A terahertz double-layer metasurface microfluidic sensor for detecting carcinoid cells containing epcam markers
By designing a terahertz double-layer metasurface microfluidic sensor and combining functional modification and microfluidic technology, the problem of water's influence on THz wave absorption was solved, realizing high-precision detection of EpCAM biomarkers for cancer cells in liquid environments, which is suitable for large-scale, low-cost production.
Patent Information
- Application Number
- CN202411187850.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-28
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2044-08-28
AI Technical Summary
Existing terahertz band detection equipment is inefficient, and water has a significant impact on the absorption of THz waves, resulting in insufficient accuracy and reliability in the detection of trace samples. Furthermore, most samples need to be tested in a dry state, which affects the sample properties.
A terahertz bilayer metasurface microfluidic sensor is designed, employing a quartz glass substrate and a metal metasurface structure. Combined with microfluidic technology, it captures EpCAM marker cancer cells through functionalization modification and utilizes the bilayer metasurface open resonant ring to enhance the electric field, achieving specific detection in a liquid environment.
By reducing the absorption interference of water on THz waves in a liquid environment, improving the signal-to-noise ratio, enhancing the interaction between the analyte and THz waves, improving detection accuracy and sensitivity, and lowering the detection limit, this method is suitable for large-scale, low-cost production.
Smart Images

Figure CN118883493B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of terahertz application, and particularly relates to a terahertz double-layer super surface microfluidic sensor for detecting cancer cells containing an EpCAM marker. BACKGROUND
[0002] Terahertz (THz, 1 THz = 10 12 THz) waves refer to electromagnetic waves with an oscillation frequency in the range of 0.1-10 THz, and the wavelength range corresponds to 3 mm~30 μm, which is a section of electromagnetic waves between microwaves and infrared, and has unique physical properties. THz waves have attracted widespread attention due to their unique fingerprint spectral characteristics, high penetration of non-polar substances, and non-ionizing properties, and have a wide range of applications in biological imaging, non-destructive testing, biomedical photonics, and wireless communication. Since THz photons have low energy and do not cause radiation damage to the detected substances, in addition, the vibration and rotation energy levels of many biological macromolecules are in the THz band, so the terahertz time-domain spectroscopy (THz-TDS) has developed into an effective means for analyzing the internal information of substances. However, under the current technical level, high-efficiency THz emission devices and sensitive detection devices are still insufficient, and the wavelength of THz waves does not match the scattering / absorption cross-section of the sample, resulting in very weak THz signals under micro-sample conditions, which affects the accuracy and reliability of the analysis.
[0003] In recent years, super surface microstructures, as a new type of periodic or non-periodic sub-wavelength artificial atomic arrangement composite structure, have the advantages of flexible design, simple manufacturing, ultra-thin size, and easy integration. The THz sensor based on the super surface microstructure can achieve a huge field enhancement effect, improve the interaction between the sample and the THz wave, realize label-free and safe non-destructive detection, and provide a reference for the detection of micro-sample. However, due to the extremely strong absorption characteristics of water to THz waves, most of the current detection samples are carried out in a dry state, but drying may affect the properties of the sample. Therefore, it is urgent to develop a new method to minimize the influence of water on THz waves and realize the real and effective detection of samples in a more realistic environment.
[0004] Microfluidic chips integrate and design a small amount of liquid in microliter level in channels through special technology, greatly reducing the absorption influence of water on THz waves, saving the use of expensive reagents, and having high reaction efficiency for samples, which can realize real-time and label-free detection and obtain the detection signal of the sample in a real environment, and is more practical. SUMMARY
[0005] The purpose of the present application is a terahertz double-layer metasurface microfluidic sensor for detecting EpCAM marker-containing carcinoid cells, which provides new technical support and perspective for the field of non-destructive detection of biomedical and agricultural product quality safety in the terahertz wave band. This technology not only reduces the detection limit and improves the detection sensitivity, but also promotes the diversification of sensor functions and the customization of specific applications, indicating that terahertz technology has a wide application prospect in the future.
[0006] In order to achieve the above purpose, the structure and material of the sensor of the present application are: quartz glass substrate (1), lower layer metal metasurface (2), microfluidic channel (3), upper layer metal metasurface (4), quartz glass cover layer (5); the microfluidic channel (3) is formed between the lower layer metal metasurface (2) and the upper layer metal metasurface (4); the lower layer metal metasurface (2) and the upper layer metal metasurface (4) are composed of the same double-open resonant ring in xy two-dimensional plane by periodic arrangement, and the upper and lower layers of double-open resonant rings are arranged with a 90° offset. The quartz glass substrate (1) and the quartz glass cover layer (5) are both undoped fused quartz optical glass, with a refractive index of 1.8-2 and a thickness of t 1 of 300-500 μm. The lower layer metal metasurface (2) and the upper layer metal metasurface (4) are composed of gold films with a thickness of t m 180-200 nm, which are formed by laser etching, and the conductivity of gold is 4.51×10 7 S / m; the parameters of the metal metasurface are: period p 200-240 μm, outer diameter r 1 of 80-120 μm, inner diameter r 2 of 50-90 μm, double-open resonant ring opening size g 20-40 μm, middle diameter rod width w is 20-40 μm. The microfluidic channel (3) is formed by double-sided adhesive tape with a thickness of t 2 of 15-45 μm as a spacer and then bonded by ultraviolet glue, and after sealing, two small holes are laser printed on the quartz glass cover layer (5) 0.5-1 cm away from the metasurface, and two drainage tubes are connected as the inlet and outlet of the analyte solution.
[0007] The basic working principle of the sensor of the application is that the double-layer super surface opening resonant ring has C4 central symmetry, that is, theoretically has polarization independence, and after the terahertz wave is incident, a strong local electric field is formed on the surface of the opening resonant ring, especially the electric field is greatly enhanced at the opening, which can effectively enhance the interaction between the terahertz wave and the analyte on the super surface. According to the principle that the super surface structure of the upper and lower layers is superimposed and coupled to generate two resonances, the sensor has two resonant strong high-Q transmission resonance peaks in the 0.4-0.9 THz frequency band range, and can sensitively sense the moving change of the frequency spectrum.
[0008] In order to realize specific capture detection of the EpCAM marker-containing carcinoid cells, a series of functional modifications are carried out on the upper and lower double-layer super surface: the S bond in the tetrahedral DNA is used to form a stable S-Au bond with the gold microstructure of the super surface, 1-5 muM biotinylated-tetrahedral DNA is modified to the metal super surface, the modification condition is 8-12 h at 2-6 DEG C environment; the unmodified place of the metal super surface by the biotinylated-tetrahedral DNA is blocked by adding bovine serum albumin, the blocking condition is 0.5-1 h at room temperature; the biotin on the tetrahedral DNA is strongly combined with the streptavidin in a ratio of 1:4, and then the streptavidin is combined with the biotin on the tetrahedral DNA, the combination condition is 10-30 min at room temperature; finally, the biotinylated-EpCAM antibody is combined with the streptavidin, and the combination condition is 0.5-1 h at room temperature.
[0009] The beneficial effects and advantages of the application are:
[0010] 1. The application combines microfluidic technology to design a device for specifically detecting EpCAM marker-containing carcinoid cells in a liquid environment, which greatly reduces the absorption interference of water on THz waves and improves the signal-to-noise ratio.
[0011] 2. The microfluidic sensor based on the double-layer metal super surface after functional modification can capture more detection substances compared with the traditional single-layer super surface, greatly promotes the interaction between the to-be-detected substances and the terahertz wave, improves the detection precision and sensitivity, and reduces the detection limit. The sensor has two resonant strong transmission peaks of nearly-50 dB in the 0.4-0.9 THz frequency band range, and theoretically has wide-angle polarization insensitivity and beneficial detection performance.
[0012] 3. The device uses an ultraviolet laser direct writing equipment to manufacture the super surface metal opening resonant ring microstructure, the preparation process is simple and the cost is low, the upper and lower two layers of super surfaces are aligned by double-sided tape as an interval of 90°, and then are bonded by ultraviolet glue, which is easy to package and integrate, the material price is economical, and it is very suitable for large-scale and low-cost manufacturing. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 is a terahertz double-layer metasurface microfluidic sensor for detecting EpCAM marker-containing carcinoid cells according to the present application, Figure 1 (a) is a schematic diagram of the overall structure of the terahertz double-layer metasurface microfluidic sensor; Figure 1 (b) is a schematic diagram of the terahertz double-layer metasurface microfluidic sensor after functional modification for specifically capturing cancer cells; and (c) is a functional modification process of the metal metasurface.
[0014] Figure 2 is the geometric shape and size parameters of the double-layer metasurface unit, Figure 2 (a) is the upper metasurface; Figure 2 (b) is the lower metasurface;
[0015] Figure 3 (a) is a transmission spectrum diagram under different polarizations and without any analyte in the microfluidic channel; Figure 3 (b) is a transmission spectrum contour map of the sensor under different polarization angles;
[0016] Figure 4 is the electric field component and current distribution diagram of the upper and lower metasurfaces at the transmission resonance frequency;
[0017] Figure 5 is the transmission light spectrum corresponding to different microfluidic channel heights t 2 of the sensor;
[0018] Figure 6 is a simulation result diagram of adding analytes with different refractive indexes in the microfluidic channel of the sensor;
[0019] Figure 7 is an experimental result diagram of adding lung cancer cells A549 with different concentrations in the microfluidic channel of the sensor;
[0020] Figure 8 is an experimental result diagram of adding lung cancer cells A549 and normal cells with different concentrations in the microfluidic channel of the sensor, respectively.
[0021] BRIEF DESCRIPTION OF DRAWINGS: quartz glass substrate (1), lower layer metal metasurface (2), microfluidic channel (3), upper layer metal metasurface (4), quartz glass cover layer (5). DETAILED DESCRIPTION
[0022] The technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application, so that those skilled in the art can implement the present application according to the description.
[0023] In the description of the present application, it should be understood that the terms "upper", "lower", "front", "back", "left", "right", "top", "bottom", "inner", "outer" and the like indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, and are only for the convenience of describing the present application and simplifying the description, and therefore cannot be understood as indicating or implying that the device or element referred to must have a particular orientation, be constructed and operated in a particular orientation, and therefore cannot be understood as limiting the present application.
[0024] The present application will be further described below by a specific embodiment; it can be understood that the specific examples described herein are only for the purpose of explaining the present application, and not limiting the present application. Based on the examples in the present application, all other examples obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.
[0025] The present application provides a terahertz double-layer metasurface microfluidic sensor for detecting EpCAM marker-containing carcinoid cells, as shown in Figure 1 (a), comprising a quartz glass substrate (1), a lower layer metal metasurface (2), a microfluidic channel (3), an upper layer metal metasurface (4), and a quartz glass cover layer (5); the quartz glass substrate (1) and the quartz glass cover layer (5) are both undoped fused quartz optical glass with a refractive index of 2 and a thickness of t 1=500μm;the microfluidic channel (3) is formed between the lower layer metal metasurface (2) and the upper layer metal metasurface (4) and is combined by double-sided tape with a thickness of t 2= 25μm as a spacer and then bonded by ultraviolet glue, two small holes are laser drilled 1 cm away from the metasurface on the quartz glass cover layer (5) after sealing, and two drainage tubes are connected as the inlet and outlet of the analyte solution; the lower layer metal metasurface (2) and the upper layer metal metasurface (4) are composed of the same double-opened resonant ring arranged in a periodic manner in xy a two-dimensional plane, and the lower layer metal metasurface (2) and the upper layer metal metasurface (4) are arranged with a 90° offset, and the lower layer metal metasurface (2) and the upper layer metal metasurface (4) are both made of gold material, with an electrical conductivity of 4.51×10 7 S / m, and a metasurface structure thickness t m = 0.2μm, and the structure and parameters of the upper and lower layer metasurfaces are as shown in Figure 2 The parameters of the metasurface structure unit are: a period p = 220μm, an outer diameter r 1= 100μm, an inner diameter r 2= 70μm, a double-opened resonant ring opening size g = 30μm, and a middle diameter rod width w = 30μm.
[0026] Figure 1 (c) Modification method for functionalized metal metasurface: 1 μM biotinylated-tetrahedral DNA is modified to the metal metasurface, modification condition is 12 h at 4℃; the unmodified place on the metal metasurface is blocked by adding bovine serum albumin, blocking condition is 0.5 h at room temperature; then streptavidin is added to strongly bind with the biotin on the DNA on the tetrahedron, binding condition is 10 min at room temperature; finally, biotinylated-EpCAM antibody is added to bind on the streptavidin, binding condition is 0.5 h at room temperature.
[0027] Table 1 Nucleic acid sequence information of biotinylated-tetrahedral DNA:
[0028] Strand Sequence (5’ – 3’) S1 ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATTTTTTTTTTGTATCCCCGGGCTCA S2 HS-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC S3 HS-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC S4 HS-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT S5 biotin-TTTTTTGAGCCCGGGGATAC
[0029] Note: The terminal of S2, S3 and S4 is modified with a thiol molecule through six carbon atoms, S5 is modified with biotin, and S1 and S5 are complementary to each other.
[0030] Figure 3 (a) is the transmission spectrum of the sensor, according to the principle of superposition coupling of the upper and lower metasurface structures, the sensor has two very strong transmission peaks in the frequency range of 0.4-0.9 THz, which are f 1 = 0.53 THz, f 2 = 0.79 THz, and the corresponding quality factors Q are Q1 = 51 and Q2 = 82, respectively. The simulation obtained transmission peak values are about -50 dB, and the spectrum is very sharp, so it is very sensitive to the change of spectral frequency. The double-layer metasurface structure has C4 center symmetry, i.e. theoretically it has polarization independence, Figure 3 (b) shows the contour map of the terahertz microfluidic sensor under different polarization angle changes. With the change of polarization angle, the transmission spectrum of the two resonance peaks remains good consistency, which also confirms that the designed sensor has the characteristic of polarization insensitivity.
[0031] Figure 4 is the electric field component and current distribution diagram of the upper and lower metasurfaces at the transmission resonance frequency. Strong local electric field is formed on the metasurface, and the electric field is greatly enhanced at the resonance ring opening, which can effectively enhance the interaction between terahertz wave and analyte on the metasurface. At resonance f 1, the dipole moment of the upper metasurface structure is smaller than that of the lower metasurface structure, so resonance f 1 is dominated by the lower metasurface, which is caused by dipole resonance; at resonance f 2, the dipole moment of the upper metasurface structure is larger than that of the lower metasurface structure, so resonancef 2guided by the upper metasurface, also caused by the dipole resonance.
[0032] Figure 5 is the transmission spectrum of the sensor at different microfluidic channel heights t 2In the design process of the sensor, the height of the microfluidic channel is a crucial parameter. The height of the microfluidic channel not only directly affects the performance of the sensor, but also determines the sample injection amount. Therefore, the influence of the height of the microfluidic channel on the electromagnetic response of the sensor is explored to determine the optimal channel height. When the height of the microfluidic channel increases from 10 μm to 40 μm t 2, the resonance peak moves to the low frequency direction, the resonance inclination angle increases first and then decreases, the resonance peak f 2moves to the high frequency direction, and the resonance inclination angle also increases first and then decreases. Considering the actual experimental situation, lung cancer cells A549 are used for verification, the cell size is 10-20 μm in diameter, and the simulation is strongest at the resonance peak when the channel height is 25 μm. Therefore, when the height of the microfluidic channel is preferably 25 μm, the sensor will have the best detection capability. f
[0033] Figure 6 is the addition of analytes with different refractive indexes in the microfluidic channel of the sensor to evaluate the theoretical sensing performance. When the analyte to be measured with different refractive indexes is introduced into the microfluidic channel, the dielectric environment in the microchannel will change, thereby changing the electromagnetic response characteristics of the sensor, such as the resonance frequency, the resonance strength, etc. By monitoring the frequency shift and the change of the resonance strength of the sensor, the sensing detection of the analyte to be measured is realized. When the refractive index of the analyte to be measured in the microfluidic channel changes from 1 to 1.8, the theoretical sensing sensitivity of the resonance peak f 1, f 2is 106.98 GHz / RIU and 109.07 GHz / RIU, respectively, both of which have very high sensing sensitivity.
[0034] Figure 7 is the experimental sensing performance diagram of the sensor with different concentrations of lung cancer cells A549 in the microfluidic channel. In a liquid environment, lung cancer cells A549 containing EpCAM markers are specifically captured and detected by using EpCAM antibodies. Different concentrations of lung cancer cells A549 solution are introduced into the microfluidic sensor, and after specific binding reaction at room temperature for 0.5 h, the cells not captured specifically are removed by flushing with PBS solution. Then, the spectral change is measured and observed in a terahertz time-domain spectroscopy system. Different concentrations of lung cancer cells A549 can be effectively distinguished, and the concentration detection limit is as low as 1×10 3 cells / ml, which provides a reference for the diagnosis and detection of early lung cancer.
[0035] Figure 8 Different concentrations of lung cancer cells A549 and normal cells were added to the microfluidic channel of the sensor for specific comparison experiments. The present invention uses EpCAM antibody. Lung cancer cells A549 contain EpCAM, while normal cells do not. Therefore, lung cancer cells A549 can be specifically captured by the functionalized metasurface. The experiment verified that the frequency shift of lung cancer cells A549 is much larger than that of normal cells.
[0036] The advantage of this method lies in utilizing the functionalized double-layer metal metasurface to capture more analytes. Combined with the sensor's strong resonance characteristics, this greatly promotes the interaction between the analyte and the terahertz wave, improving sensitivity and detection accuracy. Furthermore, the sensor of this invention can be replaced with antibodies for specific capture and detection of other corresponding antigens, offering broad application possibilities. It has profound significance for enhancing the diversity of terahertz sensing detection and expanding its applications in chemistry, biology, medicine, and other fields.
[0037] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A terahertz bilayer metasurface microfluidic sensor for detecting EpCAM-containing cancer cells, characterized in that, The sensor comprises a quartz glass substrate (1), a lower metal metasurface (2), a microfluidic channel (3), an upper metal metasurface (4), and a quartz glass capping layer (5); a microfluidic channel (3) is formed between the lower metal metasurface (2) and the upper metal metasurface (4); the lower metal metasurface (2) and the upper metal metasurface (4) are composed of the same type of double-opening resonant rings arranged periodically in the xy two-dimensional plane, and the upper and lower double-opening resonant rings are staggered by 90°; the sensor operates at a temperature of 0.4 to 0. Two high-Q transmission resonance peaks with resonant intensities close to -50 dB are formed within the 9 THz frequency band. The upper and lower double-layered metasurfaces of the sensor are functionalized with biotinylated tetrahedral DNA-streptavidin-biotinylated EpCAM antibody for specific capture of EpCAM-labeled cancer cells in a liquid environment. A terahertz time-domain spectroscopy system is used to perform spectral measurements on the sensor, and based on the frequency shift of the spectrum, highly sensitive and specific detection of the analyte is achieved, with a detection limit as low as 1 × 10⁻⁶. 3 cells / ml.
2. The terahertz bilayer metasurface microfluidic sensor for detecting EpCAM-containing cancer cells according to claim 1, characterized in that, The quartz glass substrate (1) and the quartz glass capping layer (5) are both undoped fused silica optical glass with a refractive index of 1.8 to 2 and a thickness t1 of 300 to 500 μm.
3. The terahertz bilayer metasurface microfluidic sensor for detecting EpCAM-containing cancer cells according to claim 1, characterized in that, Both the lower metal metasurface (2) and the upper metal metasurface (4) have a thickness of t. m The gold film, ranging from 180 to 200 nm, was formed by laser etching. The electrical conductivity of gold is 4.51 × 10⁻⁶. 7 S / m; The parameters of the metal metasurface are: period p is 200-240 μm, outer diameter r1 is 80-120 μm, inner diameter r2 is 50-90 μm, the opening size g of the double-opening resonant ring is 20-40 μm, and the width w of the middle diameter rod is 20-40 μm.
4. A terahertz bilayer metasurface microfluidic sensor for detecting EpCAM-containing cancer cells according to claim 1, characterized in that, The microfluidic channel (3) is made of double-sided tape with a thickness t2 of 15-45 μm as a spacer and then bonded with UV adhesive. After sealing, two small holes are laser-drilled on the quartz glass cover layer (5) at a distance of 0.5-1 cm away from the metasurface, and two drainage tubes are connected to serve as the inlet and outlet of the analyte solution, respectively.
5. A terahertz bilayer metasurface microfluidic sensor for detecting EpCAM-containing cancer cells according to claim 1, characterized in that, The metasurface structure has C4 centrosymmetry, which theoretically means it has polarization-independent properties; the sensor has two strong high-Q transmission resonance peaks in the 0.4–0.9 THz frequency range, which can sensitively detect spectral shifts.
6. A terahertz bilayer metasurface microfluidic sensor for detecting EpCAM-containing cancer cells according to claim 1, characterized in that, The modification method for the metal metasurface is as follows: 1-5 μM biotinylated tetrahedral DNA is added to the metal metasurface for 8-12 h at 2-6 °C; bovine serum albumin is added to block the unmodified areas of the metal metasurface with biotinylated tetrahedral DNA for 0.5-1 h at room temperature; streptavidin is then added to strongly bind to the biotin on the tetrahedral DNA for 10-30 min at room temperature; finally, biotinylated EpCAM antibody is added to bind to the streptavidin for 0.5-1 h at room temperature.
7. A terahertz bilayer metasurface microfluidic sensor for detecting EpCAM-containing cancer cells according to claims 1-6, characterized in that, The sensor can be used to specifically detect EpCAM-conjugated cancer cells. Experiments verified that by introducing solutions of EpCAM-conjugated cancer cells at different concentrations into the microfluidic sensor and allowing specific binding reactions to occur at room temperature for 0.5–1 h, cells not specifically captured were washed with PBS solution to remove them. Then, spectral changes at different concentrations of cancer cells were measured and observed using a terahertz time-domain spectroscopy system. Different concentrations of lung cancer cells could be effectively distinguished, with a detection limit as low as 1 × 10⁻⁶. 3 cells / ml.
Citation Information
Patent Citations
High-sensitivity terahertz micro-fluid sensor based on band gap plasma resonance
CN108507969A
Terahertz-level chiral metasurface sensor and system for identifying lactic acid enantiomers
WO2024159594A1