52 Use of 52d gene / protein as a target in screening for drugs for the prevention or treatment of foot-and-mouth disease virus infection

By knocking out the 52D gene/protein target, genetic engineering technology was used to inhibit the adsorption, proliferation, and infection of foot-and-mouth disease virus, solving the problem of the difficulty in preventing and controlling foot-and-mouth disease virus in existing technologies, and achieving effective virus inhibition and the breeding of antiviral animal breeds.

CN118873660BActive Publication Date: 2026-02-24CHINA AGRI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410938029.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-12
Publication Date
2026-02-24
Estimated Expiration
2044-07-12

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively prevent the spread and infection of foot-and-mouth disease virus, leading to economic losses and ecological impacts. Furthermore, there is a lack of effective genetic engineering methods to breed virus-resistant animal varieties.

Method used

By using the 52D gene/protein as a target, and by knocking out the 52D gene, 52D gene/protein expression inhibitors such as nucleic acid molecules, small molecule compounds, peptides, proteins, gene editing vectors, or adeno-associated viruses can be used to inhibit the adsorption, proliferation, infection, and receptor expression of foot-and-mouth disease virus, and to prepare preventive or therapeutic drugs.

Benefits of technology

It can effectively suppress foot-and-mouth disease virus infection, reduce economic losses, breed virus-resistant animal breeds, prevent the spread of the virus, and protect the ecological balance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118873660B_ABST
    Figure CN118873660B_ABST
Patent Text Reader

Abstract

The application discloses application of 52D gene / protein as a target in screening of a medicine for preventing or treating foot-and-mouth disease virus infection, and relates to the technical field of genetic engineering; the 52D gene / protein is used as a target in the medicine for preventing or treating foot-and-mouth disease virus infection, and the infection of the foot-and-mouth disease virus can be effectively inhibited by knocking out the 52D gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the use of a 52D gene / protein as a target in screening drugs for the prevention or treatment of foot-and-mouth disease virus infection. Background Technology

[0002] Foot and mouth disease (FMD) is a highly contagious viral disease caused by the foot and mouth disease virus (FMDV). Susceptible animals include more than 70 species, primarily livestock such as pigs, cattle, and sheep. The World Organization for Animal Health (WOAH) lists FMD as a notifiable animal disease, and my country also classifies it as a Class A animal disease. This disease constitutes an insurmountable barrier to international trade.

[0003] For centuries, FMD has caused enormous economic losses to countries and regions around the world, with direct economic losses reaching tens of billions of dollars annually. Once an FMD outbreak occurs, many countries impose restrictions and embargoes on animal imports from affected countries, thus disrupting normal international trade. If FMDV spreads to wild animals, it will have a serious impact on the ecological balance.

[0004] Foot-and-mouth disease (FMD) is a viral infectious disease that spreads rapidly between domestic and wild cloven-hoofed animals. FMDV can be transmitted to susceptible animals through direct contact with infected animals, or through contaminated pens or vehicles transporting livestock. Previous studies have also shown that FMDV can be transmitted airborne. After infecting a host animal, the disease causes fever, loss of appetite, weight loss, lameness, salivation, and depression, and forms vesicular ulcers on the mouth, teats, and hooves. Therefore, using genetic engineering techniques to prevent or breed pig breeds resistant to FMDV infection represents a new direction for FMDV prevention and control. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide the use of the 52D gene / protein as a target in screening drugs for the prevention or treatment of foot-and-mouth disease virus infection. By knocking out the 52D gene, foot-and-mouth disease virus infection can be effectively inhibited.

[0006] The technical solution of this invention to solve the above-mentioned technical problems is as follows: It provides the use of a 52D gene / protein as a target in screening drugs for the prevention or treatment of foot-and-mouth disease virus infection. The 52D gene ID is ENSSSCG00000014729.

[0007] The present invention also provides the use of the 52D gene / protein expression inhibitor in the preparation of medicaments for the prevention or treatment of foot-and-mouth disease virus infection.

[0008] Furthermore, drugs for the prevention or treatment of foot-and-mouth disease virus infection have at least one of the following functions:

[0009] 1) Inhibits the adsorption or internalization of foot-and-mouth disease virus;

[0010] 2) Inhibits the proliferation of foot-and-mouth disease virus;

[0011] 3) Inhibits foot-and-mouth disease virus infection;

[0012] 4) Inhibit the expression of foot-and-mouth disease virus receptors.

[0013] Furthermore, the foot-and-mouth disease virus receptor is integrin and / or heparan sulfate.

[0014] Furthermore, the 52D gene / protein expression inhibitor is at least one of nucleic acid molecules, small molecule compounds, peptides, proteins, gene editing vectors, lentiviruses, or adeno-associated viruses.

[0015] Furthermore, 52D gene / protein expression inhibitors include sgRNAs that target and knock out the 52D gene / protein.

[0016] Furthermore, the sgRNA is GTACCATGTCGTTGTCTACG.

[0017] The present invention also provides a drug combination for the prevention or treatment of foot-and-mouth disease virus infection, including the above-mentioned 52D gene / protein expression inhibitor.

[0018] This invention also provides the use of the 52D gene in the preparation and breeding of foot-and-mouth disease virus resistant pig breeds.

[0019] The present invention has the following beneficial effects:

[0020] This invention targets the 52D gene / protein as a target in drugs for the prevention or treatment of foot-and-mouth disease virus infection. By knocking out the 52D gene, foot-and-mouth disease virus infection can be effectively inhibited. Attached Figure Description

[0021] Figure 1 Sequencing diagram of the 52D gene knockout cell line;

[0022] Figure 2 Results of viral RNA copy number detection after FMDV infection of candidate host gene mixed knockout cells. Detailed Implementation

[0023] The principles and features of this invention are described below. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0024] Example 1: Preparation of Gene-Hybrid Targeting Cell Lines

[0025] 1. The gene knockout hybrid clonal cell line was constructed using the CRISPR-PB vector system, which is a three-plasmid system: the pBase plasmid transiently expressing PB transposase, the pCRISPR-S10 plasmid containing Cas9 protein, and the piggyBac transposon backbone vector PB-CRISPR-Sg4 containing the sgRNA target sequence.

[0026] 2. Based on the sgRNA target sequence information of the 52D gene, the sgRNA knockout vector was constructed. The sgRNA target information is shown in Table 1.

[0027] When constructing the sgRNA targeting sequence vector, Bbs I sticky end sequences need to be added to both ends of the sequence. The upstream and downstream target primers are used for annealing to form double strands. The annealing reaction system and reaction procedure are shown in Table 2. Then, it is ligated with the PB-CRISPR-sg4 backbone vector digested with Bbs I. The ligation reaction system and reaction procedure are shown in Table 3. After successful sequencing, the PB-CRISPR-sg4 vector with the inserted host gene sgRNA target sequence is obtained.

[0028] Primer sequence information is as follows:

[0029] 52D-F: CACCGAGTCCGTTCTGACAATACAC;

[0030] 52D-R:AAACGTGTATTGTCAGAACGGACTC.

[0031] Table 1 sgRNA target information

[0032]

[0033] Table 2 Annealing reaction system and reaction procedure

[0034]

[0035] Table 3. Connection of Reaction Systems and Reaction Procedures

[0036]

[0037] 3. Subsequently, PB-CRISPR-Sg4 plasmid, pCRISPR-S10 plasmid, and pBase plasmid were transiently transfected into wild-type IBRS-2 cells. 24 hours after transfection, cells were treated with a medium containing 3 μg / mL puromycin and 4 μg / mL doxycycline. After 80% cell death, drug screening was stopped, and recovery culture was initiated. Genomic DNA was extracted from the cells approximately one week later, amplified by PCR, and then sequenced to determine the targeting of candidate genes. The primer sequences for the 52D gene were verified (see Table 4). Sequencing results are as follows: Figure 1 As shown.

[0038] Table 4 Primers for identifying 52D gene knockout cell lines

[0039]

[0040] Depend on Figure 1 The presence of a peak at the target site in the 52D gene indicates that the hybrid knockout cell line of the 52D gene was successfully constructed.

[0041] Example 2: Anti-FMDV phenotype in 52D gene mixed knockout cells

[0042] 52D gene knockout cells were seeded in 12-well plates. When the cells reached approximately 90% confluence, they were infected with FMDV at an MOI of 0.01. Cells were collected 24 hours after viral infection, and viral RNA was extracted. The viral RNA copy number was then determined using FMDV absolute quantification primers (see Table 5). The results are as follows: Figure 2 As shown.

[0043] Table 5. Primer sequences for absolute quantification of FMDV

[0044]

[0045]

[0046] Depend on Figure 2 It can be seen that the 52D gene knockout cell line showed a significant inhibitory effect on FMDV infection.

[0047] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. 52D The use of gene / protein expression inhibitors in the preparation of drugs for the prevention or treatment of foot-and-mouth disease virus infection; 52D Gene / protein expression inhibitors include targeted knockout 52D The sgRNA of the gene / protein, sgRNA is GTACCATGTCGTTGTCTACG.

2. The use as described in claim 1, characterized in that, The drug for preventing or treating foot-and-mouth disease virus infection has at least one of the following functions: 1) Inhibits the adsorption or internalization of foot-and-mouth disease virus; 2) Inhibits the proliferation of foot-and-mouth disease virus; 3) Inhibits foot-and-mouth disease virus infection; 4) Inhibit the expression of foot-and-mouth disease virus receptors.

3. The use as described in claim 2, characterized in that, The foot-and-mouth disease virus receptor is integrin and / or heparan sulfate.

4. A pharmaceutical composition for the prevention or treatment of foot-and-mouth disease virus infection, characterized in that, include 52D Gene / protein expression inhibitors; 52D Gene / protein expression inhibitors include targeted knockout 52D The sgRNA of the gene / protein, sgRNA is GTACCATGTCGTTGTCTACG.