A biomarker for identifying stem cell aging and its application

Abstract

The present invention provides a biomarker for identifying stem cell aging and its application, which belongs to the field of detection technology. The biomarker screened by the present invention is the LINC00511 gene, which can be used to detect the aging state of stem cells. At the same time, primers for detecting the expression level of the LINC00511 gene can be used to prepare a stem cell aging diagnostic kit. In addition, the present invention also relates to the use of a preparation that promotes the expression level of the LINC00511 gene in a drug for delaying stem cell aging, including a pcDNA3.1-LINC00511 plasmid that can overexpress the LINC00511 gene. By overexpressing LINC00511 in different types of stem cells, the aging process of cells can be significantly delayed, thereby providing new tools and methods for stem cell therapy and anti-aging research.

Description

Technical Field

[0001] The present invention belongs to the field of detection technology, and in particular relates to a biomarker for identifying stem cell aging and an application thereof. Background Art

[0002] Stem cells play a key role in regeneration and repair in the body, but as we age, stem cells also undergo an aging process. Stem cell aging refers to the phenomenon that stem cells gradually decline in proliferation, differentiation, and function. This process not only limits the regenerative capacity of stem cells, but can also lead to the degeneration of tissues and organs, which in turn triggers various age-related diseases. Aged stem cells exhibit characteristics such as decreased self-renewal ability, weakened differentiation potential, increased stress response, and changes in gene expression. Therefore, a deep understanding of the mechanism of stem cell aging is of great significance for the development of methods to delay or reverse stem cell aging.

[0003] Accurately diagnosing the aging state of stem cells is crucial for assessing the health of the body and formulating stem cell treatment plans. Traditional diagnostic methods mainly rely on detecting cellular biological markers, such as telomere length, degree of DNA damage, and aging-related β-galactosidase (SA-β-gal) activity. However, these methods usually require invasive sampling and have certain limitations in sensitivity and specificity. Therefore, there is an urgent need to develop new, non-invasive and efficient diagnostic technologies to better monitor stem cell aging.

[0004] In recent years, non-coding RNA (ncRNA), as a new type of biomarker, has shown great potential in the diagnosis of stem cell aging. ncRNA does not encode proteins, but plays an important role in regulating gene expression, maintaining genome stability and regulating cell function. Studies have shown that the expression levels of certain ncRNAs change significantly during stem cell aging, making them potential diagnostic markers. For example, ncRNAs such as microRNA (miRNA) and long non-coding RNA (lncRNA) play an important role in regulating stem cell self-renewal and differentiation. By detecting changes in the expression of these ncRNAs, early and sensitive diagnosis of the aging state of stem cells can be achieved. Therefore, the development of ncRNA-based diagnostic methods will provide new technical means for monitoring and intervention in stem cell aging. Summary of the invention

[0005] The purpose of the present invention is to provide a biomarker for identifying stem cell aging, and to prepare a corresponding detection kit and a drug for inhibiting aging based on the biomarker.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides a marker for stem cell aging diagnosis, wherein the marker is the LINC00511 gene, the NCBI nucleic acid ID of the LINC00511 gene is NR_033876.1, and the sequence of NR_033876.1 is shown in SEQ ID NO.11.

[0008] Preferably, the stem cell is one of bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, and adipose mesenchymal stem cells.

[0009] In a second aspect, the present invention provides the use of primers for detecting the expression level of the LINC00511 gene in the preparation of a stem cell aging diagnostic kit, characterized in that the NCBI nucleic acid ID of the LINC00511 gene is NR_033876.1, and the sequence of NR_033876.1 is shown in SEQ ID NO.11.

[0010] Preferably, the sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0011] Preferably, the stem cell is one of bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, and adipose mesenchymal stem cells.

[0012] In a third aspect, the present invention provides a method for screening stem cell anti-aging drugs, the method comprising the following steps:

[0013] (1) Inoculating stem cells into a cell culture dish, and when the cell fusion degree is higher than 85%, adding the screening drug to treat the stem cells;

[0014] (2) After 48 hours of treatment, the gene expression level of LINC00511 gene in cells was detected using primers;

[0015] (3) Compare and screen the expression differences of LINC00511 gene between drug-treated stem cells and untreated stem cells;

[0016] (4) When the LINC00511 gene expression level in the screened drug-treated stem cells is significantly higher than that in the untreated stem cells and meets the statistical difference, it is judged that the screened drug can be used as a stem cell anti-aging drug.

[0017] Preferably, the NCBI nucleic acid ID of the LINC00511 gene is NR_033876.1, and the sequence of NR_033876.1 is shown in SEQ ID NO.11;

[0018] The sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.4;

[0019] The stem cell is one of bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells and adipose mesenchymal stem cells.

[0020] In a fourth aspect, the present invention provides an application of a preparation for promoting the expression level of the LINC00511 gene in the preparation of a drug for delaying stem cell aging, characterized in that the NCBI nucleic acid ID of the LINC00511 gene is NR_033876.1, and the sequence of NR_033876.1 is shown in SEQ ID NO.11.

[0021] Preferably, the preparation is a pcDNA3.1-LINC00511 plasmid capable of overexpressing the LINC00511 gene.

[0022] Preferably, the primer sequences of the pcDNA3.1-LINC00511 plasmid insert fragment are shown in SEQ ID NO.12 and SEQ ID NO.13;

[0023] The stem cell is one of bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells and adipose mesenchymal stem cells.

[0024] The term "marker" as used herein refers to a molecular indicator with specific biological properties or biochemical characteristics that can be used to determine the presence or absence and severity of a specific disease or condition. The term can be used interchangeably with "biomarker" and "gene marker".

[0025] The term "primer" as used herein refers to a single-stranded oligonucleotide that is capable of binding to a target nucleic acid. Typically, this binding is selective. The exact length of the primer varies depending on the specific application, but is generally between about 15 to about 120 nucleotides. The primer does not need to fully reflect the exact sequence of the target nucleic acid template, but must have sufficient complementarity to ensure binding to the template. The oligonucleotides used for the primer can be selected by software known in the art.

[0026] The beneficial effects of the present invention are:

[0027] 1. The present invention identifies and confirms LINC00511 as a biomarker of stem cell aging, and its expression level decreases significantly during stem cell aging. This provides a new and reliable molecular marker for the early diagnosis of stem cell aging.

[0028] 2. By detecting changes in the expression level of LINC00511, a more sensitive detection of the aging state of stem cells can be achieved, overcoming the limitations of traditional detection methods in sensitivity.

[0029] 3. The expression changes of LINC00511 showed a consistent trend in various types of stem cells (such as bone marrow mesenchymal stem cells, umbilical cord mesenchymal stem cells, and adipose mesenchymal stem cells), indicating that it has wide applicability in different stem cell types.

[0030] 4. By overexpressing LINC00511 in stem cells, the present invention shows a significant effect of delaying cell aging. This provides a new strategy for stem cell therapy and regenerative medicine, which helps to improve the effectiveness and durability of stem cell therapy. Moreover, the LINC00511 overexpression plasmid can be used as a preparation for the treatment of delaying stem cell aging. This provides new tools and methods for anti-aging research and related treatments. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The expression changes of different LncRNAs during the aging process of bone marrow mesenchymal stem cells were demonstrated;

[0032] Figure 2 The expression level changes of LINC00511 in umbilical cord mesenchymal stem cells at different passage numbers (P3, P6 and P12) are shown;

[0033] Figure 3 The expression changes of LINC00511 in adipose-derived mesenchymal stem cells at different passage numbers (P3, P6 and P12) were shown;

[0034] Figure 4 The changes in LINC00511 expression in bone marrow mesenchymal stem cells transfected with pcDNA3.1 and pcDNA3.1-LINC00511 were shown;

[0035] Figure 5 Shown are the results of β-galactosidase staining of passage 9 (P9) bone marrow mesenchymal stem cells transfected with pcDNA3.1 and pcDNA3.1-LINC00511. DETAILED DESCRIPTION

[0036] The following is intended to elaborate on multiple implementation examples of the present invention, but please note that these descriptions are not meant to define the present invention, but to more deeply show certain aspects, features and implementation methods of the present invention.

[0037] In the description of the present invention, the terms used are only used to describe specific embodiments and do not constitute any limitation of the present invention. In addition, when the present invention refers to a numerical range, it should be understood that all intermediate values ​​within the range are disclosed simultaneously, including upper and lower limits.

[0038] The present invention encompasses any intermediate value in any given numerical value or numerical range, and any smaller range in any two given numerical values ​​or numerical ranges. The upper and lower limits of these smaller ranges may be independently included or excluded in the protection scope of the present invention.

[0039] Example 1

[0040] Since tumors and stem cells have many similarities in proliferation and differentiation regulation, the present invention decided to search for lncRNAs that can be used for stem cell aging detection from tumor-related lncRNAs.

[0041] The lncRNAs selected in the present invention are as follows: LINC00894 (NCBI nucleic acid ID: NR_027456.1), LINC00511 (NCBI nucleic acid ID: NR_033876.1), LINC01535 (NCBI nucleic acid ID: NR_110718.1), LINC02258 (NCBI nucleic acid ID: NR_149056.1), LINC00261 (NCBI nucleic acid ID: NR_001558.3);

[0042] Design of primer sequences for the above LncRNA:

[0043] Table 1 Primer sequences of different LncRNAs

[0044]

[0045] The human bone marrow mesenchymal stem cells were inoculated into a cell culture plate, and the cells were passaged when the cell confluence reached about 85%, and the cells of the third generation (P3 generation) and the twelfth generation (P12 generation) were collected respectively;

[0046] Total RNA was extracted using Trizol reagent, and after determining the concentration and purity of RNA, the extracted total cellular RNA was reverse transcribed into cDNA using Thermo Fisher's SuperScript IV reverse transcription kit;

[0047] Prepare the qPCR reaction system and prepare 20 μl of reaction solution. The specific formula is as follows:

[0048] Table 2 qPCR reaction system

[0049]

[0050]

[0051] The qPCR reaction was performed according to the following qPCR reaction conditions:

[0052] Pre-denaturation at 95°C for 10 min; 95°C for 5 s, 60°C for 30 s, repeated 38 cycles;

[0053] GAPDH was used as the internal reference gene, and the ΔΔCt method was used to calculate the relative expression level of each LncRNA.

[0054] The experimental results are as follows Figure 1 As shown, for the LINC00894 gene, the expression levels between the third generation (P3) and the twelfth generation (P12) were not significantly different (ns);

[0055] For the LINC00511 gene, the expression levels of the third generation (P3) and the twelfth generation (P12) decreased significantly (###), showing a significant difference, suggesting that the expression level of LINC00511 decreased significantly during stem cell aging;

[0056] For the LINC01535 gene, there was no significant difference in expression between the third generation (P3) and the twelfth generation (P12) (ns);

[0057] For the LINC02258 gene, the expression levels of the 3rd generation (P3) and the 12th generation (P12) decreased (ns), but there was no significant difference, suggesting that the expression level of LINC02258 decreased during stem cell aging, but the difference was not statistically significant;

[0058] For the LINC00261 gene, there was no significant difference in expression between the third generation (P3) and the twelfth generation (P12) (ns);

[0059] In summary, the expression level of LINC00511 decreased significantly during stem cell aging, indicating that LINC00511 may play an important role in the aging process of stem cells.

[0060] Example 2

[0061] In order to test whether the findings in Example 1 are also applicable to other stem cells, the present invention selected adipose-derived mesenchymal stem cells and umbilical cord-derived mesenchymal stem cells for verification.

[0062] The human bone marrow mesenchymal stem cells were inoculated into a cell culture plate, and the cells were subcultured when the cell confluence reached about 90%, and the cells of the third generation (P3 generation), the sixth generation (P6 generation), and the twelfth generation (P12 generation) were collected respectively;

[0063] Total RNA was extracted using Trizol reagent, and after determining the concentration and purity of RNA, the extracted total cellular RNA was reverse transcribed into cDNA using Thermo Fisher's SuperScript IV reverse transcription kit;

[0064] Prepare the qPCR reaction system and prepare 20 μl of reaction solution. For the specific formula, see Example 1:

[0065] The qPCR reaction was performed according to the following qPCR reaction conditions:

[0066] Pre-denaturation at 95°C for 10 min; 95°C for 5 s, 60°C for 30 s, repeated 38 cycles;

[0067] GAPDH was used as the internal reference gene, and the ΔΔCt method was used to calculate the relative expression of LINC00511.

[0068] The results are as follows Figure 2 and Figure 3 As shown. It can be clearly seen from the figure that with the increase of cell culture generations, the relative expression of LINC00511 in both umbilical cord mesenchymal stem cells (hUC-MSCs) and adipose-derived mesenchymal stem cells (ADSCs) decreased significantly. This downward trend was statistically significant (p<0.05). Specifically, with the increase of cell passage number, the expression of LINC00511 gradually decreased, indicating that the expression of this lncRNA was inhibited during cell aging. Although there are certain differences in the expression of LINC00511 in different types of cells after aging, the overall trend is consistent, that is, the expression of LINC00511 decreases with cell aging. Therefore, LINC00511 can be used as a marker of stem cell aging, and the corresponding detection kit is involved based on it.

[0069] Example 3

[0070] The above examples demonstrate that the gene expression of LINC00511 decreases significantly during stem cell aging. Therefore, the present invention decides to explore whether overexpressing LINC00511 in stem cells can effectively reduce cell aging.

[0071] First, according to the transcript sequence of LINC00511 (SEQ ID NO.11), the plasmid expressing LINC00511 was constructed using pcDNA3.1 plasmid, and the restriction sites were selected as XbaI and EcoRI. The primers for the inserted fragment were as follows:

[0072] Upstream primer: TCTAGAAAGGGGCGATGCGCCC, SEQ ID NO.12;

[0073] Downstream primer: GAATTCACTGTCCACCGAGCAT, SEQ ID NO. 13;

[0074] The pcDNA3.1 and pcDNA3.1-LINC00511 plasmids were transfected into P3 bone marrow mesenchymal stem cells using lip2000;

[0075] 48 hours after transfection, the cells were collected, and RNA was extracted and reverse transcribed to obtain cDNA according to the steps in Example 1;

[0076] According to the following common PCR reaction system, prepare 20μl reaction solution. The specific formula is as follows:

[0077] Table 3 Common PCR reaction system

[0078] Element volume 10X PCR reaction buffer 2μl dNTP mix (10 mM) 0.4μl Forward primer (10 μM) 0.8μl Reverse primer (10 μM) 0.8μl Taq DNA polymerase (5U / μl) 0.2μl DNA samples 1μl Sterile distilled water (dH2O) 14.8μl

[0079] Place the PCR reaction tube into the PCR instrument and set the following reaction program:

[0080] Initial denaturation: 95°C, 5 minutes; Cycle (30 cycles): Denaturation: 95°C, 30 seconds, Annealing: 60°C, 30 seconds, Extension: 72°C, 1 minute; Final extension: 72°C, 10 minutes; Incubation: 4°C, storage;

[0081] After preparing 1% agarose gel, add 6× loading buffer to the PCR product, mix well and load;

[0082] Add 1×TAE buffer for electrophoresis, set the voltage to 120 V, and the time to 30 min;

[0083] The gel was taken out and placed in a gel imaging instrument for observation and photography.

[0084] The results are as follows Figure 4 As shown in the figure, it can be seen that the expression level of LINC00511 in bone marrow mesenchymal stem cells transfected with pcDNA3.1-LINC00511 is significantly higher than that of the control group cells transfected with pcDNA3.1 only. This shows that pcDNA3.1-LINC00511 prepared by the present invention can effectively increase the expression level of LINC00511 in bone marrow mesenchymal stem cells.

[0085] Example 4

[0086] Bone marrow mesenchymal stem cells of generation P3 transfected with pcDNA3.1 and pcDNA3.1-LINC00511 were cultured to generation P9, and the Bone marrow mesenchymal stem cells of generation P9 were seeded into 6-well cell culture plates;

[0087] The inoculated 6-well cell culture plate was placed in a cell culture incubator at 37°C and 5% CO2 and continued to be cultured for 48 hours;

[0088] The culture medium was removed, and 4% paraformaldehyde was added to fix the cells for 15 min at room temperature;

[0089] Remove 4% paraformaldehyde and add PBS to gently wash the cells twice, 5 minutes each time;

[0090] Add β-galactosidase staining solution to ensure that the staining solution covers the cells, then seal the cell culture plate with sealing film, place it in a common bacterial incubator, and incubate it at 37°C overnight;

[0091] After staining, remove the staining solution, add PBS to gently wash the cells once, remove excess staining solution, place the cell culture plate under an inverted microscope for observation, select 5 random fields of view, and count the β-galactosidase-positive cells in each field of view.

[0092] like Figure 5 As shown in the experimental results, compared with the control group cells transfected with pcDNA3.1 alone, the senescence rate of bone marrow mesenchymal stem cells (hBMSCs) transfected with pcDNA3.1-LINC00511 was significantly lower. This result shows that overexpression of LINC00511 in hBMSCs can significantly delay the senescence process of cells.

[0093] Since the expression of LINC00511 has been observed to decrease with cell aging in other stem cell types, such as umbilical cord mesenchymal stem cells (hUC-MSCs) and adipose-derived mesenchymal stem cells (ADSCs), overexpression of LINC00511 in these cells may also have the effect of delaying aging.

[0094] Therefore, the LINC00511 overexpression plasmid can be used as a preparation for delaying stem cell aging to effectively delay the aging rate of stem cells, thereby providing new tools and methods for stem cell therapy and anti-aging research.

Claims

1. Use of primers for detecting the expression level of LINC00511 gene in the preparation of a stem cell aging diagnostic kit, characterized in that: The NCBI nucleic acid ID of the LINC00511 gene is NR_033876.1, and the sequence of NR_033876.1 is shown in SEQ ID NO.11; The stem cells are bone marrow mesenchymal stem cells.

2. Use of the primers for detecting the expression level of the LINC00511 gene according to claim 1 in preparing a stem cell aging diagnostic kit, characterized in that: The sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. Use of a preparation for promoting the expression level of the LINC00511 gene in the preparation of a drug for delaying stem cell aging, characterized in that: The NCBI nucleic acid ID of the LINC00511 gene is NR_033876.1, and the sequence of NR_033876.1 is shown in SEQ ID NO.11; The stem cells are bone marrow mesenchymal stem cells; The preparation is a pcDNA3.1-LINC00511 plasmid capable of overexpressing the LINC00511 gene.

4. Use of the preparation for promoting the expression level of LINC00511 gene according to claim 3 in the preparation of a drug for delaying stem cell aging, characterized in that: The primer sequences of the pcDNA3.1-LINC00511 plasmid insert fragment are shown in SEQ ID NO.12 and SEQ ID NO.13.

Images