A method for constructing cell meat containing cell autocrine ECM

Abstract

The present invention relates to the field of cell culture and application technology, and specifically discloses a method for constructing cell-containing autocrine ECM cell meat, CEF cells are inoculated in medium No. 1 and proliferated and cultured at a speed of 110-120rpm; when the cell density reaches 1.4E6-1.5E6, it is replaced with medium No. 2, and adjusted to variable speed culture: 40-45rpm, 5-6min; 0rpm, 1-1.2h, 24 cycles, and 100-200um suspended cell aggregates are obtained after 20-24h of variable speed culture; then the speed is adjusted to 55-60rpm constant speed culture, medium No. 2 is replaced once a day, cultured for 4-6 days, and 450-500um autocrine ECM cell meat is harvested. The present invention can obtain 450-500um autocrine ECM cell meat, the cell viability is above 90%, and it can autosecrete ECM.

Description

Technical Field

[0001] The present invention relates to the field of cell culture and application technology, and in particular to a method for constructing cell meat containing cell autocrine ECM. Background Art

[0002] Since its establishment, cell culture technology has mainly been carried out in two dimensions by attaching to tissue culture dishes. However, in the normal physiological environment of the human body, cells are connected by extracellular matrix (ECM), and cells and extracellular matrix can achieve complex regulatory functions through mutual influence. Two-dimensional cell culture models cannot reproduce the complex signals between cells and their matrix, and therefore cannot simulate complex biological processes such as cell migration and transcriptional regulation. In order to solve this problem, three-dimensional cell culture models came into being, which can more realistically simulate the growth environment in the body.

[0003] Cultured meat refers to the use of cell culture engineering and tissue engineering technologies to culture animal muscle tissue in vitro as edible material. This concept aims to provide an efficient, environmentally friendly and sustainable new meat production method to meet the future human meat supply. In the production process of cultured meat, ECM can simulate the cell growth environment in animals, provide support and nutrition for cells, promote cell growth and differentiation, and thus produce cultured meat that is closer to real meat.

[0004] Currently, the methods and technologies used to imitate or replace ECM in cell meat culture are:

[0005] Biomaterials: Scaffolds with ECM-like structures and functions can be prepared using materials with good biocompatibility, such as collagen, hyaluronic acid, polylactic acid, etc. These scaffolds can provide space for cells to attach and grow, while simulating the biochemical and biophysical signals in the ECM.

[0006] 3D printing: 3D printing technology can precisely control the shape and structure of materials, so it can be used to manufacture ECM scaffolds with complex structures. By combining different biomaterials, the various components and interactions in ECM can be simulated.

[0007] Acellular matrix: Acellular matrix extracted from animal or human tissue is a natural ECM substitute. These matrices retain the complex structure and biochemical signals of ECM and can therefore be used to support cell growth and differentiation.

[0008] The current methods and technologies (biomaterials, 3D printing, decellularized matrices) used to mimic or replace ECM are only applicable to adherent cells and cannot meet the needs of cell cultured meat for high-density cell expansion. These technologies are only applicable to adherent cells and cannot meet the needs of cell cultured meat for high-density cell expansion. With the help of scaffold materials to replace or mimic ECM, cells are provided with space for attachment and growth, while simulating biochemical and biophysical signals in ECM. But they still cannot fully replicate the complexity and dynamics of ECM.

[0009] Therefore, multiple factors need to be considered comprehensively, including the biocompatibility of materials, the complexity of the structure, the diversity of biochemical signals, and there is an urgent need to develop a method for constructing cell meat. Summary of the invention

[0010] In order to develop a method for constructing cell meat, the present invention provides a method for constructing cell meat containing cell autocrine ECM. The present invention uses suspended cells as seed cells to meet the demand for high-density cell expansion of cell cultured meat. At the same time, the scaffold system is not used to imitate or replace ECM. Instead, when the cells proliferate to the peak density, the interaction and signal transduction between cells are controlled by changing the culture process and the composition of the culture medium, and the cells are induced to self-assemble into autocrine ECM cell meat and secrete ECM. Thus, cell meat that is closer to real meat is cultivated.

[0011] The present invention provides a method for constructing a cell meat containing cell autocrine ECM, comprising the following steps:

[0012] Cell proliferation culture: CEF cells were inoculated in medium No. 1 and incubated at 110-120 rpm, 38-39°C, 5% CO 2 Culture under the same conditions for 4-6 days, replacing medium No. 1 every 2-3 days;

[0013] Culture medium No. 1: DMEM+10% FBS+25ug / ml anti-cell clumping agent+1% F68; the "%" in 10% FBS and 1% F68 indicates volume fraction.

[0014] The preparation process of 500mL No. 1 culture medium is as follows: Taking 500mL culture medium as an example, take 444.5mL DMEM culture medium + 50mL FBS + 0.5mL anti-cell clumping agent mother solution with a concentration of 25ug / ml + 5mL F68 with a mass fraction of 10%. The volume fraction of the 10% F68 solution added to No. 1 culture medium is 1%.

[0015] Preparation of suspended cell aggregates: When the cell density reaches 1.4E6-1.5E6, replace with medium No. 2 and adjust to variable speed culture: 40-45rpm, 5-6min; 0rpm, 1-1.2h, 24 cycles, and obtain 100-200um suspended cell aggregates after 20-24h of variable speed culture;

[0016] Culture medium 2: DMEM + 10% FBS + 1% F68;

[0017] The preparation process of 500mL No. 2 culture medium is as follows: taking 500mL culture solution as an example, 445mL DMEM culture medium + 50mL FBS + 5mL F68 with a mass fraction of 10%.

[0018] Preparation of autocrine ECM cell meat: Then adjust the rotation speed to 55-60rpm for constant culture, replace medium No. 2 once a day, culture for 4-6 days, and harvest 450-500um autocrine ECM cell meat.

[0019] The above method for preparing autocrine ECM cell meat can meet the high-density expansion requirements of cell cultured meat, induce cells to self-assemble into autocrine ECM cell meat and secrete ECM.

[0020] Furthermore, the inoculation amount of the CEF cells is 2E5 / mL-3E5 / mL.

[0021] Furthermore, CEF cells were inoculated in medium No. 1 and cultured at 120 rpm, 39°C, and 5% CO 2 .

[0022] Furthermore, the variable speed culture conditions were 45 rpm, 5 min; 0 rpm, 1 h, 24 cycles.

[0023] Furthermore, the rotation speed of the constant culture in the preparation of autocrine ECM cell meat was 55 rpm.

[0024] Furthermore, the variable speed culture is achieved using an interval stirring mode.

[0025] Furthermore, the culture conditions for the preparation of suspended cell aggregates and the preparation of autocrine ECM cell meat were 39°C and 5% CO. 2 .

[0026] Furthermore, the cell proliferation culture time was 4 days.

[0027] Furthermore, the process of changing to medium No. 2 in the preparation of suspended cell aggregates is as follows: when the cell density reaches 1.4E6, centrifuge, resuspend the cell pellet with medium No. 2, and then adjust the interval stirring mode at 39°C and 5% CO 2 Continue to culture under the same conditions.

[0028] Furthermore, the centrifugation condition is: 1000 rpm for 5 min.

[0029] The present invention also provides the autocrine ECM cell meat prepared by the above method.

[0030] The present invention also provides the use of the autocrine ECM cell meat in preparing organoids.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] 1. The present invention can obtain 450-500um autocrine ECM cell meat, the cell viability is above 90%, the cell is in good condition, and can autocrine ECM.

[0033] 2. The method of the present invention changes the adhesion molecules on the cell surface, mediates the interaction between cells, and promotes the cells to form autocrine ECM cell meat. The time is short, and the obtained autocrine ECM cell meat is large in volume. The obtained autocrine ECM cell meat has COLA1 expression, can autosecrete ECM, has a good cell state, and a cell viability of 90%. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0035] Figure 1 This is a diagram of the cell proliferation culture status.

[0036] Figure 2 Bright field images of cells forming suspended cell aggregates in intermittent agitation mode culture.

[0037] Figure 3 Bright field image of cells forming autocrine ECM cellular meat.

[0038] Figure 4 This is the detection result of the expression amount of actin in the autocrine ECM cell meat obtained in Example 1 of the present invention.

[0039] Figure 5 This is a Masson staining image of the autocrine ECM cell meat obtained in Example 1 of the present invention.

[0040] Figure 6 This is an immunofluorescence staining diagram of the ECM-specific collagen COLA1 protein in the autocrine ECM cell meat obtained in Example 1 of the present invention;

[0041] In the figure, A is the result of cell nucleus staining; B is the result of COLA1 protein staining; C is the merged image of A and B.

[0042] Figure 7 This is a picture of cells cultured in high-glucose DMEM in Comparative Example 1 of the present invention.

[0043] Figure 8 This is a cell image formed by culture in Comparative Example 3 of the present invention.

[0044] Fig. 9 This is a picture of cells cultured in Comparative Example 4 of the present invention. DETAILED DESCRIPTION

[0045] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0046] Example 1: A method for producing cell-containing autosecreting ECM.

[0047] 1. Experimental Methods

[0048] 1. Experimental materials

[0049] Chicken embryo fibroblast cell line, referred to as CEF cell line, comes from the cell bank of our laboratory. The cells extracted from chicken embryos are spontaneously immortalized and suspended to become CEF cell lines. The detailed process can be found in the literature [Pasitka, L., et al. "Spontaneous immortalization of chicken fibroblasts generates stable, high-yield cell lines for serum-free production of cultured meat." Nature Food 4.1 (2023): 35-50.].

[0050] Anti-cell clumping agent: dextran sulfate sodium salt, purchased from McLean, model: D808268-50g.

[0051] Preparation of 10% F68: Weigh 5g of F68 and dissolve it in 45mL of distilled water. After it is completely dissolved, add distilled water to make up to 50mL. Finally, filter and sterilize using a 0.22um filter membrane to obtain a sterile 10% F68 solution. The volume fraction of the 10% F68 solution added to culture medium No. 1 is 1%.

[0052] F68, purchased from Solebow, model: S7070100g, also known as Miloxam 188, is a commonly used shear force protectant in suspended cell culture.

[0053] DMEM (Gibco, 31600083), fetal bovine serum (Tianhang Biological, 11011-8611), abbreviated as FBS.

[0054] 2. Preparation of cell meat containing cell autocrine ECM

[0055] The electric-driven magnetic stirring device bioreactor used in this example (HuaKan Bio, 3D ), you can start the interval stirring and constant speed stirring mode. The electric driven magnetic stirring device bioreactor includes a controller, a magnetic stirrer and a rotating bottle. The rotating bottle contains a rotor and is placed on the magnetic stirrer. The stirring culture mode (interval stirring mode or constant speed stirring mode) of the cells in the rotating bottle container can be adjusted by the controller. The magnetic stirrer and the rotating bottle are placed in a cell culture incubator, and the cell culture temperature and CO are controlled by the incubator. 2 concentration.

[0056] (1) Cell proliferation culture: 40 mL of medium No. 1 (DMEM + 10% FBS + 25 ug / ml anti-cell clumping agent + 1% F68) was added to the spinner bottle of the electric-driven magnetic stirring device bioreactor in advance, and then CEF cells were inoculated into the medium at an inoculum of 2E5 / mL in an ultra-clean workbench, and the speed was set to 120 rpm in a constant speed stirring mode. The electric-driven magnetic stirring device bioreactor was placed in a cell culture incubator, and the culture conditions of the cell culture incubator were adjusted to 39°C and 5% CO 2 Continuously culture for 4 days, replace the culture medium (DMEM + 10% FBS + 25ug / ml anti-cell clumping agent + 1% F68) every 2 days, and take samples every day to calculate the cell density. When the cell density reaches 1.4E6 (cell status is as Figure 1 ), the cells proliferate to a peak density.

[0057] Formula of medium No. 1: DMEM+10% FBS+25ug / ml anti-cell clumping agent+1% F68, wherein "%" in 10% FBS and 1% F68 indicates volume fraction.

[0058] The preparation process of 500mL No. 1 culture medium is as follows: taking 500mL culture medium as an example, take 444.5mL DMEM+50mL FBS+0.5mL anti-cell clumping agent mother solution with a concentration of 25ug / ml+5mL F68 with a mass fraction of 10%.

[0059] 25ug / ml anti-cell clumping agent mother solution: weigh 2.5g sodium dextran sulfate and dissolve it in 90mL of distilled water. After it is completely dissolved, add distilled water to make the volume 100mL. Finally, filter and sterilize it with a 0.22um filter membrane to obtain an anti-cell clumping agent mother solution with a concentration of 25ug / ml.

[0060] (2) Preparation of suspended cell aggregates: When the cell density reaches 1.4E6, remove the spinner bottle, collect the cells with a centrifuge tube, centrifuge at 1000 rpm for 5 min, carefully discard the supernatant, and retain the cell pellet. Then use 40 mL of medium No. 2 (DMEM + 10% FBS + 1% F68) to resuspend the cells and transfer the suspension to the spinner bottle. Put the spinner bottle back into the cell culture incubator and incubate at 39°C, 5% CO 2 Continue to culture under the same conditions and adjust to the interval stirring mode (45 rpm, 5 min; 0 rpm, 1 h, 24 cycles). After 24 h of interval stirring, the cells form a suspended cell aggregate of about 200 μm (state as Figure 2 ).

[0061] Culture medium 2: DMEM + 10% FBS + 1% F68;

[0062] The preparation process of 500mL of culture medium No. 2 is as follows: taking 500mL of culture solution as an example, 445mL of DMEM+50mL of FBS+5mL of F68 with a mass fraction of 10%.

[0063] Culture medium No. 2 formula: DMEM+10% FBS+1% F68.

[0064] (3) Preparation of autocrine ECM cell meat: After the cell clusters were formed, the interval stirring mode was changed to a constant stirring speed of 55 rpm, and the culture conditions remained unchanged (39°C, 5% CO 2 ), cultured with continuous stirring for 4 days, sampled and tested glucose consumption and cell viability every day, replaced medium No. 2 (DMEM + 10% FBS + 1% F68) without anti-agglomerating agent every day, and harvested autocrine ECM cell meat of about 500um (such as Figure 3 shown).

[0065] 2. Characterization of the autocrine ECM cell meat prepared in Example 1

[0066] 1. qPCR method to identify actin expression

[0067] 1) Forward and reverse primers were synthesized based on the actin gene of Gallus gallus (Shanghai Sangon Biotechnology Co., Ltd.).

[0068] Forward primer: AGGAATAAGCCAGGAACAGATGAATG

[0069] Reverse primer: TCACAATCCATCATACCAGTCTTCTTC

[0070] 2) Take single cell suspension and organoid suspension, take about 1E6 well-growing cells respectively, centrifuge and wash the cells twice with physiological saline.

[0071] 3) Add 1 mL of lysis buffer and extract RNA according to the instructions of the RNA extraction kit (Tiangen RNAEasy Fast RNA Extraction Kit, DP451).

[0072] 4) Take 1 mg of total RNA and operate according to the instructions of the PrimeScript RT reagent kit (TaKaRa, RR037A). The reverse transcription system is shown in Table 1.

[0073] Table 1 Reverse transcription system

[0074]

[0075]

[0076] 5) The cDNA obtained by reverse transcription was used as a template, and the detection system was configured according to the instructions of the qPCR reagent (TaKaRa, RR820B). Actin primers were used and the standard three-step method was used for detection on the qPCR instrument. The detection system is shown in Table 2.

[0077] Table 2 qPCR detection system

[0078]

[0079] 6) Record the qPCR test results.

[0080] 2. Histological analysis of autocrine ECM cell meat by Masson trichrome staining

[0081] 1) Masson's trichrome staining is a classic tissue staining method, which is mainly used to show the fiber structure in the tissue and can clearly distinguish collagen fibers from muscle fibers in the tissue.

[0082] 2) The ECM secreting cell meat tissue is obtained and goes through the conventional steps: tissue fixation - dehydration - transparent - wax immersion - embedding - mounting - dewaxing and hydration.

[0083] 3) Follow the instructions of Masson's trichrome staining solution kit (Chawei Pathology, 20230826) for operation.

[0084] 3. Immunofluorescence staining for collagen 1 (COLA1)-specific collagen staining

[0085] 1) Collagen is the most abundant protein in the extracellular matrix, accounting for 25%-50% of the dry weight of the extracellular matrix. COLA1 is the main protein. The secretion of ECM can be determined by identifying the expression of COLA1.

[0086] 2) The ECM secreting cell meat tissue is obtained and goes through the conventional steps: tissue fixation - dehydration - transparent - wax immersion - embedding - mounting - dewaxing and hydration.

[0087] 3) Permeabilization: Use 0.5% Triton X-100 for 20 minutes, and wash three times with PBS, each time for 5 minutes.

[0088] 4) Primary antibody incubation: primary antibody COLA1 (Santa Cruz Biotechnology, sc-59772) was added according to the instructions of the primary antibody, and incubated at 4 degrees overnight; washed three times with PBS, each time for 5 minutes.

[0089] 5) Secondary antibody incubation: Secondary antibody Alexa Fluor 594 (Yisheng Biotechnology, 33212ES60) was added according to the instructions and incubated at room temperature for 1 h in the dark.

[0090] 6) Staining of cell nuclei: Add 0.5ug / ml Hoechst 33342 (Yisheng Biotechnology, 40731ES10) and incubate at room temperature for 5 minutes; wash three times with PBS, 5 minutes each time. Aspirate the liquid, seal the slide, and observe under a fluorescence microscope.

[0091] 3. Experimental Results

[0092] 1. qPCR method to identify actin expression

[0093] The results are as follows Figure 4 As shown in the figure, the expression of actin in the autocrine ECM cell meat prepared in Example 1 of the present invention is significantly lower than that in the suspension cells. This shows that the present invention changes the adhesion molecules on the cell surface, mediates the interaction between cells, and promotes the cells to form autocrine ECM cell meat.

[0094] The characteristic of the suspension environment is that a large amount of shear stress is generated due to the shaking of the culture, and a high actin content is a necessary condition for the survival of cells in the suspension environment. The expression of actin in the autocrine ECM cell meat formed by the present invention becomes low, proving that the present invention changes the adhesion molecules on the cell surface, mediates the interaction between cells, and promotes the cells to form autocrine ECM cell meat.

[0095] 2. Histological analysis of autocrine ECM cell meat by Masson trichrome staining

[0096] The histological structure of the autocrine ECM cell meat was analyzed by Masson staining. It can be seen that the autocrine ECM cell meat formed by Example 1 of the present invention has green collagen fibers, and collagen is the basic unit of collagen fibers. This proves that the autocrine ECM cell meat formed by the present invention can secrete ECM (such as Figure 5 ).

[0097] 3. Immunofluorescence staining for collagen 1 (COLA1)-specific collagen staining

[0098] The results are as follows Figure 6 As shown, using immunostaining technology to perform COLA1-specific collagen staining, it can be seen that the autocrine ECM cell meat formed using Example 1 of the present invention expresses red COLA1, proving that the autocrine ECM cell meat formed by the present invention can autosecrete ECM.

[0099] Comparative Example 1: A method for obtaining cell-based meat.

[0100] The method is basically the same as that in Example 1, except that the DMEM in the No. 2 culture medium is replaced by the high-glucose DMEM culture medium in the cell mass preparation process, as follows:

[0101] Preparation of suspended cell aggregates: When the cell density reaches 1.4E6, remove the spinner bottle, collect the cells with a centrifuge tube, centrifuge at 1000rpm for 5min, carefully discard the supernatant, and retain the cell pellet. Then use 40mL of medium No. 2 (high-glucose DMEM + 10% FBS + 1% F68) to resuspend the cells and transfer the suspension to the spinner bottle. Put the spinner bottle back into the cell culture incubator and incubate at 39°C, 5% CO 2 The culture was continued under the same conditions, and the stirring mode was adjusted to an interval stirring mode (45 rpm, 5 min; 0 rpm, 1 h, 24 cycles) with interval stirring for 24 h.

[0102] High glucose DMEM medium: Gibco, 11965118.

[0103] Comparative Example 2: A method for obtaining cell meat (organoids).

[0104] The method is basically the same as that in Example 1, except that the speed of the interval stirring is changed from 45 rpm to 35 rpm during the preparation of the suspended cell aggregate. The details are as follows:

[0105] Preparation of suspended cell aggregates: When the cell density reaches 1.4E6, remove the spinner bottle, collect the cells with a centrifuge tube, centrifuge at 1000rpm for 5min, carefully discard the supernatant, and keep the cell pellet. Then use 40mL of medium No. 2 (DMEM+10% FBS+1% F68) to resuspend the cells and transfer the suspension to the spinner bottle. Put the spinner bottle back into the cell culture incubator and incubate at 39℃ and 5% CO. 2 The culture was continued under the same conditions, and the stirring mode was adjusted to an interval stirring mode (35 rpm, 5 min; 0 rpm, 1 h, 24 cycles) and stirred for 24 h.

[0106] Comparative Example 3: A method for obtaining cell meat (organoids).

[0107] The method is basically the same as that in Example 1, except that the intermittent stirring is changed to a constant speed of 45 rpm during the preparation of the suspended cell aggregate. The specific steps are as follows:

[0108] Preparation of suspended cell aggregates: When the cell density reaches 1.4E6, remove the spinner bottle, collect the cells with a centrifuge tube, centrifuge at 1000rpm for 5min, carefully discard the supernatant, and keep the cell pellet. Then use 40mL of medium No. 2 (DMEM+10% FBS+1% F68) to resuspend the cells and transfer the suspension to the spinner bottle. Put the spinner bottle back into the cell culture incubator and incubate at 39℃ and 5% CO. 2 The culture was continued under the same conditions and the stirring mode was adjusted to a constant speed of 45 rpm for 48 h.

[0109] Comparative Example 4: A method for obtaining cell meat (organoids).

[0110] The method is basically the same as that in Example 1, except that the intermittent stirring is changed to a constant speed of 35 rpm during the preparation of the suspended cell aggregate. The specific steps are as follows:

[0111] Preparation of suspended cell aggregates: When the cell density reaches 1.4E6, remove the spinner bottle, collect the cells with a centrifuge tube, centrifuge at 1000rpm for 5min, carefully discard the supernatant, and keep the cell pellet. Then use 40mL of medium No. 2 (DMEM+10% FBS+1% F68) to resuspend the cells and transfer the suspension to the spinner bottle. Put the spinner bottle back into the cell culture incubator and incubate at 39℃ and 5% CO. 2 The culture was continued under the same conditions and the stirring mode was adjusted to 35 rpm for 24 h.

[0112] The formation of suspended cell aggregates and autocrine ECM cell meat in the above examples and comparative examples was observed. The suspended cell aggregates or autocrine ECM cell meat obtained in the above examples and comparative examples were collected for cell viability detection. The specific method and results are as follows:

[0113] 1. Experimental Methods

[0114] 1. Detect cell viability of cell suspension

[0115] (1) Prepare 4% Trypan blue stock solution: weigh 4 g of Trypan blue, add a small amount of distilled water to grind, add double distilled water to 100 mL, filter with filter paper, and store at 4°C. When using, dilute to 0.4% with PBS.

[0116] (2) Staining: If the autocrine ECM cell suspension is collected, trypsin should be used to digest the autocrine ECM cell suspension into single cells. If a single cell suspension is collected (the cell suspension before the formation of suspended cell aggregates), take an appropriate amount of cell suspension (such as 1 mL) and mix it with an equal amount of 0.4% trypan blue solution (1 mL). Gently blow and mix to allow the cells to fully contact with the trypan blue. The staining time is usually 2-3 minutes.

[0117] (3) Microscopic examination: Add the stained cell suspension onto a hemocytometer or a glass slide, cover with a coverslip, and then observe under an optical microscope. Living cells have intact cell membrane structures that can repel trypan blue, so they appear colorless and transparent; while dead cells have damaged cell membranes, allowing trypan blue to enter the cells, making them appear blue.

[0118] (4) Counting: Count the number of live cells and dead cells separately under a microscope. You can use a hemocytometer for accurate counting, or you can directly select multiple fields of view on the slide for counting and then take the average value.

[0119] According to the counting results, the cell viability can be calculated. The calculation formula is:

[0120] Viable cell rate (%) = total number of viable cells / (total number of viable cells + total number of dead cells) × 100%.

[0121] This value reflects the proportion of living cells in the cell suspension and is an important indicator for evaluating cell viability and health status.

[0122] 2. Experimental Results

[0123] 1. Cell viability

[0124] The counting results showed that the method of Example 1 of the present invention could obtain suspended cell aggregates of about 200 um in one day and autocrine ECM cell meat in five days. The detection found that the cell viability was above 90%, and the condition was good.

[0125] like Figure 7 As shown, no suspended cell aggregates were formed in Comparative Example 1, indicating that high-sugar culture medium is not conducive to the formation of suspended cell aggregates.

[0126] Although the interval stirring mode was also used in Comparative Example 2, the stirring rate was changed from 45 rpm to 35 rpm. It was found that the 35 rpm interval stirring speed was too low, causing the suspended cell aggregates to adhere to the bottom, which was not conducive to the formation of suspended cell aggregates.

[0127] like Figure 8 As shown, in Comparative Example 3, the intermittent stirring was changed to a constant speed of 45 rpm. Although the cell viability was above 90%, it took 2 days of culture to form suspended cell aggregates of 20-50 um, which indicated that Comparative Example 3 took a long time and the formed suspended cell aggregates were relatively small.

[0128] like Fig. 9 As shown, in Comparative Example 4, the intermittent stirring in Example 1 was changed to a constant speed of 35 rpm. Although a 90 um suspended cell aggregate could be formed within one day, the rotation speed was too low and the cell state was poor, with a cell viability of 50%.

[0129] In summary, the embodiments of the present invention can not only meet the high-density expansion requirements of cell cultured meat, but also can induce cells to self-assemble into autocrine ECM cell meat and secrete ECM without any scaffold material or complicated process, thereby cultivating cell meat that is closer to real meat.

[0130] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0131] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A method for constructing a cell meat containing cell autocrine ECM, characterized in that: The steps include: Cell proliferation culture: CEF cells were inoculated in medium No. 1 and cultured at 110-120 rpm, 38-39°C, 5% CO2 for 4-6 days, and medium No. 1 was replaced every 2-3 days; Culture medium No. 1: DMEM+10% FBS+25ug / ml anti-cell clumping agent+1% F68; the anti-cell clumping agent is dextran sulfate sodium salt; Preparation of suspended cell aggregates: When the cell density reaches 1.4E6-1.5E6, replace with medium No. 2 and adjust the interval stirring mode to: 45rpm, 5min; 0rpm, 1h, 24 cycles, and obtain 100-200um suspended cell aggregates after variable speed culture for 20-24h; Culture medium 2: DMEM + 10% FBS + 1% F68; Preparation of autocrine ECM cell meat: Then adjust the rotation speed to 55-60rpm for constant culture, replace medium No. 2 once a day, culture for 4-6 days, and harvest 450-500um autocrine ECM cell meat.

2. The method for constructing cell meat containing cell autocrine ECM according to claim 1, characterized in that: The inoculation amount of the CEF cells is 2E5 / mL-3E5 / mL.

3. The method for constructing cell meat containing cell autocrine ECM according to claim 2, characterized in that: CEF cells were inoculated into medium No. 1 and cultured at 120 rpm, 39°C, and 5% CO2.

4. The method for constructing cell meat containing cell autocrine ECM according to claim 1, characterized in that: The rotation speed of the constant culture in the autocrine ECM cell meat preparation was 55 rpm.

5. The method for constructing cell meat containing cell autocrine ECM according to claim 1, characterized in that: The culture conditions for the preparation of suspended cell aggregates and autocrine ECM cell meat were 39°C and 5% CO2.

6. The method for constructing cell meat containing cell autocrine ECM according to claim 1, characterized in that: The cell proliferation culture time is 4 days.

7. The method for constructing cell meat containing cell autocrine ECM according to claim 1, characterized in that: The process of changing to medium No. 2 in the preparation of suspended cell aggregates is as follows: when the cell density reaches 1.4E6, centrifuge, resuspend the cell pellet with medium No. 2, and then adjust the intermittent stirring mode to continue culturing at 39°C and 5% CO2.

8. The method for constructing cell meat containing cell autocrine ECM according to claim 7, characterized in that: The centrifugation conditions were: 1000 rpm for 5 min.

Images