA high-abundance engineered cell membrane nanovesicles according to claim 1, characterized in that: The step-by-step membrane passing in step (4) comprises the following steps: passing the sox9-MSCs cell suspension through filter membranes with pore sizes of 5-10 μm, 1 μm and 0.4 μm in sequence.

4. The method for constructing the sox9 mRNA high-abundance engineered cell membrane nanovesicles according to claim 1, characterized in that: The molecular weight cut-off of the ultrafiltration tube is 90-120 kDa.

5. The method for constructing sox9 mRNA high-abundance engineered cell membrane nanovesicles according to claim 1, characterized in that: In the step (5), the centrifugation rate is 4500-5500 g and the centrifugation time is 20-40 min.

6. Use of the sox9 mRNA high-abundance engineered cell membrane nanovesicles according to claim 1 in the preparation of anti-inflammatory drugs for osteoarthritis.

Images