Use of the dwarfing mutation of rice plant height-related gene XJHA in regulating rice plant height

Abstract

The present invention discloses the use of the dwarfing mutation of the rice plant height-related gene XJHA in regulating rice plant height. The amino acid sequence of the protein encoded by the rice plant height-related gene XJHA is shown as SEQ ID NO.26, and this dwarfing mutation has at least an allelic dwarfing mutation in which Asp at position 337 is mutated to Asn. The present invention can regulate rice plant height and has good application potential in the plant type breeding of rice varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of rice molecular biology, and specifically relates to the use of a dwarfing mutation of an allele of the rice plant height-related gene XJHA in regulating rice plant height. Background Art

[0002] Rice is one of the most important food crops in the world, and plant height is a key agronomic trait affecting rice yield, lodging resistance, and fertilizer tolerance (Liu et al. 2018). The genetic regulatory mechanism of rice plant height and its application in breeding have always been one of the hotspots and key issues in the research of rice genetics and breeding.

[0003] The application of rice plant height in breeding is mainly reflected in the discovery and utilization of dwarfing genes. Dwarfing genes can reduce rice plant height, improve lodging resistance, increase stem strength, and reduce the consumption of nutrients by stems, thereby increasing yield. Currently, there are many rice mutants and genes related to the dwarfing trait, which are distributed on each chromosome of rice. However, most of the identified semi-dwarf and dwarf genes have negative effects on the agronomic traits of rice, thus limiting their application in breeding. Therefore, there are not many dwarfing genes currently applied in breeding, and the most widely used one is the Green Revolution gene sd1.

[0004] sd1 can reduce rice plant height, improve lodging resistance, increase stem strength, and reduce the consumption of nutrients by stems, thereby increasing yield. There are multiple alleles of sd1 in rice, among which the loss-of-function sd1-d, sd1-AJNT, and sd1-9311 are widely used in indica rice, such as varieties IR8, IR36, IR64, 9311, etc. In japonica rice, sd1-r and sd1-j are mainly retained, such as the "Dongnong" and "Xiushui" series. In addition, sd1-d was introduced into the rice variety Daohuaxiang 2 (DHX2), and dwarf and semi-dwarf lines (1279 and 1280) carrying sd1-d were obtained (Sha et al. 2022). However, the overuse of sd1 will result in a single dwarfing gene in breeding varieties and a reduction in genetic diversity. Therefore, there is an urgent need for new semi-dwarf rice genes that can be used in breeding.

[0005] In summary, due to the extensive application of SD1 but the vulnerability of a single genetic resource, the excavation and identification of new genes related to plant height control and the revelation of their biological functions have great application value for the directional improvement of rice plant height and the guarantee of the diversity of rice semi-dwarf genetic resources. Summary of the Invention

[0006] The purpose of the present invention is to overcome the defects of the prior art and provide the use of a dwarfing mutation of the rice plant height-related gene XJHA in regulating rice plant height.

[0007] Another object of the present invention is to provide a rice plant height-related mutant gene xjha.

[0008] Another object of the present invention is to provide a plant expression vector.

[0009] Another object of the present invention is to provide a recombinant bacterium.

[0010] The technical solution of the present invention is as follows:

[0011] Use of the dwarfing mutation of the rice plant height-related gene XJHA in regulating rice plant height, the amino acid sequence of the protein encoded by the rice plant height-related gene XJHA is shown in SEQ ID NO.26, and the dwarfing mutation has at least an allelic dwarfing mutation in which Asp at position 377 is mutated to Asn.

[0012] In a preferred embodiment of the present invention, the nucleotide sequence of the genome of the allelic dwarfing mutation is shown in SEQ ID NO.01.

[0013] More preferably, the nucleotide sequence of the cDNA of the allelic dwarfing mutation is shown in SEQ ID NO.02.

[0014] In a preferred embodiment of the present invention, the manner of forming the dwarfing mutation includes at least one of natural mutation, artificial mutagenesis and gene editing.

[0015] A rice plant height-related mutant gene xjha, the amino acid sequence of the protein encoded by it is shown in SEQ ID NO.03.

[0016] In a preferred embodiment of the present invention, the nucleotide sequence of its genome is shown in SEQ ID NO.01.

[0017] More preferably, the nucleotide sequence of its cDNA is shown in SEQ ID NO.02.

[0018] In a preferred embodiment of the present invention, the manner of its formation includes at least one of natural mutation, artificial mutagenesis and gene editing

[0019] A plant expression vector, containing the nucleotide sequence of the dwarfing mutation of the rice plant height-related gene XJHA, the amino acid sequence of the protein encoded by the rice plant height-related gene XJHA is shown in SEQ ID NO.26, and the dwarfing mutation has at least an allelic dwarfing mutation in which Asp at position 377 is mutated to Asn.

[0020] A recombinant bacterium, containing the above plant expression vector.

[0021] The beneficial effects of the present invention are as follows: The present invention can effectively regulate the plant height of rice and has good application potential in the plant type breeding of rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 For Example 1 of the present invention, (A) mature plants of wild type (WT) and mutant xjha, the scale bar is 10 cm; (B - G) comparison of agronomic traits between WT and xjha, unit is cm, plant height (B), panicle length (C), panicle neck length (D), internode length (E), leaf length (F), leaf width (G), * indicates significant difference, ** indicates extremely significant difference, ns indicates no significant difference (*P < 0.05, **P < 0.01, ns P > 0.05).

[0023] Figure 2 For Example 1 of the present invention, (A - E) statistical charts of yield - related traits of WT and xjha, where, grain shape (A), grain length (B), grain width (C), effective panicle number (D), 1000 - grain weight (E), filled grains per panicle (F), seed - setting rate (G), yield per plant (H).

[0024] Figure 3 For Example 2 of the present invention, the mapping on the chromosome of xjha, where: ((A)) xjha is mapped between RM495 and RM13226 on the long arm of chromosome 2; ((B)) using 1143 F2 single plants for large - scale linkage analysis, xjha is mapped to the genomic region between markers RM12965 and RM12979, and its physical distance is 131 Kb, and there are 5 functionally annotated genes. Sequencing the OsCPS1 gene of WT and xjha, it is found that compared with WT, the 48th base on the 7th exon of OsCPS1 in xjha changes from G to A, resulting in the 377th amino acid changing from aspartic acid Asp (D) to asparagine Asn (N) (OsCPS1 D377N ). The blue squares represent exons, the gray lines represent introns, the red square represents the 7th exon, and the orange squares represent 5’UTR and 3’UTR.

[0025] Figure 4 Shows the haploid types with the number of samples greater than 10 in Example 2 of the present invention, indicating that xjha in Example 2 is a new allelic gene mutation.

[0026] Figure 5 For Example 4 of the present invention, (A) construction of the complementation vector pRHE - OsCPS1p::OsCPS1, (B - E) comparison of plant - height - related traits of WT, xjha and complemented plants. Plant type, Bar = 7 cm (B), OsCPS1 mRNA level (C), plant height (D), internode length (E). DETAILED DESCRIPTION OF THE INVENTION

[0027] The technical solutions of the present invention will be further described and illustrated below in conjunction with specific embodiments and the accompanying drawings.

[0028] Example 1 Comparison of the mutant and wild-type plant types

[0029] In this example, xjha is a dwarf mutant, which is a rice plant with a single-base natural mutation in the OsCPS1 gene found in the field population of the rice variety Jiahexinzhan. Compared with the wild-type Jiahexinzhan, this mutant plant shows reduced plant height and increased tillering, while there is no significant difference in seed setting rate and yield compared with the wild-type ( Figure 1 ). xjha may have good application potential in improving the lodging resistance breeding of rice varieties. The rice plant height-related mutant gene xjha was obtained from this mutant plant. Its genome is 10202 bp in length, and the cDNA coding region sequence is 2604 bp in length, as shown in SEQ ID NO.01 and SEQ ID NO.02 respectively. It encodes 867 amino acids, as shown in SEQ ID NO.03, and this mutation is an allelic dwarf mutation. The amino acid sequence of the protein encoded by the wild-type rice plant height-related gene XJHA relative to this mutation is shown in SEQ ID NO.26.

[0030] Example 2 Map-based cloning of the xjha gene

[0031] In order to map and clone the regulatory gene for the plant height of the dwarf mutant in Example 1, a genetic mapping population was constructed. In this example, the dwarf mutant xjha was crossed with the japonica-type rice variety Samba to construct a genetic mapping population for gene mapping. After selecting 20 plants with very significant mutant phenotypes from the F2 population of the cross between the mutant xjha and the japonica variety Samba for bulk screening and single-plant verification, the gene was mapped within the interval of physical positions 9562527 - 10806334 on chromosome 2. New molecular markers were developed within this interval, and the interval was continuously narrowed between the two markers. Finally, the dwarf gene was mapped within a 140 kb interval with physical positions chr2:10186708 - 1032662 ( Figure 3 ).

[0032] After further sequencing analysis, in this example, it was found that the base at position 48 on the 7th exon of gene LOC_Os02g17780 was mutated from G to A, causing the 377th amino acid Asp to become Asn, thereby affecting the function of the XJHA protein. Therefore, it was determined that LOC_Os02g17780 (OsCPS1) was the target gene of the plant height regulatory gene, and this gene was named XJHA (wild type, the nucleotide sequence of its genome is shown in SEQ ID NO.25), which encodes an expressed protein with pleiotropy and is related to multiple traits of the rice plant type( Figure 3 ).

[0033] In addition, in order to characterize the genetic diversity of OsCPS1, in this example, the haplotypes of this gene were analyzed using the public database in the 3K Rice Genome Project (https: / / www.rmbreeding.cn). Fourteen single nucleotide polymorphisms (SNPs) were identified in the coding region of OsCPS1, and the rice varieties were divided into 241 haplotypes (Haps). Figure 4 The haploid types with more than 10 samples are shown. No SNP sites were found on Exon7 of OsCPS1, indicating that xjha is a new allele of OsCPS1.

[0034] The sequencing primers used in this example are as follows:

[0035] CPS1-CDS1 / 2-F: gcatcgcatctccatcatctcc (SEQ ID NO.04)

[0036] CPS1-CDS1 / 2-R: cctactgttcttcgatcgggttc (SEQ ID NO.05)

[0037] CPS1-CDS3 / 4-F: aactataccaaaaacatgcggcac (SEQ ID NO.06)

[0038] CPS1-CDS3 / 4-R: tgtaacaaacctatctcaaactgtctatc (SEQ ID NO.07)

[0039] CPS1-CDS5 / 6-F: gctaagttgctataatttaagacggagg (SEQ ID NO.08)

[0040] CPS1-CDS5 / 6-R: caacatcacatgatctgagatcagc (SEQ ID NO.09)

[0041] cx-CPS1-F: catatctcgagttggcgaaacag (SEQ ID NO.10)

[0042] CPS1-CDS7 / 8 / 9-F: gattcgtggcatttcactgacc (SEQ ID NO.11)

[0043] CPS1-CDS7 / 8 / 9-R: cagtgcaatgttatatcagtactcagg (SEQ ID NO.12)

[0044] CPS1-CDS10 / 11 / 12-F: cctaccaggagaggtataatctagttac (SEQ ID NO.13)

[0045] CPS1-CDS10 / 11 / 12-R: catagagaggacaagcatcagaag (SEQ ID NO.14)

[0046] CPS1-CDS13 / 14-F: gagaagaatgcttgccttggagtac (SEQ ID NO.15)

[0047] CPS1-CDS13 / 14-R: caattcagtgaatacagcttgtcaag (SEQ ID NO.16)

[0048] CPS1-CDS15-F: gataattctaactctcaaggcatctcc (SEQ ID NO.17)

[0049] CPS1-CDS15-R: cacatgtagaaccatacagagatacatc (SEQ ID NO.18)

[0050] Example 3: Construction of xjha genetic complementation transgenic plants and identification of transgenic materials

[0051] In this example, a 7821 bp gene fragment (including 2166 bp before the start codon of XJHA, the full length of XJHA, and 215 bp after the stop codon) in the wild-type XJHA of the gene xjha shown in SEQ ID NO.01 was amplified by PCR and ligated to the plant expression vector pRHE to construct the genetic complementation vector pRHE-gXJHA( Figure 4), and then transfer the genetic complementation vector pRHE-gXJHA into Agrobacterium tumefaciens EHA105 and transform it into the semi-dwarf mutant xjha. Specifically: Infect the callus of the xjha mutant with Agrobacterium tumefaciens EHA105 containing the genetic complementation vector pRHE-gXJHA, and perform co-culture, bacteria elimination, antibiotic screening and differentiation at 28°C (for about 4 months) to obtain the pRHE-gXJHA transgenic plants with the full length of the rice XJHA gene.

[0052] Identification of T0 transgenic plants: Amplify using the following primers to identify the T0 plants into which the above genetic complementation vector carrying the target gene has been successfully transferred.

[0053] gXJHA-F: gggagcaaacaccgcaaagg (SEQ ID NO.19)

[0054] gXJHA-R: agaacaaatccaaaataaataatttataaaaaatg (SEQ ID NO.20)

[0055] NosR-seq: agaccggcaacaggattcaatc (SEQ ID NO.21)

[0056] CPS1-CDS15-F: gataattctaactctcaaggcatctcc (SEQ ID NO.22)

[0057] The average plant height of the genetic complementation transgenic plants (82.4 cm) increased by 32.9% compared with the mutant xjha (62.0 cm), and there was no significant difference compared with the wild type WT (91.0 cm) ( Figure 5 ). By detecting the mRNA expression level of OsCPS1 in the complemented materials through qPCR, it was found that the sixth complemented material (cp6) not only had its plant height complemented but also the mRNA level did not change significantly ( Figure 5 ). Measuring the internode length of cp6 found that the internode lengths of cp6, especially the first and second internodes from the top, were significantly elongated compared with xjha and were basically the same as those of WT ( Figure 5 ). The ability of OsCPS1 WT to complement the defect in the plant height trait of xjha indicates that OsCPS1 is the control gene for the plant height phenotype of the mutant xjha. As Figure 5 shown, XJHA can regulate plant height, indicating that the rice plant height-related gene XJHA in the present invention has good application potential in the plant type breeding of rice varieties.

[0058] The primers used in the above qPCR are as follows:

[0059] QCPS1-F: gaacgtttacccggtcgatc (SEQ ID NO.23)

[0060] Qcps1-R: cttcagtccagtgcctgttg (SEQ ID NO.24)

[0061] As is known to those of ordinary skill in the art, homologous genes of the rice OsCPS1 gene in Example 1 also exist in gramineous plants. When these homologous genes undergo mutations that are the same as or similar to the xjha mutation of the OsCPS1 gene, the same or similar technical effects as those in the above examples can also be obtained, that is, the plants are partially dwarfed. The above homologous genes include, but are not limited to, the wheat TaCPS3 gene (Gene ID: TraesCS7D02G539200) and the maize An1 (Gene ID: Zm00001d032961 / Zm00001d032961).

[0062] As mentioned above, it is only the preferred embodiment of the present invention, so the scope of implementation of the present invention cannot be limited thereby. That is, equivalent changes and modifications made according to the scope of the present invention patent and the content of the specification should still fall within the scope covered by the present invention.

Claims

1. Rice plant height-related genes XHJ Use of a dwarfing mutation in regulating rice dwarfing, characterized in that: Rice plant height-related genes XHJ The amino acid sequence of the encoded protein is shown in SEQ ID NO.26, and the dwarfing mutation is an allele dwarfing mutation in which Asp at position 377 of the amino acid sequence shown in SEQ ID NO.26 is mutated to Asn.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the genome of the allele dwarfing mutation is shown in SEQ ID NO.

01.

3. The use according to claim 2, characterized in that: The nucleotide sequence of the cDNA of the allele dwarfing mutation is shown in SEQ ID NO.

02.

4. The use according to any one of claims 1 to 3, characterized in that: The method of forming the dwarfing mutation includes at least one of natural mutation, artificial mutagenesis and gene editing.

5. A mutant gene related to rice plant height xj , characterized in that: The amino acid sequence of the protein encoded by it is shown in SEQ ID NO.

03.

6. A rice plant height-related mutant gene according to claim 5 xj , characterized in that: The nucleotide sequence of its genome is shown in SEQ ID NO.

01.

7. A rice plant height-related mutant gene according to claim 6 xj , characterized in that: The nucleotide sequence of its cDNA is shown in SEQ ID NO.

02.

8. A plant expression vector, characterized in that: Contains rice plant height-related genes XHJ Nucleotide sequence of dwarfing mutation of rice plant height-related gene XHJ The amino acid sequence of the encoded protein is shown in SEQ ID NO.26, and the dwarfing mutation is an allele dwarfing mutation in which Asp at position 377 of the amino acid sequence shown in SEQ ID NO.26 is mutated to Asn.

9. A recombinant bacterium, characterized in that: Containing the plant expression vector according to claim 8.

Images