Corn EPSPS enzyme mutant, nucleic acid molecule, expression cassette, expression vector, recombinant bacteria and applications thereof

Abstract

The present invention discloses a corn EPSPS enzyme mutant, a nucleic acid molecule, an expression cassette, an expression vector, a recombinant bacterium and its application, and relates to the field of plant genetic engineering technology. The present invention obtains a glyphosate-resistant corn EPSPS enzyme by mutating the wild-type corn EPSPS enzyme to Q62H, R122G, V155M, G163A, P168S, V222A, P229S and V394A. After the wild-type corn EPSPS enzyme is transformed into a plant, the corn EPSPS enzyme mutant can be expressed and has glyphosate resistance. The present invention proposes an effective solution to the problem of non-selective damage to crops by herbicides such as glyphosate, and provides a new approach for cultivating glyphosate-resistant crop varieties. At the same time, the corn EPSPS enzyme mutant provided by the present invention also has high practicality and promotion value, can improve the weeding effect in agricultural production, reduce the cost of weeding, and promote the increase of crop yield.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to a corn EPSPS enzyme mutant, a nucleic acid molecule, an expression cassette, an expression vector, a recombinant bacterium and applications thereof. Background Art

[0002] Glyphosate is a highly effective non-selective herbicide widely used in commercial agriculture. It targets 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in plant chloroplasts. EPSPS is an enzyme involved in the shikimate biosynthesis pathway and the synthesis of aromatic amino acids. Therefore, its inhibition can affect plant growth and even lead to death. If crops such as corn could acquire resistance to glyphosate, it would significantly improve weed control in these crops.

[0003] Currently, the most commonly used glyphosate-resistant CP4 gene is a strong glyphosate-resistant gene isolated by Monsanto from Agrobacterium tumefaciens. Crops conditioned on glyphosate resistance through genetic engineering have been widely adopted, with corn and soybean varieties containing the CP4 gene having been widely distributed over the past 20 years. These transgenic crops can grow normally in the presence of glyphosate, reducing damage to the crops and lowering the cost of manual weed control. However, there is a constant need for new glyphosate-resistant genes and glyphosate-resistant crop varieties based on these genes in production applications. However, for various reasons, genetically modified crops have been hindered from widespread adoption. Therefore, the discovery and application of new glyphosate-resistant genes from plants has enormous economic and commercial value.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The purpose of the present invention is to provide a corn EPSPS enzyme mutant, a nucleic acid molecule, an expression cassette, an expression vector, a recombinant bacterium and applications thereof, thereby enabling plants to develop resistance to glyphosate without affecting the original function of the plant's own EPSPS enzyme.

[0006] The present invention is achieved in that:

[0007] In a first aspect, the present invention provides a corn EPSPS enzyme mutant having glyphosate resistance, which is shown as follows (1) or (2):

[0008] (1): It is obtained by mutating the 62nd, 122nd, 155th, 163rd, 168th, 222nd, 229th and 394th amino acids of the wild-type EPSPS enzyme from corn; the amino acid sequence of the wild-type corn EPSPS enzyme is shown in SEQ ID NO. 2;

[0009] The amino acids at positions 62, 122, 155, 163, 168, 222, 229, and 394 of the EPSPS enzyme mutant are H, G, M, A, S, A, S, and A, respectively;

[0010] (2): It has at least 70% identity with the EPSPS enzyme mutant shown in (1), and is identical to the EPSPS enzyme mutant shown in (1) at amino acids 62, 122, 155, 163, 168, 222, 229 and 394, and has glyphosate resistance.

[0011] The inventors discovered that by mutating the wild-type corn EPSPS enzyme at the aforementioned positions, a glyphosate-resistant corn EPSPS enzyme can be obtained. Transformed into plants, these mutant corn EPSPS enzymes can be expressed and confer glyphosate resistance. The corn EPSPS enzyme mutants provided by the present invention can effectively address the problem of non-selective damage to crops by herbicides such as glyphosate, providing a new approach for cultivating glyphosate-resistant crop varieties. Furthermore, the corn EPSPS enzyme mutants provided by the present invention have high practicality and promotional value and can be used to breed glyphosate-resistant crops in a variety of crops, including but not limited to corn, rice, and soybeans. They can improve weed control effectiveness in agricultural production, reduce weed control costs, and promote increased crop yields.

[0012] The expression of the above-mentioned corn EPSPS enzyme mutant in corn can confer tolerance to herbicides that inhibit EPSPS enzymes, particularly herbicides of the phosphonomethylglycine family, including but not limited to glyphosate.

[0013] As defined herein, "glyphosate" includes any herbicidally effective form of N-phosphonomethylglycine (including any salts thereof), other forms that result in the production of the glyphosate anion in plants, and any other herbicides in the phosphonomethylglycine family.

[0014] The EPSPS enzyme in the present invention refers to 5-enolpyruvylshikimate-3-phosphate synthase.

[0015] Since the amino acid sequences of EPSPS enzymes in different crops have a high degree of homology, as shown in Table 1, those skilled in the art can easily implement mutations in the above-mentioned positions of EPSPS enzymes in different crops to obtain crops with glyphosate resistance. For example, the EPSPS enzyme mutants shown in (1) have at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity. As long as the mutated EPSPS enzyme mutants have the above-mentioned homology percentages, the plants can be made glyphosate-resistant.

[0016] Table 1 Amino acid homology of EPSPS enzymes from different species

[0017]

[0018]

[0019] In a second aspect, the present invention provides a nucleic acid molecule encoding the above-mentioned corn EPSPS enzyme mutant.

[0020] The term "nucleic acid molecule encoding the above-mentioned corn EPSPS enzyme mutant" may include a polynucleotide encoding the mutant protein of the present invention, or may also include additional coding and / or non-coding sequences.

[0021] Given the amino acid sequence provided herein, those skilled in the art can readily obtain a nucleic acid sequence encoding the corn EPSPS enzyme mutant based on codon degeneracy. For example, a nucleic acid sequence encoding the wild-type corn EPSPS enzyme can be mutated to obtain a nucleic acid sequence encoding the corn EPSPS enzyme mutant. This is readily achievable by those skilled in the art.

[0022] In an alternative embodiment, those skilled in the art can optimize the codon sequence based on the codon preference of the EPSPS enzyme in different crops. For example, for corn, a nucleotide sequence as shown in SEQ ID NO. 3 can be set, and for other crops such as soybean and rice, other nucleotide sequences can be set.

[0023] The nucleotide sequence of the original wild-type corn EPSPS is shown in SEQ ID NO. 1. The sequence shown in SEQ ID NO. 3 has a 99.3% homology to the nucleotide sequence of the original wild-type corn EPSPS.

[0024] The mutant proteins and polynucleotides of the present invention are preferably provided in an isolated form, and more preferably, purified to homogeneity.

[0025] The full-length sequences of the polynucleotides of the present invention can generally be obtained by PCR amplification, recombinant methods, or synthetic methods. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly the open reading frame sequences, and commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art can be used as templates to amplify the relevant sequences. For long sequences, two or more PCR amplifications are often required, followed by splicing the fragments amplified in the correct order.

[0026] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0027] In addition, the method of artificial synthesis can also be used to synthesize the relevant sequence, especially when the fragment length is shorter. Usually, by synthesizing multiple small fragments first and then connecting them, a very long fragment of sequence can be obtained.

[0028] Currently, DNA sequences encoding proteins of the present invention (or fragments thereof, or derivatives thereof) can be obtained entirely by chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into protein sequences of the present invention by chemical synthesis.

[0029] Methods using PCR techniques to amplify DNA / RNA are preferably used to obtain the polynucleotides of the present invention. In particular, when full-length cDNA is difficult to obtain from a library, the RACE method (RACE - rapid amplification of cDNA ends) is preferably used. Primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and can be synthesized using conventional methods. The amplified DNA / RNA fragments can be separated and purified using conventional methods, such as gel electrophoresis.

[0030] In an alternative embodiment, the nucleic acid molecule is selected from DNA, RNA, or a combination thereof.

[0031] In a third aspect, the present invention further provides an expression cassette comprising the above-mentioned nucleic acid molecule;

[0032] In a preferred embodiment of the present invention, the expression cassette further comprises a promoter and a terminator. In a preferred embodiment of the present invention, the promoter is any one of a cauliflower mosaic virus 19S promoter, a cauliflower mosaic virus 35S promoter, a figwort mosaic virus 35S promoter, a sugarcane rhizome-shaped virus promoter, a communis yellow spot virus promoter, a ribulose-1,5-bisphosphate carboxylase small subunit promoter, a cassava vein mosaic virus (CsVMV) promoter, an Arabidopsis Ubiquitin 10 (UBI10) gene promoter, a rice actin 1 promoter, a mannopine synthase gene promoter, an octopine synthase gene promoter, a nopaline synthase gene promoter, a soybean ubiquitin (GmUBI) gene promoter, a maize Ubiquitin promoter, or a maize EPSPS gene promoter.

[0033] In a preferred embodiment of the present invention, the terminator is selected from any one of the terminator of the nopaline synthase gene (NOS) of Agrobacterium tumefaciens, the terminator of the octopine synthase gene, the terminator of the 19S gene of CaMV, the terminator of the 35S gene of CaMV, the mannopine synthase gene terminator, the Saccharomyces cerevisiae alcohol dehydrogenase gene terminator tAdh, the terminator of the trpC gene of Aspergillus nidulans, and the terminator of the corn EPSPS gene.

[0034] In a fourth aspect, the present invention further provides an expression vector comprising the above-mentioned expression cassette.

[0035] In the present invention, the polynucleotide sequence encoding the mutant protein can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Any plasmid or vector can be used as long as it can replicate and be stable in the host. An important feature of an expression vector is that it generally contains an origin of replication, a promoter, a marker gene, and translation control elements.

[0036] In a fifth aspect, the present invention further provides a recombinant bacterium or a recombinant cell, which contains a gene encoding the above-mentioned corn EPSPS enzyme mutant, and the recombinant cell is a non-plant cell.

[0037] In a preferred embodiment of the present invention, the recombinant bacteria or recombinant cells are bacteria or fungi;

[0038] In a preferred embodiment of the present invention, the bacteria is Agrobacterium or Escherichia coli; and the fungus is yeast.

[0039] Recombinant cells can be prokaryotic cells, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher non-plant eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; and fungal cells, such as yeast.

[0040] The aforementioned recombinant bacteria (or genetically engineered bacteria) are produced by transforming a recombinant expression vector into a host microorganism using conventional methods in the art. The host microorganism can be any of a variety of conventional host microorganisms in the art, as long as the recombinant expression vector can stably replicate and the exogenous gene carried by it can be effectively expressed. The host microorganism is a bacterium or a fungus.

[0041] In a preferred embodiment of the present invention, the recombinant bacteria refers to at least one of resting cells of the recombinant bacteria, living cells of the recombinant bacteria, dead cells of the recombinant bacteria, and cell fragments of the recombinant bacteria.

[0042] Resting cells, also known as quiescent cells, are a special cell state. In this state, cells do not grow or reproduce, but still contain various enzymes and possess oxidation and fermentation capabilities. Under appropriate conditions, resting cells can resume growth. Characteristics of resting cells include: a. Cells maintain growth potential: Despite being dormant, these cells can re-enter the cell cycle and resume proliferation when given appropriate stimulation. b. High specificity: Resting cells are highly specific in their reactions, which can improve substrate conversion rates. c. Resistant to contamination by foreign bacteria: Due to their characteristics, resting cells can reduce the inhibition of bacterial growth and enzyme synthesis by products during use.

[0043] Dead bacteria of recombinant bacteria include but are not limited to bacteria obtained by inactivation by heat, pressure, radiation, etc.

[0044] Cell disruptors refer to products obtained by changing the permeability of cell membranes through, but not limited to, ultrasonic, mechanical, chemical, biological, or other methods, resulting in leakage of cell contents.

[0045] In a preferred embodiment of the present invention, the dead bacteria are selected from at least one of a sediment of dead bacteria and a cell-free supernatant of dead bacteria. The cell-free supernatant of dead bacteria refers to the "exudate contents" remaining after removing the outer shell of the dead bacteria.

[0046] In a sixth aspect, the present invention also provides the use of the above-mentioned corn EPSPS enzyme mutant, nucleic acid molecule, expression cassette, expression vector or the above-mentioned recombinant bacteria or recombinant cells in cultivating glyphosate-resistant plants.

[0047] In a preferred embodiment of the present invention, the present invention includes at least one of the following application methods:

[0048] (1) delivering nucleic acid molecules into target plant cells;

[0049] (2) introducing the expression cassette into the target plant cells;

[0050] (3) transforming the target plant with the vector, wherein the vector contains a gene encoding a mutant of the corn EPSPS enzyme;

[0051] (4) introducing a recombinant bacterium or a recombinant cell into a target plant, wherein the recombinant bacterium or the recombinant cell contains a gene encoding a corn EPSPS enzyme mutant;

[0052] (5) Gene editing is performed on target plant cells to encode the aforementioned corn EPSPS enzyme mutant.

[0053] In an optional embodiment, the introduction method is selected from a genetic transformation method, a genome editing method or a gene mutation method.

[0054] The above genetic transformation methods include but are not limited to: producing individuals with glyphosate resistance by selfing a parent plant carrying a gene for a glyphosate-resistant EPSPS enzyme mutant or crossing it with other plant individuals.

[0055] In other embodiments, the above transformation methods include but are not limited to Agrobacterium-mediated gene transformation, gene gun transformation, and pollen tube channel method.

[0056] In use (4), the target plant cell is gene-edited to encode the above-mentioned corn EPSPS enzyme mutant. The gene editing method includes but is not limited to: CRISPR / Cas9, ZFN, and TALEN technology. For example, multiple genes encoding the EPSPS enzyme mutant in the target plant cell are edited multiple times using CRISPR / Cas9 technology.

[0057] In a preferred embodiment of the present invention, the plants include but are not limited to corn, rice, tobacco, soybean, cotton, sorghum, wheat or rapeseed.

[0058] In a preferred embodiment of the present invention, the plant is selected from corn.

[0059] In a seventh aspect, the present invention also provides a method for detecting glyphosate-resistant EPSPS mutant plants, comprising: determining whether the test plant contains the aforementioned nucleic acid molecule; or determining whether the test plant contains the aforementioned corn EPSPS enzyme mutant.

[0060] Determining whether the rice to be tested contains the aforementioned nucleic acid molecule includes but is not limited to detecting primers, probes, nucleic acid aptamers, chips, etc. Detection of nucleic acid molecules is achieved by amplification and / or hybridization.

[0061] Methods for determining whether the rice to be tested contains the aforementioned glyphosate-resistant maize EPSPS enzyme mutant include, but are not limited to, modifying a solid-phase support with a marker capable of detecting the maize EPSPS enzyme mutant to achieve qualitative or quantitative identification of the EPSPS enzyme mutant. The solid-phase support includes, but is not limited to, magnetic beads, test strips, microplates, membranes, micron-sized particles, nanoparticles, and the like.

[0062] In a preferred embodiment of the present invention, the marker capable of detecting corn EPSPS enzyme mutants refers to a class of substances having properties that can be directly observed by the naked eye or detected or detected by an instrument, such as luminescence, color development, radioactivity, etc., through which qualitative or quantitative detection of the corresponding target can be achieved.

[0063] In preferred embodiments of the present invention, the detectable marker is selected from fluorescent dyes, enzymes that catalyze substrate color development, radioactive isotopes, chemiluminescent reagents, and nanoparticle markers. In actual use, those skilled in the art can select an appropriate marker based on detection conditions or actual needs. Regardless of the marker used, it falls within the scope of protection of the present invention.

[0064] Fluorescent dyes include but are not limited to fluorescein dyes and their derivatives (for example, including but not limited to fluorescein isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), etc. or their analogs), rhodamine dyes and their derivatives (for example, including but not limited to red rhodamine (RBITC), tetramethylrhodamine (TAMRA), rhodamine B (TRITC), etc. or their analogs), Cy series dyes and their derivatives (for example, including but not limited to Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5 .5, Cy3, etc. or their analogs), Alexa series dyes and their derivatives (for example, including but not limited to AlexaFluor350, 405, 430, 488, 532, 546, 555, 568, 594, 610, 33, 647, 680, 700, 750, etc. or their analogs) and protein dyes and their derivatives (for example, including but not limited to phycoerythrin (PE), phycocyanin (PC), allophycocyanin (APC), peridinin-chlorophyll protein (preCP), etc.).

[0065] In an alternative embodiment, the enzyme that catalyzes the color development of the substrate includes, but is not limited to, horseradish peroxidase, alkaline phosphatase, β-galactosidase, glucose oxidase, carbonic anhydrase, acetylcholinesterase, and 6-phosphate glucose deoxidase.

[0066] In an alternative embodiment, radioactive isotopes include but are not limited to 212 Bi, 131 I. 111 In,90 Y. 186 Re、 211 At 125 I. 188 Re、 153 Sm, 213 Bi, 32 P. 94 mTc, 99 mTc, 203 Pb, 67 Ga, 68 Ga, 43 Sc, 47 Sc, 110 mIn、 97 Such as 62 Cu, 64 Cu, 67 Cu, 68 Cu, 86 Y. 88 Y. 121 Sn, 161 Tb, 166 Ho, 105 Rh, 177 Lu, 172 Lu and 18 F.

[0067] In an optional embodiment, the chemiluminescent reagent includes but is not limited to luminol and its derivatives, lucigenin, crustacean fluorescein and its derivatives, ruthenium bipyridine and its derivatives, acridinium esters and their derivatives, dioxetanes and their derivatives, lophanes and their derivatives, and peroxalates and their derivatives.

[0068] In an optional embodiment, the nanoparticle markers include but are not limited to nanoparticles and colloids; nanoparticles include but are not limited to organic nanoparticles, magnetic nanoparticles, quantum dot nanoparticles and rare earth complex nanoparticles.

[0069] In alternative embodiments, colloids include, but are not limited to, colloidal metals, disperse dyes, dye-labeled microspheres, and latex.

[0070] In alternative embodiments, colloidal metals include, but are not limited to, colloidal gold, colloidal silver, and colloidal selenium.

[0071] The present invention has the following beneficial effects:

[0072] The present invention obtains a glyphosate-resistant corn EPSPS enzyme by mutating the wild-type corn EPSPS enzyme to Q62H, R122G, V155M, G163A, P168S, V222A, P229S, and V394A. After transforming the enzyme into a plant, the corn EPSPS enzyme mutant can be expressed and has glyphosate resistance. The corn EPSPS enzyme mutant provided by the present invention can effectively solve the problem of non-selective damage to crops by herbicides such as glyphosate, and provides a new approach for cultivating glyphosate-resistant crop varieties. At the same time, the corn EPSPS enzyme mutant provided by the present invention also has high practicality and promotion value, can improve weed control effects in agricultural production, reduce weed control costs, and promote the increase of crop yields.

[0073] The present invention provides a method for expressing a corn EPSPS enzyme mutant in corn, which can confer tolerance to herbicides that inhibit the EPSPS enzyme, particularly herbicides of the phosphonomethylglycine family, including but not limited to glyphosate.

[0074] The present invention also provides an expression cassette for expressing a corn EPSPS enzyme mutant, which contains a mutant EPSPS gene that confers glyphosate resistance to corn. This expression cassette is derived from the corn variety itself, rather than a microorganism, and is suitable for transforming various plant varieties, such as rice, tobacco, soybean, corn, cotton, sorghum, and wheat, thus broadening its applicability.

[0075] The corn EPSPS enzyme mutant, nucleic acid molecule, expression cassette or vector or recombinant bacteria or recombinant cell with glyphosate resistance provided by the present invention has broad application prospects in cultivating glyphosate-resistant soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0076] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0077] Figure 1 This is the map of the expression cassette for the herbicide resistance gene ZE124;

[0078] Figure 2 A schematic diagram of the structure of the pBI121 vector provided by the present invention;

[0079] Figure 3 This is a diagram showing the electrophoresis detection results of PCR products of positive corn transformed with ZE124 provided by the present invention;

[0080] Figure 4This is a diagram showing the growth of the transgenic positive corn provided by the present invention after spraying glyphosate;

[0081] Figure 5 Schematic diagram of the pBI121-ZE124Y vector structure in Example 6;

[0082] Figure 6 The figure shows the PCR results of soybean plants transformed with 6 different ZE124Y genes. DETAILED DESCRIPTION

[0083] Reference will now be made in detail to embodiments of the present invention, one or more examples of which are described below. Each example is provided to illustrate, not to limit, the present invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment may be used in another embodiment to produce further embodiments.

[0084] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the preparations or unit doses herein, some methods and materials are now described. Unless otherwise indicated, the techniques employed or contemplated herein are standard methods. Materials, methods, and examples are illustrative and non-limiting only.

[0085] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of plant physiology, plant molecular genetics, cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a person skilled in the art. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Plant Physiology (Cang Jing et al., 2017); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); Plant Molecular Genetics (Monica A. Hughes et al.); PCR: The Polymerase Chain Reaction (Mullis et al., 1994), each of which is expressly incorporated herein by reference.

[0086] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0087] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0088] Example 1

[0089] This example provides a plant EPSPS mutant derived from maize, namely, maize EPSPS mutant ZE124, which is obtained by mutating wild-type maize EPSPS (amino acid sequence shown in SEQ ID NO: 2), and its amino acid sequence is shown in SEQ ID NO: 4.

[0090] Compared to the amino acid sequence of the wild-type maize EPSPS shown in SEQ ID NO: 2, the maize EPSPS mutant ZE124 provided in this example has Q62H, R122G, V155M, G163A, P168S, V222A, P229S and V394A mutations.

[0091] That is, relative to the wild-type maize EPSPS, the maize EPSPS mutant ZE124 mutated from amino acid residue 62 from Q to H; the amino acid residue 122 from R to G, which corresponds to position 58 of the E. coli EPSPS; the amino acid residue 155 from V to M, which corresponds to position 88 of the E. coli EPSPS; the amino acid residue 163 from G to A, which corresponds to position 96 of the E. coli EPSPS; the amino acid residue 168 from P to S, which corresponds to position 101 of the E. coli EPSPS; the amino acid residue 222 from V to A, which corresponds to position 153 of the E. coli EPSPS; the amino acid residue 229 from P to S, which corresponds to position 158 of the E. coli EPSPS; and the amino acid residue 394 from V to A, which corresponds to position 314 of the E. coli EPSPS.

[0092] This example also provides a gene encoding the above-mentioned maize EPSPS mutant ZE124, the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0093] The gene encoding the maize EPSPS mutant ZE124 provided in this example can be obtained by chemical synthesis.

[0094] Example 2

[0095] This example constructs the ZE124 expression cassette.

[0096] The ZE124 gene was synthesized by chemical synthesis, and primers were designed to amplify a ZE124 gene fragment with a fragment overlapping the maize ubi promoter and NOS terminator. The maize ubi promoter was amplified from B73 maize. Using standard molecular biology methods, the 5' end of the ZE124 gene fragment was ligated to the maize ubi promoter and then to a NOS terminator at the 3' end to form an expression cassette that can be expressed in plants. The expression cassette structure is as follows: Figure 1 shown.

[0097] This expression cassette was connected to the modified pBI121 vector (the original pBI121 vector was purchased from Newpro Biotechnology, catalog number V010909) by homologous recombination to obtain the T-DNA vector pBI121-ZE124, whose vector structure is as follows: Figure 2shown.

[0098] Example 3

[0099] This example transforms corn, specifically using the ZE124 expression cassette from Example 2 above to cultivate glyphosate-resistant corn. The process includes the following steps:

[0100] 1. Agrobacterium Culture

[0101] LBKR liquid medium: Add 1 ml of 50 mg / mL Kan and 700 μL of 50 mg / mL Rif to 1 L of LB liquid before use.

[0102] Take the -80℃ preserved bacteria and activate them in 30mL LBKR overnight, 180rpm, 28℃, and culture until the OD 600 The day before infection, take 50ul of activated bacterial solution and add it to 50ml LBKR for overnight culture (180rpm, 28℃) until the next morning, adjust the OD to about 0.2, and continue to culture until the OD is 0.8-1 before use.

[0103] 2. Preparation of Agrobacterium Infection Medium

[0104] At the same time as embryo removal begins, filter-sterilized AS and cysteine ​​L-cys are added to the suspension to a concentration of 40 mg / L for AS and 200 mg / L for L-cys. After preparation, take a small amount of the suspension to measure the pH, which should be around 5.5.

[0105] 3. Preparation and Treatment of Immature Embryo Recipients

[0106] Take corn ears 8 to 15 days after pollination, remove the husks, and disinfect them by soaking them in 20% sodium hypochlorite for 20 minutes. Rinse them 4-5 times with sterile water for 3 minutes each time before transferring them to a clean bench. In the clean bench, remove the immature embryos, place them in a 2mL centrifuge tube, and rinse them twice with the suspension. Heat shock the embryos in the centrifuge tube at 45°C for 3 minutes, followed by an ice bath for 1 minute.

[0107] 4. Preparation of corn infection solution

[0108] Transfer the cultured liquid to a 50 mL centrifuge tube, centrifuge at 5000 rpm for 10 min, discard the supernatant, add the invading dye solution to resuspend, adjust the OD to 0.4, place the centrifuge tube flat on an oscillator and shake at low speed (20 rpm) for 20 min before incubation and use immediately.

[0109] 5. Agrobacterium Infection and Co-cultivation with Immature Embryos

[0110] 5.1 Infection process

[0111] Add 1.5-1.8 mL of Agrobacterium infection solution to the treated immature embryos, gently invert the centrifuge tube about 20 times, and let it stand horizontally for about 5 minutes.

[0112] 5.2 Co-cultivation process

[0113] After infection, the embryos and infection solution were transferred to the co-culture medium and cultured in the dark at 22°C for 1 day.

[0114] 6. Obtaining resistant callus

[0115] After one day of co-cultivation, the calli were transferred to selection medium and cultured in the dark at 32°C for 7 days. After 7 days, they were transferred to the dark at 28°C for another 7 days.

[0116] 7. Regeneration of Transformed Plants

[0117] 7.1 Differentiation

[0118] Transfer calli to differentiation 1 medium and culture at 28°C under low light for 2-3 days. Then, transfer calli to long-day normal light (5000-6000 Lux) for 4-5 days. Transfer calli containing green spots to regeneration medium and culture at 28°C and 5,000 lx for 14+ days. After differentiation 2 is complete, transfer seedlings to differentiation 3 medium and culture at 28°C and 5,000 lx for 7 days. After 7 days, transfer to rooting medium.

[0119] 7.2 Rooting stage of regenerated seedlings

[0120] Transfer the regenerated seedlings to rooting medium and incubate at 28°C and 5000 lux for 14-21 days. Once strong roots have developed, remove the seedlings, clean the root medium, number the plants, and transplant them into soil.

[0121] Example 4

[0122] This example is about obtaining and identifying positive plants.

[0123] One week after transplanting the C0 generation seedlings provided in Example 3, they were sprayed with glyphosate at a rate 10x the field rate. In this experiment, Roundup herbicide (41% glyphosate isopropylammonium salt) was used for spraying. One week after spraying, surviving rice seedlings were selected, sampled, and DNA extracted using the SLS method. Transgenic testing was performed using the designed specific primers. The primer sequences are as follows:

[0124] ZE124-F0:CTACTTCGATGTGCTGAGCACTTT

[0125] ZE124-R304:CTAGTAACATAGATGACACCGCGC

[0126] PCR was performed using Nanjing Novozymes Biotechnology Co., Ltd. MIX. The PCR reaction system (20 μl) was as follows:

[0127]

[0128] PCR reaction conditions are as follows:

[0129]

[0130] Take 3ul of PCR product and perform agarose gel electrophoresis using 2% agarose gel. The target band size is 304bp. Figure 3 This indicates that all 10 plants transformed with different ZE124 genes have the target gene integrated.

[0131] Lane M is the DNA molecular weight marker DL2000, lane N is the wild-type corn negative control, P is the plasmid DNA positive control, W is water, lanes 1-10 are different transformation events, and the transgenic positive plants containing the target gene are those that can amplify a specific fragment of about 304 bp.

[0132] Example 5

[0133] This example conducts herbicide tolerance testing of positive plants.

[0134] In this example, wild-type corn plants were used as a control group, and the ZE124 gene-positive corn plants obtained in Example 4 were used as an experimental group to verify the glyphosate resistance of the ZE124 gene in corn.

[0135] The experimental method is as follows:

[0136] ZE124-positive transgenic corn plants, 10-15 cm tall, were evenly distributed in the same experimental plot with wild-type corn plants of similar size (avoiding leaf overlap). They were then sprayed with 10 times the field application rate of glyphosate (a commercial 41% glyphosate isopropylammonium salt solution). After the leaves dried, the experimental and control plants were moved to a greenhouse for incubation. After one week, photographs were taken and their growth was recorded.

[0137] Depend on Figure 4 It can be seen that after spraying 10 times the field dosage of glyphosate, the wild-type corn (CK) had no glyphosate resistance and died, while the corn transformed with the ZE124 gene ( Figure 4 The growth of corn (except for CK) was almost unaffected, and transgenic corn with sufficient glyphosate resistance was obtained. These results show that the ZE124 gene can significantly improve the glyphosate resistance of transgenic corn.

[0138] Example 6

[0139] In this example, soybean transformation was performed. Specifically, the ZE124 gene in Example 1 above was optimized according to the soybean nucleotide sequence codon preference. The optimized ZE124Y nucleotide sequence (SEQ ID NO: 5) has a homology of 74.8% with the original corn wild-type EPSPS. Primers were redesigned to amplify the ZE124Y gene fragment with overlapping fragments with 35s and NOS. The 35S promoter was amplified from the pBI121 vector. The 5' end of the ZE124Y gene fragment was connected to 35S by general molecular biological methods, and then connected to a NOS terminator at the 3' end to form an expression cassette that can be expressed in plants. This expression cassette was connected to the modified pBI121 vector (the original pBI121 vector was purchased from Newpu Biotechnology, with the product number V010909) by homologous recombination to obtain the T-DNA vector pBI121-ZE124Y, and its vector structure is as shown below. Figure 5 shown.

[0140] The vector is used to cultivate glyphosate-resistant soybeans, comprising the following steps:

[0141] 1. Agrobacterium Preparation

[0142] Spread 400ul of bacteria containing the pBI121-ZE124Y vector stored at -80℃ on YEP (LB) medium and culture for about 24 hours.

[0143] 2. Seed disinfection and soaking

[0144] Soybean seeds are sterilized by chlorine dry method, and the sterilized soybean seeds are soaked in water for 20-24 hours.

[0145] 3. Infection and Co-cultivation

[0146] Add GA3, 6-BA, L-Cys, and AS to the infection solution and set aside.

[0147] Move the imbibed soybean seeds from the water into a sterile culture dish, remove the seed coat, cut off the radicle, cut the seeds longitudinally along the hilum with a scalpel, and evenly separate the cotyledons and hypocotyls into two petals for use as explants.

[0148] After 24 hours of culture, add Agrobacterium to the prepared infection solution and adjust the OD value of the bacterial solution. 600 Adjust to 0.7-0.8.

[0149] Place the soybean explants in a sterilized cup, rinse once with clean water, and saturate. Add the prepared Agrobacterium to the cup containing the soybean explants and infect at room temperature for at least 1 hour. Add 6 ml of co-culture solution (infection solution + DTT) to a sterile Petri dish lined with sterile filter paper and place the infected soybean explants in the dish with the growth point facing downward. Seal the dish and incubate in the light at 24°C for 4-5 days with 16 hours of light / 8 hours of darkness.

[0150] 4. Screening

[0151] The elongated hypocotyls on the cotyledons after co-cultivation were cut in half and the obvious small buds were removed. The explants were transferred to the shoot induction medium (SIM g12), 10 explants / dish, 24°C, 18h light / 6h dark, and cultured for 3 weeks.

[0152] 5. Bud Elongation I

[0153] The yellowed cotyledons of the explants were removed, and the explants with small buds were transferred to shoot elongation medium (SEM g3 culture dish), 6 explants / dish, at 24°C, 18h light / 6h dark cycle for 2 weeks.

[0154] 6. Bud Elongation II

[0155] Cut off the black part at the bottom of the explants that have obviously elongated to expose the tissue that can absorb nutrients, remove the cotyledons and most of the small buds, and then transfer them to the bud elongation medium (SEM g2 cup), 4-6 explants / cup, and subculture with new medium after 2 weeks of culture.

[0156] 7. Rooting

[0157] Cut off the seedlings that have grown to more than 2 / 3 of the culture cup, transfer them to rooting medium, and culture them at 24℃ with a photoperiod of 18 hours light / 6 hours dark. After strong roots are induced, remove the seedlings, wash the root culture medium, number the plants, and transplant them into seedling pots. Continue to culture for about 10 days before moving them into the greenhouse.

[0158] Example 7

[0159] This example is about obtaining and identifying positive plants.

[0160] One week after transplanting, the C0 generation seedlings provided in Example 6 were sprayed with glyphosate at 4x the field rate. In this experiment, Roundup herbicide (41% glyphosate isopropylammonium salt) was used for spraying. One week after spraying, surviving rice seedlings were selected, sampled, and DNA extracted using the SLS method. Transgenic testing was performed using the designed specific primers. The primer sequences are as follows:

[0161] ZE124Y-F0:

[0162] ZE124Y-R304:

[0163] PCR was performed using Nanjing Novozymes Biotechnology Co., Ltd. MIX. The PCR reaction system (20 μl) was as follows:

[0164]

[0165] PCR reaction conditions are as follows:

[0166]

[0167] Take 3ul of PCR product and perform agarose gel electrophoresis using 1% agarose gel. The target band size is 1200bp. Figure 6 This indicates that the target gene was integrated into all 6 plants transformed with the ZE124Y gene.

[0168] Lane M is the DNA molecular weight marker DL2000, lane N is the wild-type soybean negative control, P is the plasmid DNA positive control, lanes 1-6 are different transformation events, and the transgenic positive plants containing the target gene are those that can amplify a specific fragment of about 1200 bp.

[0169] Example 8

[0170] This example conducts herbicide tolerance testing of positive plants.

[0171] In this example, wild-type soybean plants were used as a control group, and the ZE124Y gene-positive soybean plants obtained in Example 8 were used as an experimental group to verify the glyphosate resistance of the ZE124Y gene in soybeans.

[0172] The experimental method is as follows:

[0173] ZE124Y-positive soybean plants, growing in the same conditions, were evenly distributed in the same experimental plot as wild-type soybean plants of similar size (avoiding leaf overlap). They were then sprayed with glyphosate (a commercially available 41% isopropylammonium salt solution) at four times the field rate. After the leaves dried, the experimental and control plants were moved to a greenhouse for cultivation. After one week, photographs and records of plant growth were taken. Plant growth revealed that after spraying with four times the field rate of glyphosate, the wild-type soybeans (CK) showed no glyphosate resistance and died. However, the growth of the ZE124Y-transfected soybeans remained largely unaffected under the same treatment, demonstrating that transgenic soybeans with sufficient glyphosate resistance could be obtained. These results demonstrate that the ZE124Y gene can significantly enhance glyphosate resistance in transgenic soybeans.

[0174] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A corn EPSPS enzyme mutant having glyphosate resistance, characterized in that: It looks like this: The enzyme is obtained by mutating amino acids 62, 122, 155, 163, 168, 222, 229 and 394 of a wild-type EPSPS enzyme derived from corn; the amino acid sequence of the wild-type EPSPS enzyme is shown in SEQ ID NO. 2; The amino acids at positions 62, 122, 155, 163, 168, 222, 229 and 394 of the EPSPS enzyme mutant are H, G, M, A, S, A, S and A, respectively.

2. A nucleic acid molecule, characterized in that It encodes the corn EPSPS enzyme mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

3.

4. An expression cassette, characterized in that It comprises the nucleic acid molecule according to any one of claims 2 to 3.

5. The expression cassette according to claim 4, characterized in that The expression cassette also includes a promoter and a terminator.

6. An expression vector, characterized in that It comprises the expression cassette according to any one of claims 4 to 5.

7. A recombinant bacterium, characterized in that The recombinant bacteria contains a gene encoding the corn EPSPS enzyme mutant according to claim 1.

8. The recombinant bacterium according to claim 7, characterized in that The recombinant bacteria are bacteria or fungi.

9. The recombinant bacterium according to claim 8, characterized in that The bacteria are Agrobacterium or Escherichia coli; the fungus is yeast.

10. Use of the corn EPSPS enzyme mutant according to claim 1, the nucleic acid molecule according to any one of claims 2-3, the expression cassette according to any one of claims 4-5, the expression vector according to claim 6 or the recombinant bacterium according to any one of claims 7-9 in cultivating glyphosate-resistant plants; the plants are selected from corn, rice or soybean.

11. The use according to claim 10, characterized in that The application method includes at least one of the following: (1) delivering the nucleic acid molecule into target plant cells; (2) introducing the expression cassette into the target plant by gene gun or Agrobacterium transformation; (3) transforming the target plant with the vector containing the gene encoding the corn EPSPS enzyme mutant; (4) introducing the recombinant bacteria into the target plant, wherein the recombinant bacteria contains a gene encoding the corn EPSPS enzyme mutant; (5) Gene editing is performed on target plant cells so that they encode the corn EPSPS enzyme mutant described in claim 1.

12. A method for cultivating glyphosate-resistant plants, characterized in that: The corn EPSPS enzyme mutant according to claim 1, the nucleic acid molecule according to any one of claims 2-3, the expression cassette according to any one of claims 4-5, the expression vector according to claim 6 or the recombinant bacteria according to any one of claims 7-9 are introduced into a target plant; the target plant is selected from soybean, rice or corn.

13. A method for detecting a plant having a glyphosate-resistant EPSPS mutant, characterized in that: It includes: Determining whether the plant to be tested contains the nucleic acid molecule according to any one of claims 2 to 3; Or determining whether the plant to be tested contains the corn EPSPS enzyme mutant according to claim 1.

Images