Molecular markers for predicting the low-temperature color change in kale and their applications

Abstract

This invention relates to a molecular marker for predicting the rate of color change in kale in response to low temperatures and its application. The molecular marker is a co-dominant InDel polymorphic molecular marker. The nucleotide sequence of the upstream primer of the original sequence of the co-dominant InDel polymorphic molecular marker is SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is SEQ ID NO: 2. The application method of the molecular marker to predict the rate of color change in kale in response to low temperatures includes the following steps: (1) extracting kale genomic DNA; (2) PCR amplification; (3) agarose gel electrophoresis detection. This invention establishes a co-dominant InDel polymorphic molecular marker that can predict the rate of color change in kale in response to low temperatures, which has important scientific guiding significance in the breeding and application of new kale varieties.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular technology, specifically relating to a molecular marker for predicting the speed of kale color change in response to low temperatures and its application. It can be used to predict the speed of kale color change under low temperature conditions and guide the breeding and cultivation of new kale varieties. Background Technology

[0002] Ornamental kale (Brassica oleracea var. acephala) is a biennial foliage plant belonging to the Brassicaceae family and the Brassica genus. It is widely cultivated due to its vibrant colors, diverse shapes, strong cold resistance, and long ornamental period, making it an important ornamental plant in northern regions during early spring, late autumn, and early winter. Leaf color is one of the main ornamental characteristics of ornamental kale. During the rosette stage, the heart leaves of ornamental kale can display different colors such as pink, purple, white, and green, and the speed at which the color changes affects the length of the ornamental period.

[0003] Codominant InDel polymorphic molecular markers are PCR amplification markers based on specific primers designed for the sequences flanking the insertion / deletion site. Essentially, they are length polymorphic markers and can be genotyped using a convenient electrophoresis platform. Codominant InDel markers are highly accurate, stable, simple to use, and inexpensive, and are mainly used in plant genotyping and marker-assisted selection breeding. Currently, there is no method to predict the rate of color change in kale using molecular markers. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides a molecular marker for predicting the rate of color change in kale at low temperatures and its application. This invention is achieved through the following technical solution:

[0005] A molecular marker for predicting the rate of color change in kale in response to low temperature, wherein the molecular marker is a codominant InDel polymorphic molecular marker, and the nucleotide sequence of the upstream primer of the original sequence of the codominant InDel polymorphic molecular marker is SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is SEQ ID NO: 2.

[0006] On the other hand, this application also claims protection for a method for predicting the rate of color change in kale at low temperatures based on the aforementioned molecular markers, comprising the following steps:

[0007] (1) Extraction of kale genomic DNA:

[0008] Genomic DNA was extracted from the kale samples using the CTAB method.

[0009] (2) Using DNA as a template, the original sequence of the molecular marker was amplified by PCR:

[0010] PCR reaction system: including 5 μL of 2×Taq enzyme buffer, 1 μL of DNA template, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of deionized water;

[0011] PCR reaction conditions: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 48℃ annealing for 30 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ extension for 7 minutes; store at 4℃.

[0012] (3) Agarose gel electrophoresis detection:

[0013] The PCR products were detected by 2% agarose gel electrophoresis. After imaging with a gel imaging system, kale with a specific band of 256bp was identified as kale with slow color change under low temperature conditions, while kale with a specific band of 285bp was identified as kale with fast color change under the same low temperature conditions.

[0014] Furthermore, the Taq enzyme buffer contains 0.2 U of Taq enzyme, 1 μM of dNTPs, and magnesium ions.

[0015] Furthermore, it is used to predict the rate of color change in kale under low-temperature conditions.

[0016] Furthermore, this application also claims protection for a method for obtaining molecular markers as described above for predicting the rate of color change in kale at low temperatures, comprising the following steps:

[0017] (1) Cultivation of kale:

[0018] Cultivate kale seedlings that respond quickly and slowly to low temperatures using conventional methods;

[0019] (2) Extraction of kale genomic DNA:

[0020] Genomic DNA was extracted from kale plants that exhibited rapid and slow color change at low temperatures using the CTAB method.

[0021] (3) Primer design for full-length cloning of genes regulating the rate of color change in kale under low-temperature conditions:

[0022] The full-length cloning primers include an upstream full-length cloning primer and a downstream full-length cloning primer, with corresponding nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, respectively;

[0023] (4) PCR amplification:

[0024] PCR reaction system: including 5 μL of 2× high-fidelity Taq enzyme buffer, 1 μL of upstream full-length cloning primer, 1 μL of downstream full-length cloning primer, 1 μL of DNA template, 2 μL of deionized water, totaling 10 μL;

[0025] PCR reaction conditions: 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 50℃ annealing for 50 seconds, 72℃ extension for 3 minutes and 30 seconds, 35 cycles; 72℃ extension for 7 minutes; store at 4℃.

[0026] (5) Agarose gel electrophoresis:

[0027] The PCR products were detected by 1% agarose gel electrophoresis, and the band positions were observed using a gel imaging system.

[0028] (6) Recovery of amplification products;

[0029] (7) The recovered product was ligated into a cloning vector and transformed into E. coli;

[0030] (8) Sequencing:

[0031] The nucleotide sequence of kale with fast color change was determined to be SEQ ID NO: 5, and the nucleotide sequence of kale with slow color change was determined to be SEQ ID NO: 6;

[0032] (9) Synthesize molecular markers for predicting the rate of color change in kale at low temperatures:

[0033] Based on the nucleotide sequences SEQ ID NO: 5 and SEQ ID NO: 6 obtained in step (8), design the upstream primer nucleotide sequence SEQ ID NO: 1 and the downstream primer nucleotide sequence SEQ ID NO: 2 for synthesizing the original sequence of the codominant InDel polymorphic molecular marker.

[0034] Furthermore, the high-fidelity Taq enzyme buffer contains 0.2 U of high-fidelity Taq enzyme, 1 μM of dNTPs, and magnesium ions.

[0035] Compared with the prior art, the present invention has the following advantages:

[0036] A method using co-dominant InDel polymorphic molecular markers was established to predict the rate of color change in kale in response to low temperatures, which has important scientific guiding significance for the breeding and cultivation of new kale varieties. Attached Figure Description

[0037] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following is a brief introduction to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0038] Figure 1 Top view of kale inbred line 'P23';

[0039] Figure 2 Top view of the kale inbred line 'S0836';

[0040] Figure 3 For example, agarose gel electrophoresis detection in Example 1;

[0041] Figure 4 Top view of kale inbred line 'P28';

[0042] Figure 5 A top view of the 'Sunset' variety of kale;

[0043] Figure 6 Top view of the kale inbred line 'F0820';

[0044] Figure 7 A top view of the kale variety 'Song Bird White';

[0045] Figure 8 Example 2: Agarose gel electrophoresis detection. Detailed Implementation

[0046] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0047] The following is combined Figure 1-8 Further details of this application:

[0048] Example 1:

[0049] 1.1 Obtaining Molecular Markers

[0050] (1) Cultivation of kale: Kale seedlings were cultivated using conventional methods for the fast color change inbred line 'P23' and the slow color change inbred line 'S0836' in response to low temperature. Inbred line 'P23' was obtained by continuous self-pollination of the original variety 'Red Gull', and inbred line 'S0836' was obtained by continuous self-pollination of the variety 'Sun Rise'.

[0051] (2) Extraction of kale genomic DNA

[0052] DNA was extracted from 'P23' and 'S0836' using the CTAB method, as follows:

[0053] ① 0.15g of leaf material was thoroughly ground under liquid nitrogen protection and quickly transferred to a 2mL centrifuge tube. 700μL of 2% β-mercaptoethanol-CTAB extraction solution preheated at 65℃ was added. The tube was then incubated in a 65℃ water bath for 1 hour, with gentle shaking every 10 minutes.

[0054] ② Cool to room temperature for 30 minutes, add 700 μL of chloroform / isoamyl alcohol (24:1) mixture, shake well to mix, and centrifuge at 12000 rpm for 7 minutes.

[0055] ③ Take 400 μL of supernatant into a new 1.5 mL centrifuge tube, add 800 μL of isopropanol (pre-cooled at -20℃), and let it stand at -20℃ for 1 hour.

[0056] ④ Centrifuge the above mixture at 12000 rpm for 7 minutes, and then discard the supernatant.

[0057] ⑤ Add 700 μL of 75% ethanol (pre-cooled at -20℃) to wash the DNA, centrifuge at 12000r for 2 minutes, and discard the supernatant.

[0058] ⑥ Repeat step ⑤ once. Air dry at room temperature, add TE to bring the volume to 50 μL, and store at -20℃.

[0059] (3) Primer design for full-length cloning of genes regulating the rate of color change in kale under low-temperature conditions:

[0060] Download the Bo5g123620 gene sequence from the Kale Genome Database (http: / / www.amwayabrc.com / zh-cn / index.html), and design primers for amplifying the full-length sequence of this gene. The primer sequences are as follows:

[0061] Upstream primer F (SEQ ID NO: 3): AGTTCTCACAGCACCAAGGAA

[0062] Downstream primer R (SEQ ID NO: 4): AGTATCGCTTTCGACGCGCAT

[0063] (4) PCR amplification

[0064] PCR reaction system: including 5 μL of 2× high-fidelity Taq enzyme buffer (containing 0.2 U of high-fidelity Taq enzyme, 1 μM of dNTPs and magnesium ions), 1 μL of DNA template, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of deionized water.

[0065] PCR reaction conditions: 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 50℃ annealing for 30 seconds, 72℃ extension for 3 minutes and 30 seconds, 35 cycles; 72℃ extension for 7 minutes; store at 4℃.

[0066] (5) Agarose gel electrophoresis detection

[0067] The PCR products were detected by 1% agarose gel electrophoresis, and the bands were observed using a gel imaging system.

[0068] (6) Recovery of amplification products

[0069] The agarose gel recovery kit was used for recovery.

[0070] (7) The purified product was ligated into a cloning vector, transformed into E. coli, and plasmids were extracted.

[0071] (8) Sequencing: The plasmid ligated with the cloning vector was sequenced, and the full-length sequences of the two materials were obtained as follows:

[0072] P23 (SEQ ID NO: 5)

[0073]

[0074] >S0836(SEQ ID NO:6)

[0075]

[0076] (9) Synthesize molecular markers for predicting the rate of color change in kale at low temperatures.

[0077] Based on the nucleotide sequence obtained in step (8), two oligonucleotide primers, InDel_F and InDel_R, were designed and synthesized, which are molecular markers used to predict the speed of kale color change. The molecular marker primers are: InDel_F (SEQ ID NO: 1): GGGAGCTATAAACATTTC, InDel_R (SEQ ID NO: 2): CACACATCCCAATGAAAC.

[0078] 1.2 Applications of Molecular Markers

[0079] It can predict the rate of color change in kale at low temperatures. The method of using the molecular marker includes the following steps:

[0080] (1) Extraction of kale genomic DNA

[0081] Genomic DNA was extracted from kale using the CTAB method, as detailed below:

[0082] ① 0.15g of leaf material was thoroughly ground under liquid nitrogen protection and quickly transferred to a 2mL centrifuge tube. 700μL of 2% β-mercaptoethanol-CTAB extraction solution preheated at 65℃ was added. The tube was then incubated in a 65℃ water bath for 1 hour, with gentle shaking every 10 minutes.

[0083] ② Cool to room temperature for 30 minutes, add 700 μL of chloroform / isoamyl alcohol (24:1) mixture, shake well to mix, and centrifuge at 12000 r for 7 minutes.

[0084] ③ Take 400 μL of supernatant into a new 1.5 mL centrifuge tube, add 800 μL of isopropanol (pre-cooled at -20℃), and let it stand at -20℃ for 1 hour.

[0085] ④ Centrifuge the above mixture at 12000r for 7 minutes, and then discard the supernatant.

[0086] ⑤ Add 700 μL of 75% ethanol (pre-cooled at -20℃) to wash the DNA, centrifuge at 12000r for 2 minutes, and discard the supernatant.

[0087] ⑥ Repeat step ⑤ once. Air dry at room temperature, add TE to bring the volume to 50 μL, and store at -20℃.

[0088] (2) PCR amplification of the original molecular marker sequence

[0089] PCR reaction system: including 5 μL of 2×Taq enzyme buffer, 1 μL of plasmid template, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of deionized water;

[0090] PCR reaction conditions: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 48℃ annealing for 30 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ extension for 7 minutes; store at 4℃.

[0091] (3) Detection of PCR products by agarose gel electrophoresis

[0092] PCR products were subjected to 2% agarose gel electrophoresis, and gel imaging was used to capture electrophoretic images. The line with a specific band of 285 bp was the fast-changing kale inbred line 'P23', and the line with a specific band of 256 bp was the slow-changing kale inbred line 'S0836'. Figure 3 ).

[0093] Example 2:

[0094] This molecular marker was verified as specific to the kale inbred line 'P28' (responding to low-temperature rapid color change) and the kale inbred line 'F0820' (responding to slow color change), as well as the commercial varieties 'Sunset' and 'Song Bird White' (responding to slow color change). Inbred line 'P28' was obtained by continuous self-pollination of the kale variety 'Red Gull', and inbred line 'F0820' was obtained by continuous self-pollination of the original variety 'Red Peacock'.

[0095] The specific method is as follows:

[0096] 1. Cultivation of kale: Using conventional methods, kale seedlings were cultivated for the low-temperature responsive fast color-changing inbred line 'P28', the slow color-changing inbred line 'F0820', and the slow color-changing varieties 'Sunset' and 'Song Bird White'.

[0097] 2. Detection of codominant InDel polymorphic molecular markers:

[0098] (1) Extraction of kale genomic DNA

[0099] Genomic DNA was extracted from kale using the CTAB method, as detailed below:

[0100] ① 0.15g of leaf material was thoroughly ground under liquid nitrogen protection and quickly transferred to a 2mL centrifuge tube. 700μL of 2% β-mercaptoethanol-CTAB extraction solution preheated at 65℃ was added. The tube was then incubated in a 65℃ water bath for 1 hour, with gentle shaking every 10 minutes.

[0101] ② Cool to room temperature for 30 minutes, add 700 μL of chloroform / isoamyl alcohol (24:1) mixture, shake well to mix, and centrifuge at 12000 r for 7 minutes.

[0102] ③ Take 400 μL of supernatant into a new 1.5 mL centrifuge tube, add 800 μL of isopropanol (pre-cooled at -20℃), and let it stand at -20℃ for 1 hour.

[0103] ④ Centrifuge the above mixture at 12000r for 7 minutes, and then discard the supernatant.

[0104] ⑤ Add 700 μL of 75% ethanol (pre-cooled at -20℃) to wash the DNA, centrifuge at 12000r for 2 minutes, and discard the supernatant.

[0105] ⑥ Repeat step ⑤ once. Air dry at room temperature, add TE to bring the volume to 50 μL, and store at -20℃.

[0106] (2) Amplify the original sequence of the molecular marker.

[0107] PCR reaction system: including 5 μL of 2×Taq enzyme buffer, 1 μL of plasmid template, 1 μL of upstream primer, 1 μL of downstream primer, and 2 μL of deionized water;

[0108] PCR reaction conditions: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 48℃ annealing for 30 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ extension for 7 minutes; store at 4℃.

[0109] (3) Detection of PCR products by agarose gel electrophoresis

[0110] PCR products were subjected to 2% agarose gel electrophoresis, and electrophoresis images were captured using a gel imaging system. The kale inbred line 'P28', which responds quickly to low-temperature color change, showed a 285bp specific band, while the slow-color-changing inbred line 'F0820' and the slow-color-changing varieties 'Sunset' and 'Song Bird White' showed a 256bp specific band. Figure 8 ).

[0111] 3. Application of codominant InDel polymorphic molecular markers: Codominant InDel polymorphic molecular markers successfully verified that the kale inbred line 'P28' with fast color change under low temperature conditions has fast color change, while the kale inbred line 'F0820' with slow color change and the slow-color-changing varieties 'Sunset' and 'Song Bird White' have slow color change under the same conditions.

[0112] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker for predicting the rate of color change in kale at low temperatures, characterized in that: The molecular marker is a codominant InDel polymorphic molecular marker, and the nucleotide sequence of the codominant InDel polymorphic molecular marker is shown in SEQ ID NO: 7 and SEQ ID NO:

8.

2. A method for predicting the rate of color change in kale at low temperatures based on the molecular markers described in claim 1, characterized in that, Includes the following steps: (1) Extraction of genomic DNA from kale: Genomic DNA was extracted from the kale samples using the CTAB method. (2) Using DNA as a template, the molecular marker was amplified by PCR: The PCR reaction system includes: 5 μL of 2×Taq enzyme buffer, 1 μL of DNA template, 1 μL of upstream primer with nucleotide sequence as shown in SEQ ID NO: 1, 1 μL of downstream primer with nucleotide sequence as shown in SEQ ID NO: 2, and 2 μL of deionized water; PCR reaction conditions included: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 48℃ annealing for 30 seconds, 72℃ extension for 30 seconds, 35 cycles; 72℃ extension for 7 minutes; storage at 4℃. (3) Agarose gel electrophoresis detection: The PCR products were detected by 2% agarose gel electrophoresis. After imaging with a gel imaging system, kale with a specific band of 256bp was identified as kale with slow color change under low temperature conditions, while kale with a specific band of 285bp was identified as kale with fast color change under the same low temperature conditions.

3. The method according to claim 2, characterized in that, The Taq enzyme buffer contains 0.2 U of Taq enzyme, 1 μM of dNTPs, and magnesium ions.

4. The method for obtaining molecular markers for predicting the rate of color change in kale at low temperatures, as described in claim 1, is characterized in that... The following steps are involved: (1) Cultivation of kale: Cultivating kale seedlings that respond quickly and slowly to low temperatures; (2) Extraction of genomic DNA from kale: Genomic DNA was extracted from kale plants that exhibited rapid and slow color change at low temperatures using the CTAB method. (3) Primer design for full-length cloning of genes regulating the rate of color change in kale under low-temperature conditions: The full-length cloning primers include an upstream full-length cloning primer and a downstream full-length cloning primer, and the corresponding nucleotide sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively; (4) PCR amplification: The PCR reaction system includes: 5 μL of 2× high-fidelity Taq enzyme buffer, 1 μL of upstream full-length cloning primer, 1 μL of downstream full-length cloning primer, 1 μL of DNA template, and 2 μL of deionized water, for a total of 10 μL. PCR reaction conditions included: 98℃ pre-denaturation for 3 minutes; 98℃ denaturation for 10 seconds, 50℃ annealing for 50 seconds, 72℃ extension for 3 minutes and 30 seconds, 35 cycles; 72℃ extension for 7 minutes; storage at 4℃. (5) Agarose gel electrophoresis: The PCR products were detected by 1% agarose gel electrophoresis, and the band positions were observed using a gel imaging system. (6) Recovery of amplification products; (7) The recovered product was ligated into a cloning vector, transformed into E. coli, and plasmids were extracted; (8) Sequencing: The plasmids containing the cloning vector were sequenced, and the nucleotide sequences of kale with fast color change were shown in SEQ ID NO: 5, and the nucleotide sequences of kale with slow color change were shown in SEQ ID NO:

6. (9) Synthesize amplification primers for molecular markers used to predict the rate of color change in kale at low temperatures: Based on the nucleotide sequences obtained in step (8), such as those shown in SEQ ID NO: 5 and SEQ ID NO: 6, upstream primers such as those shown in SEQ ID NO: 1 and downstream primers such as those shown in SEQ ID NO: 2 are designed and synthesized for amplifying the codominant InDel polymorphic molecular marker.

5. The method for obtaining molecular markers for predicting the rate of color change in kale at low temperatures according to claim 4, characterized in that, The high-fidelity Taq enzyme buffer contains 0.2 U of high-fidelity Taq enzyme, 1 μM of dNTPs, and magnesium ions.

Images