A recombinant sea cucumber peptide with soothing effect and its preparation method and application

Abstract

The present application discloses a recombinant sea cucumber peptide with soothing effect, a preparation method thereof and an application thereof, wherein the amino acid sequence with repairing effect is shown in SEQ ID NO. 1. The present application also provides a preparation method of a recombinant sea cucumber peptide, which mainly comprises: gene synthesis; constructing a vector plasmid: integrating the target gene sequence into the vector plasmid, and introducing the plasmid into a competent genetic engineering strain; fermenting and expressing the target product; obtaining a high-purity sea cucumber peptide by purification means (solid-liquid separation, salting out, isoelectric precipitation, chromatography technology, ultrafiltration), and the sea cucumber peptide has excellent water solubility and high purity, and can be widely used in cosmetics.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a recombinant sea cucumber peptide with soothing effect, and a preparation method and application thereof. Background Art

[0002] Sea cucumber is a general term for animals of the class Holothuria of the phylum Echinodermata. Although sea cucumbers are cylindrical, their thickness, shape and size vary greatly from species to species. Common large edible sea cucumbers are all relatively sturdy cylindrical, with warty feet on the back and tube feet on the ventral side. The body wall of sea cucumbers is flexible and rich in connective tissue, and the thickness varies with the species. Because of its cucumber-like appearance, it is called "sea cucumber" in English. There are more than 900 species of sea cucumbers in the world, and about 140 species in China. Since ancient times, sea cucumbers have been a precious and fine product for nourishing the body and a good medicine for preventing and treating some diseases. There are many records in Chinese medical books of successive dynasties. Sea cucumbers are sweet and warm in nature. They have the effects of nourishing the kidney and essence, nourishing blood and moistening dryness, and prolonging life, which can be compared with ginseng. Sea cucumbers are one of the potential marine organisms that have a beneficial effect on human health. Modern pharmacological studies have shown that sea cucumber peptides, as a marine bioactive peptide, have multiple biologically active functions, such as anti-oxidation, anti-inflammatory, anti-fatigue, anti-tumor, immune regulation, and lowering blood pressure.

[0003] The sources of sea cucumber peptides or sea cucumber collagen on the market are all obtained by extracting sea cucumbers. On the one hand, the price of fresh sea cucumbers is relatively expensive, and the extraction yield is not very high. On the other hand, catching a large number of sea cucumbers is likely to cause damage to the ecological environment, which will have an impact on the marine environment and the ecological chain. At the same time, the extracted sea cucumber peptides or sea cucumber collagen have the risk of animal immunogenicity. Therefore, obtaining recombinant sea cucumber peptides through genetic engineering, fermentation, and purification has broad market prospects. Summary of the invention

[0004] Sea cucumber polypeptides have many physiological functions, but in the prior art, research is mainly focused on the repairing effect of sea cucumber polypeptides. The purpose of this application is to provide an active polypeptide with repairing effect derived from sea cucumbers.

[0005] The present application provides an amino acid sequence with a repairing effect, wherein the amino acid sequence is shown in SEQ ID NO.1, and SEQ ID NO.1 is

[0006] IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK.

[0007] The present application also provides a polypeptide with repairing effect, wherein the polypeptide comprises the following amino acid sequence: (IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK) n , n is 1, 2, 3, 4 or 5.

[0008] Furthermore, the amino acid sequence of the polypeptide is SEQ ID NO.2, and the SEQ ID NO.2 is (IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK) 2 .

[0009] Furthermore, the amino acid sequence or polypeptide is derived from sea cucumber.

[0010] The present application provides a nucleic acid sequence encoding the aforementioned amino acid sequence or the aforementioned polypeptide.

[0011] The present application also provides a method for preparing a polypeptide, wherein the polypeptide is the aforementioned polypeptide.

[0012] Further, including:

[0013] The polypeptide is obtained by expressing and purifying Pichia pastoris, and the Pichia pastoris carries an expression vector having the nucleic acid sequence of the polypeptide.

[0014] Furthermore, the Pichia pastoris is Pichia pastoris GS115, and preferably the expression vector is pPIC9K.

[0015] The present application provides the use of the aforementioned amino acid sequence or the aforementioned polypeptide or the polypeptide prepared by the aforementioned method in the preparation of cosmetics.

[0016] The present application provides a cosmetic comprising the aforementioned amino acid sequence or the aforementioned polypeptide or a polypeptide prepared by the aforementioned method.

[0017] The sea cucumber in this application extracts a polypeptide with a repair function composed of a short amino acid sequence, which has excellent repair properties. The sea cucumber peptide is prepared, fermented, and purified through synthetic biology, and has the advantages of high purity, good efficacy, and low cost. By formulating a soothing and repairing essence lotion, the repair effect is excellent. It can be further widely used in cosmetics. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the mass spectrum obtained by mass spectrometry detection of sea cucumber polypeptides in Example 2.

[0019] Figure 2 This is the mass spectrum obtained by mass spectrometry detection of sea cucumber polypeptides in Example 2.

[0020] Figure 3 This is the plasmid map of the recombinant sea cucumber peptide in Example 5.

[0021] Figure 4 This is a graph showing the moisture content of the skin stratum corneum before and after using the soothing and repairing essence lotion in Example 6.

[0022] Figure 5This is a graph of the transepidermal water loss rate of the skin before and after using the soothing and repairing essence lotion in Example 6.

[0023] Figure 6 This is a diagram showing the difference in the red zone a value before and after using the soothing and repairing essence lotion in Example 6. DETAILED DESCRIPTION

[0024] The following is a description of the exemplary embodiments of the present application, including various details of the embodiments of the present application to facilitate understanding, which should be considered as merely exemplary. Therefore, it should be recognized by those of ordinary skill in the art that various changes and modifications can be made to the embodiments described herein without departing from the scope and spirit of the present application. Similarly, for the sake of clarity and conciseness, the description of well-known functions and structures is omitted in the following description.

[0025] As used herein, the terms "polypeptide," "peptide," "sea cucumber peptide," and "sea cucumber polypeptide" are used interchangeably herein to refer to polymers of amino acid residues. That is, descriptions of polypeptides are equally applicable to describing peptides and describing proteins, and vice versa. The terms are applicable to naturally occurring amino acid polymers and amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the terms encompass amino acid chains of any length.

[0026] As used herein, the term "nucleic acid molecule" may include those containing naturally and / or non-naturally occurring nucleotides and bases, including, for example, those with backbone modifications, and refers to polymers of nucleotides, such polymers of nucleotides may contain natural and / or non-natural nucleotides, and include, but are not limited to, DNA, RNA, and PNA. Nucleotide sequence refers to the linear sequence that constitutes a nucleic acid molecule.

[0027] In some cases, the nucleic acid molecule contains cDNA, and in some cases, the nucleic acid molecule can be modified for use in the constructs described herein, such as for codon optimization. In some cases, for the purpose of cloning into a vector, the sequence can be designed to contain a terminal restriction site sequence.

[0028] In some cases, nucleic acid molecules can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) amplification of encoding nucleic acids within or isolated from one or more given cells.

[0029] As used herein, the term "nucleic acid", "polynucleotide" or "nucleotide" can be used generically, which means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences.

[0030] As used herein, the term "vector" is used to describe a nucleic acid molecule that can be engineered to contain a polynucleotide or multiple polynucleotides that can be cloned and amplified in a host cell. Vectors include, but are not limited to: single-stranded, double-stranded or partially double-stranded nucleic acid molecules; nucleic acid molecules containing one or more free ends, no free ends (e.g., circular); nucleic acid molecules containing DNA, RNA or both; and other polynucleotide species known in the art. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which additional DNA fragments can be inserted, such as by standard molecular cloning techniques. Certain vectors are capable of autonomous replication in the host cell into which they are introduced (e.g., bacterial vectors and episomal mammalian vectors having a bacterial origin of replication). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell after introduction into the host cell, thereby replicating with the host genome. In addition, certain vectors are capable of directing the expression of those genes to which they are operably linked. Such vectors are referred to herein as "expression vectors." The recombinant expression vector may contain the nucleic acid of the present application in a form suitable for expressing the nucleic acid in a host cell, which means that the recombinant expression vector includes one or more regulatory elements, which can be selected based on the host cell used for expression and can be operably linked to the nucleic acid sequence to be expressed.

[0031] As used herein, the term "expression" includes any step involved in the production of the variant including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0032] As used herein, the term "expression vector" means a linear or circular DNA molecule comprising a polynucleotide encoding a variant and operably linked to other nucleotides that provide for its expression.

[0033] As used herein, the term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. of a nucleic acid construct or expression vector comprising the polynucleotides of the present application. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The host cell can be any cell useful in the production of recombinant human-like collagen of the present application.

[0034] In the following amino acid sequences and polypeptide sequences, capital letters such as I, P, V, Q, E, S, T, and W represent an amino acid or its amino acid residue. The correspondence between the capital letters and the amino acids is shown in Table 1.

[0035] Table 1 shows the amino acids and their corresponding abbreviations

[0036]

[0037]

[0038] The present application provides an amino acid sequence with a repairing effect, the amino acid sequence is shown in SEQ ID NO.1, and the SEQ ID NO.1 is

[0039] IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK.

[0040] The amino acid sequence is derived from sea cucumber.

[0041] The present application also provides a polypeptide with repairing effect, wherein the polypeptide comprises the following amino acid sequence: (IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK) n , n is a positive integer from 1 to 5.

[0042] In some embodiments, when n is 1, the polypeptide comprises an amino acid sequence of IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK (SEQ ID NO. 1).

[0043] In some embodiments, when n is 2, the polypeptide comprises an amino acid sequence of IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSV LDVVRK (SEQ ID NO. 2).

[0044] In some embodiments, when n is 3, the polypeptide comprises an amino acid sequence of IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSV LDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK (SEQ ID NO. 3).

[0045] In some embodiments, when n is 4, the polypeptide comprises an amino acid sequence of IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSV LDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRKIINEPTAAALAYGLDKKGHYTEGA ELVDSVLDVVRK (SEQ ID NO.4).

[0046] In some embodiments, when n is 5, the polypeptide comprises an amino acid sequence of IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSV LDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRKIINEPTAAALAYGLDKKGHYTEGA ELVDSVLDVVRKIINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK (SEQ ID NO.5).

[0047] In the present application, the amino acid sequence or polypeptide is derived from sea cucumber. In some embodiments, the amino acid sequence or polypeptide is obtained by hydrolyzing sea cucumber by enzymatic hydrolysis.

[0048] The present application also provides a nucleic acid sequence of the aforementioned amino acid sequence or the aforementioned polypeptide.

[0049] The nucleotide sequence of the recombinant sea cucumber peptide with repairing effect is as follows:

[0050] (ATTATTAACGAACCAACTGCTTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACA CTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAG) n , n is a positive integer from 1 to 5, and the optimal value is n=2.

[0051] In some embodiments, when n is 1, the nucleotide sequence of the recombinant sea cucumber peptide having a repairing effect is

[0052] ATTATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACA CTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAG (SEQ ID NO. 6).

[0053] In some embodiments, when n is 2, the nucleotide sequence of the recombinant sea cucumber peptide having a repairing effect is

[0054] ATTATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACACTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAGATTATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACACTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAG (SEQ ID NO. 7).

[0055] In some embodiments, when n is 3, the nucleotide sequence of the recombinant sea cucumber peptide having a repairing effect is

[0056] ATTATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACACTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAGATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCA TTACACTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAGATTATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACACTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAG(SEQ ID NO.8).

[0057] In some embodiments, when n is 4, the nucleotide sequence of the recombinant sea cucumber peptide having a repairing effect is

[0058] ATTATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACACTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAGATTATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACACTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAGATTATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACACTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAGATTATTAACGAACCAACTGCTGCTGCTTTGGCTTACGGTTTGGATAAGAAGGGTCATTACACTGAAGGTGCTGAATTGGTTGATTCTGTTTTGGATGTTGTTAGAAAG(SEQ ID NO.9).

[0059] In some embodiments, when n is 5, the nucleotide sequence of the recombinant sea cucumber peptide with repair efficacy is

[0060] (SEQ ID NO.10).

[0061] In some embodiments, the amino acid sequence or polypeptide can be produced by chemical synthesis. In some embodiments, the polypeptide can be produced by biosynthesis. In some embodiments, the polypeptide can be extracted from food or obtained by enzymatic hydrolysis.

[0062] The present application provides a method for preparing a polypeptide, wherein the polypeptide is the aforementioned polypeptide.

[0063] In this application, the method comprises:

[0064] The polypeptide is obtained by expressing and purifying Pichia pastoris, and the Pichia pastoris carries an expression vector having the nucleic acid sequence of the polypeptide.

[0065] Pichia pastoris is a unicellular fungus belonging to the family Saccharomyces. The Pichia pastoris ferments under anaerobic conditions. Its cell morphology is usually elliptical or spherical, with a diameter of 2 to 4 microns, and sometimes pseudohyphae are formed. The optimal growth temperature of Pichia pastoris is 28 to 30°C, but it can also grow at 37°C. The Pichia pastoris has an AOX1 gene, which is a methanol utilization gene of Pichia pastoris. The promoter of the AOX1 gene is one of the promoters with the strongest regulatory mechanism and the strictest regulation mechanism. At the same time, the constructed Pichia pastoris can be stably integrated in the form of a single copy or multiple copies at a specific site of the genome of Pichia pastoris, and the strain of Pichia pastoris is easy to ferment at a high density, with a high expression of exogenous proteins. There are also peroxisomes in Pichia pastoris, in which the expressed proteins are stored, which can be protected from degradation by proteases and reduce toxic effects on cells.

[0066] The Pichia pastoris is Pichia pastoris GS115.

[0067] The Pichia pastoris GS115 strain is a yeast commonly used in biotechnology and protein expression systems. It has an AOX1 gene, which can be normally expressed to produce an enzyme that converts methanol into formaldehyde, and is a normal methanol-utilizing yeast.

[0068] In a specific embodiment, the expression vector is pPIC9K.

[0069] The pPIC9K plasmid is a plasmid used in the expression system of Escherichia coli, and is usually used to express foreign genes in Escherichia coli. pPIC9K contains a selection marker, which is mainly used to screen and maintain the presence of the plasmid in the culture medium of Pichia pastoris. A selection marker is a gene or DNA fragment that allows only cells with a specific plasmid to grow and reproduce. pPIC9K usually contains multiple cloning sites, allowing researchers to insert foreign genes of interest into it. These sites are usually located around some restriction enzyme cutting sites to facilitate the insertion of DNA fragments.

[0070] In a specific embodiment, the method for preparing the polypeptide is: codon optimization of the amino acid sequence or the polypeptide to obtain a nucleic acid sequence encoding the amino acid sequence or the polypeptide sequence; connecting the nucleic acid sequence with the vector pPIC9K to obtain a recombinant vector; electroporating the recombinant vector into Pichia pastoris GS115 to obtain a recombinant Pichia pastoris; inducing fermentation of the recombinant Pichia pastoris to obtain the polypeptide.

[0071] In a specific embodiment, the induced culture is induced culture using methanol.

[0072] The present application provides the use of the aforementioned amino acid sequence or the aforementioned polypeptide or the polypeptide prepared by the aforementioned method in the preparation of cosmetics.

[0073] The present application provides a skin care product, which is composed of raw materials in the mass ratio shown in Table 2 below.

[0074] Table 2

[0075]

[0076]

[0077] Example

[0078] The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0079] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0080] Example 1 Extraction of sea cucumber polypeptides

[0081] 1) Take fresh sea cucumber, remove the mouth, internal organs and inner membrane, wash and crush, and weigh 1 kg.

[0082] 2) Add 6 kg of ultrapure water, adjust the pH to 7.0, add 1% neutral protease, and control the enzymatic hydrolysis at 27° C. for 8 hours.

[0083] 3) heating the hydrolyzate at 100° C. for 40 minutes to inactivate the enzyme, and cooling to room temperature to obtain a sea cucumber enzymatic hydrolyzate;

[0084] 4) adding 95% ethanol to the sea cucumber hydrolysate until the ethanol volume fraction is 80%, and letting it stand for 12 hours;

[0085] 5) Centrifuge at 10000 rpm for 30 minutes;

[0086] 6) Recovering the ethanol in the supernatant, and decolorizing and removing the fishy smell of the sea cucumber polypeptide mixture through an anionic resin to obtain a sea cucumber polypeptide extract.

[0087] 7) Use a dialysis bag to perform desalination at 4°C.

[0088] The extract is placed in liquid nitrogen for rapid freezing and drying to obtain sea cucumber polypeptide freeze-dried powder.

[0089] Example 2: Screening of polypeptide sequences with repair efficacy

[0090] Take the sea cucumber polypeptide freeze-dried powder obtained in Example 1 and dissolve it in 1% formic acid solution. Use orbital ion trap mass spectrometer (Thermo, America) for analysis. The flow rate is 0.300μl / min, and the analytical column is Acclaim PepMap RSLC column (75μm ID, 250mm length, C18). The mobile phase A is composed of 0.1% formic acid-water, and the mobile phase B is composed of 80% acetonitrile and 0.1% formic acid. Gradient elution conditions: 0-5min, 3% B; 5-80min, 22% B; 80-92min, 35% B; 92-103min, 90% B; 103-109min, 90% B; 109-110min, 3% B. The scanning range is 600-10000 m / z, the resolution is 60000, and the results are as follows Figure 1 as well as Figure 2 shown.

[0091] Screening for peptide sequences with repair effects:

[0092] Orbitrap-MS analysis was performed on the freeze-dried sea cucumber powder. By searching the corresponding ncbi sea cucumber protein database, a total of 327 peptide spectra, 74 proteins, 24 proteomes, and 197 peptides were obtained. The theoretical molecular weight of 98.98% of the peptides was between 800Da and 2000Da. The MS / MS spectra were searched according to the selected sea cucumber protein database using the software byonic (version 3.2.0). GO analysis (Gene Ontology (GO)) was performed on the 74 proteins using the GO tool provided by the UniProt community (http: / / www.uniprot.org / ). 64 IDs were expressed, 8 molecular functions were obtained, 11 biological processes were involved, and they existed in 5 cell components. The amino acid sequence of the sea cucumber polypeptide with repairing effect was screened as shown in SEQ ID NO.2.

[0093] Example 3: Determination of the repair performance of sea cucumber peptides

[0094] Principle of repair performance determination: The proliferation, differentiation and orderly assembly of keratinocytes form a skin barrier. When the assembly process is disordered, the skin barrier function will be damaged. The effect of skin barrier damage repair can be achieved by regulating the proliferation and differentiation of keratinocytes. This experiment evaluates its ability to promote cell proliferation by detecting the changes in cell proliferation after the test substance acts. The amino acid sequence of the sea cucumber peptide in this example is shown in SEQ ID NO.2.

[0095] 1) Experimental design and methods

[0096] (1) Cell viability test: Human keratinocytes (HaCaT) in the logarithmic growth phase were collected and the cell density was adjusted to inoculate into 96-well plates, with each well containing 100 μl of culture medium. 2 After culturing in the cell culture incubator for 24 hours, the culture medium was removed, the cells were washed twice with PBS buffer, and then the cells were grouped and dosed according to the prepared concentrations of the sea cucumber peptide samples in Table 3.

[0097] Table 3 is the concentration design table of sea cucumber peptides in the cell viability test

[0098]

[0099] (2) Grouping is shown in Table 4

[0100]

[0101] (3) Model drug administration: CO after drug administration 2 The cells were cultured in the cell culture incubator for 24 h, and then the MMT cell viability test was performed, and the absorbance OD value was read at 490 nm. The cell survival rate was calculated, and only cell culture medium was added to the blank wells.

[0102] (4) Cell proliferation detection: adjust to a certain cell density, re-spread 3 96-well plates and add 3 sea cucumber peptide sample concentrations with cell viability of the same group ≥ 90%. After adding samples, place in an incubator and culture for 0h, 24h, and 48h.

[0103] 2) Experimental results:

[0104] (1) Cell viability (%) = sample group OD 490 / Negative control group OD 490 ×100%

[0105] (2) Relative cell proliferation rate (%) = sample group OD 490 / Negative control group OD 490 ×100%

[0106] (3) Cell viability detection is shown in Table 5.

[0107] Table 5 shows the results of cell viability test.

[0108]

[0109] The purpose of testing cell viability is to model the effect of drug administration on cell viability and to determine the accuracy and rationality of subsequent cell proliferation.

[0110] (4) Cell proliferation detection see Table 6

[0111] Table 6 Cell relative proliferation rate test results

[0112]

[0113] Summary: Under the experimental conditions, the sea cucumber peptide sample acted on human keratinocytes. At a concentration of 0.300%, the relative cell proliferation rates at 0h, 24h, and 48h reached 124.32% + 3.31%, 198.65% ± 3.45%, and 881.76% ± 6.69%, respectively; at a concentration of 0.110%, the relative cell proliferation rates at 0h, 24h, and 48h reached 126.35% ± 3.31%, respectively. %, 197.97%±8.33%, 818.24%±13.78%; at 0.050% concentration, the relative cell proliferation rates at 0h, 24h, and 48h reached 121.62%±3.82%, 155.41%±9.98%, and 647.30%±18.80%, respectively; at 0.300% and 0.110% concentrations, the average relative cell proliferation rates at 24h and 48h were higher than those in the positive control group. Compared with the negative control group, the P value was <0.05, which was significantly different, indicating that the sea cucumber peptide sample in this test system has a growth-promoting effect on Hacat cells and has a repairing effect.

[0114] Example 4: Detection of the soothing effect of sea cucumber peptides

[0115] Soothing effect testing principle:

[0116] Based on the release of inflammatory mediators: After keratinocytes are irradiated with UV, they can activate cellular inflammatory responses, including activation of arachidonic acid metabolism, secretion of cytokines, etc. PGE2 is a typical metabolite of arachidonic acid, and IL-1α is an important cytokine in the early stage of inflammatory response. By detecting the release of IL-1α and PGE2, the inflammatory response of keratinocytes can be reflected, thereby evaluating the soothing effect of the sea cucumber peptide sample. The amino acid sequence of the sea cucumber peptide in this embodiment is shown in SEQ ID NO.2.

[0117] 1) Test methods

[0118] 1. Cytotoxicity assay

[0119] Under sterile conditions, the sea cucumber peptide samples were prepared and diluted to 5%, 2%, 1%, 0.5%, 0.2%, 0.1%, 0.05%, 0.02% (w / v) in serum-free medium and stored at 4° C. Cytotoxicity detection grouping and detection indexes are shown in Table 7.

[0120] HaCaT was inoculated in a 96-well plate and cultured in an atmosphere of saturated humidity and 5% CO 2 , and culture at 37°C. When the cell density reaches about 50%, add the sample.

[0121] Table 7 Cytotoxicity detection groups and detection indicators

[0122]

[0123] After 24 hours of sample addition, the cell metabolic activity was detected by CCK-8 method, and the cell survival rate was calculated according to the following formula. The concentration with a cell survival rate ≥ 90% was selected as the subsequent detection concentration.

[0124]

[0125] 2. Detection of IL-1α and PGE2 inflammatory mediator release

[0126] HaCaT cells were seeded in 24-well plates under saturated humidity and 5% CO 2 , 37°C. The next day, samples were added according to the table below, and UVB irradiation was performed 4 hours later, with an irradiation dose of 80 mJ / cm 2 After UVB irradiation, each well was replaced with fresh medium containing the test substance, saturated humidity, 5% CO 2 , and cultured at 37°C for 20 h. The groups for the soothing efficacy experiment are shown in Table 8.

[0127] Table 8 Soothing effect experimental grouping

[0128]

[0129] At the end of the time action period, the culture supernatant of each well was collected, and after centrifugation, the IL-1α and PGE2 contents in the supernatant were detected according to the instructions of the ELISA kit, and the inhibition rate of inflammatory mediators was calculated.

[0130] II) Experimental results

[0131] 1. Cytotoxicity test results are shown in Table 9

[0132] Table 9 Cytotoxicity test results

[0133] OD450 Cell viability 5％ 0.422±0.010 37.1％±0.9％ 2％ 0.667±0.029 58.6％±2.5％ 1％ 0.762±0.081 67.0％±7.2％ 0.5％ 0.870±0.026 76.5％±2.3％ 0.2％ 0.970±0.084 85.2％±7.4％ 0.1％ 1.114±0.083 97.9％±7.3％ 0.05％ 1.265±0.052 111.2％±4.6％ 0.02％ 1.185±0.037 104.2％±3.2％ Blank control group 1.137±0.018 100.0％±1.5％

[0134] 2. Soothing effect detection---release of inflammatory mediators

[0135] 2.1 The test results of IL-1α release are shown in Table 10

[0136] Table 10 is the detection results of IL-1α release in this example

[0137]

[0138] ##: compared with the blank control group, P<0.01, **: compared with the UV irradiation group, P<0.01.

[0139] Summary: Compared with the UV irradiation group, the sea cucumber peptide samples with concentrations of 0.1%, 0.05% and 0.02% (w / v) can significantly inhibit the release of IL-la caused by UV irradiation (P<0.01), among which the inhibition rate of the sea cucumber peptide sample with a concentration of 0.1% (w / v) on the release of IL-la is 64.6%±1.3%, the inhibition rate of the sea cucumber peptide sample with a concentration of 0.05% (w / v) is 57.5%±0.7%, and the inhibition rate of the sea cucumber peptide sample with a concentration of 0.02% (w / v) is 42.6%±0.9%.

[0140] 2.2PEG2 release test results are shown in Table 11

[0141] Table 11 is the PEG2 release test results

[0142] PEG2 release (pg / mL) PEG2 inhibition rate Blank control group 53.89±8.93 / UV irradiation group 142.42±10.21## / Sea cucumber peptide sample~0.1% 94.13±10.63** 33.9％±7.5％ Sea cucumber peptide sample~0.05% 109.86±13.81** 22.9％±9.7％ Sea cucumber peptide sample~0.02% 114.51±20.30* 19.6％±14.3％ Positive control group 81.09±7.23** 43.1％±5.1％

[0143] ##: compared with the blank control group, P<0.01; *: compared with the UV irradiation group, P<0.05; **: compared with the UV irradiation group, P<0.01.

[0144] Summary: Compared with the UV irradiation group, 0.1% and 0.05% (w / v) sea cucumber peptide samples can significantly inhibit the release of PGE2 caused by UV irradiation (P<0.01), and 0.02% (w / v) sea cucumber peptide samples can significantly inhibit the release of PGE2 caused by UV irradiation (P<0.05). Among them, the inhibition rate of 0.1% (w / v) sea cucumber peptide sample on PGE2 is 33.9%±7.5%, the inhibition rate of 0.05% (w / v) sea cucumber peptide sample is 22.9%±9.7%, and the inhibition rate of 0.02% (w / v) sea cucumber peptide sample is 19.6%±14.3%.

[0145] Example 5 Preparation of recombinant sea cucumber peptide

[0146] In this embodiment, five strains are constructed, wherein the amino acid sequence of the first strain is SEQ ID NO.1, the amino acid sequence of the second strain is SEQ ID NO.2, the amino acid sequence of the third strain is SEQ ID NO.3, the amino acid sequence of the fourth strain is SEQ ID NO.4, and the amino acid sequence of the fifth strain is SEQ ID NO.5. The methods for constructing these five strains are relatively similar, and the second strain is now described in detail, and the other strains are not described in detail.

[0147] The amino acid sequence of the recombinant sea cucumber peptide in this example is SEQ ID NO. 2. The following specifically describes the steps for synthesizing the recombinant sea cucumber peptide using genetically engineered bacteria.

[0148] 1. Synthesis of plasmid

[0149] The amino acids of the above Shanghai ginseng peptide were reverse translated and optimized according to the preference of Pichia pastoris codons. The nucleotide sequence was SEQ ID NO.7. The receptor was Pichia pastoris GS115, the vector was pPIC9K, the restriction sites were EcoRI and NotI, and the plasmid was commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis. The plasmid structure is shown in Figure 3 .

[0150] 2. Linearization of plasmid

[0151] 1) Prepare the vector enzyme digestion system according to Table 12;

[0152] 2) Enzyme digestion at 37℃ overnight;

[0153] 3) Agarose gel electrophoresis detection, using the undigested plasmid as a control;

[0154] 4) After successful enzyme digestion, inactivate at 65°C for 20 min.

[0155] Table 12

[0156]

[0157] 3. Linearized plasmid purification and recovery

[0158] 1) Prepare the vector purification system according to Table 13;

[0159] Table 13

[0160]

[0161] 2) Stand at -20℃ for more than 35 minutes;

[0162] 3) Centrifuge at 12000 rpm for 15 min at 4°C and discard the supernatant. A white precipitate can be observed on the wall.

[0163] 4) Add 400 μl of pre-cooled 80% ethanol to resuspend the precipitate;

[0164] 5) Centrifuge at 12000 rpm for 10 min at 4°C, discard the supernatant, and dry the tube;

[0165] 6) Add 10 μl ddHO 2 O dissolves the precipitate.

[0166] 4. Preparation of GS115 sea cucumber peptide

[0167] 1) Streak the strain onto a YPD plate and culture at 30°C for 3-5 days until a single colony grows;

[0168] 2) Pick a single clone and transfer it to 10 mL YPD culture medium (125 mL conical flask), and culture at 30°C and 300 rpm for 1-2 days;

[0169] 3) Transfer to 100 mL YPD culture medium, with an initial bacterial concentration of OD600 = 0.2, and culture at 30°C and 300 rpm for 1-2 days until OD600 = 1.3-1.5; (Note: When the OD value cannot be determined, transfer to different concentrations for culture)

[0170] 4) Centrifuge at 1500g for 5 min at 4°C to collect the bacterial strains, and add 250 mL of pre-cooled sterile water to resuspend the bacterial strains to wash the bacterial strains;

[0171] 5) Centrifuge at 1500g for 5 min at 4°C to collect the bacteria (adjust the deceleration damping to greater than 6), add 10 mL of pre-cooled 1 M sorbitol to resuspend the bacteria, and gently pipette during resuspending;

[0172] 6) Collect the culture by centrifugation at 1500g and 4℃ for 5 min (adjust the deceleration damping to greater than 6), add 300μl pre-cooled 1M sorbitol to resuspend the culture, gently blow during resuspending, the final volume of the culture is about 500μl (in actual operation, the final volume of the culture is about 700μl), divide into 100μl per tube, and place on ice for electroporation.

[0173] 5. Electrical conversion

[0174] 1) Take 80 μl of competent cells, add 6 ug of linearized pPIC9K, mix well and transfer to a pre-cooled 0.2 cm electroporation cuvette;

[0175] 2) Place on ice for 5 minutes;

[0176] 3) Electric shock according to the yeast electric shock parameters (1.5kV, 25uF, 200Ω);

[0177] 4) Immediately add 2 ml of pre-cooled 1 M sorbitol + HEPES (10 ml 1 M sorbitol + 100 μl 2 M HEPES, pH = 8.0) and transfer to a 2 ml sterile centrifuge tube;

[0178] 5) Incubate at 30°C for 1-2 hours;

[0179] 6) After diluting 5-fold, 10-fold, and 100-fold, 300 μl / plate was spread on a 15 cm YPD plate containing 100 mg / l Zeocin, and cultured at 30°C until clones grew.

[0180] 6. Positive clone screening

[0181] 1) Use a 10 μl pipette tip to streak the clones grown on the MD plate onto a 0.5 mg / mL G418 plate and culture at 30°C for 3-5 days;

[0182] 2) Select clones with better growth and streak them onto 2 mg / mL and 4 mg / mL G418 plates at the same time, and culture at 30°C for 3-5 days;

[0183] 3) Try to select 5 clones that grow better on the 4 mg / mL G418 plate to try to induce expression. If the growth on the 4 mg / mL plate is poor, select the clones on the 2 mg / mL plate.

[0184] 7. Transformant expression test

[0185] 1) Prepare 7 50 ml conical flasks, add 5 ml YPG medium to each, inoculate the above verified clones respectively, and culture at 30°C and 220 rpm for 1-2 days until the bacterial solution is saturated;

[0186] 2) Transfer to a 50 ml centrifuge tube, centrifuge at 4000 rpm for 5 min, and discard the supernatant;

[0187] 3) Resuspend the cells in 5 ml BMMY medium, transfer to a new sterile 50 ml conical flask, add methanol to a final concentration of 0.5%, and culture at 28°C and 220 rpm for 6 days;

[0188] 4) Methanol was added every 24 h (final concentration was 0.5%);

[0189] 5) On the morning of the 6th day, the bacterial culture was collected, centrifuged at 4000 rpm for 5 min, and the supernatant was collected;

[0190] 6) Screen the strain with ideal expression and preserve the glycerol bacteria (the ratio of bacterial liquid to 20% glycerol is 1:1).

[0191] 8. Expression

[0192] 1) 10L fermentation tank, the culture medium is BSM medium, prepared as follows:

[0193] Fermentation medium: including 85% phosphoric acid 26.7ml / L, KOH 18.2g / L, CaSO 4 ·2H 2 O1.18g / L, K 2 SO 4 18.2g / L, MgSO 4 7H 2 O 14.9g / L, glycerol 40g / L; after the fermentation medium is sterilized at high temperature, wait for the temperature to drop to room temperature, add PTM1, and adjust the pH to 5.0 with ammonia water.

[0194] Feed medium: 50% W / V glycerol, plus 12 mL PTM1 trace elements per liter;

[0195] Induction medium: 100% methanol, plus 12mL PTM1 trace elements per liter.

[0196] 2) Fermentation control: liquid volume 5L, temperature controlled at 28°C, dissolved oxygen controlled to be greater than 30% by stirring speed and air flow, maximum stirring speed 800rpm, maximum air flow controlled at 6L / min.

[0197] 3) Induction: Control the wet weight of the bacteria to about 150 g / L for induction, first starve for 0.5-1 h, then induce with methanol, add methanol intermittently, control the methanol concentration to 0.5-1% for induction, and induce for 90-120 h.

[0198] 9. Purification

[0199] 1) After the fermentation, solid-liquid separation was performed by centrifugation at 6000 rpm for 10 min, and the supernatant was collected.

[0200] 2) Ultrafiltration desalination: use an organic membrane with a molecular weight of 500Da for ultrafiltration desalination.

[0201] 3) Ion chromatography, protein PI = 4.1, select Q BB column, buffer A: 50 mM phosphate buffer, pH = 7; buffer B: 50 mM phosphate buffer + 1 M sodium chloride, pH = 7;

[0202] 4) Ultrafiltration desalination: use an organic membrane with a molecular weight of 500Da for ultrafiltration desalination.

[0203] 5) Freeze-drying.

[0204] Example 6: Preparation of a soothing and repairing essence lotion:

[0205] Mix evenly in a reaction kettle according to the formula in Table 14 to obtain the soothing and repairing essence lotion.

[0206] Table 14 is the formula of the soothing repair essence lotion

[0207]

[0208] We recruited 30 to 60-year-olds with facial skin that meets the requirement of Tewl>15g / h / m 2, stratum corneum moisture content <50 (Corneometer Unit, CU) and facial skin redness, 6 healthy male subjects and 25 female subjects, used the soothing repair essence milk of this embodiment for 28 consecutive days. The specific method of use is to take a small amount of the product of the size of a broad bean and apply it evenly on the face several times after cleansing and toning, and pat and press until absorbed. It can be applied in spots or thickly on sensitive and uncomfortable parts of the skin. Use it once a day, and evaluate the moisturizing, repairing, soothing, and sensitive skin applicability of the cosmetics by testing the changes in the stratum corneum moisture content, transepidermal water loss rate, and red zone a value of the subjects before and after 28 days of use of the soothing repair essence milk.

[0209] The moisture content of the stratum corneum was measured on the cheeks of the subjects using a skin moisture tester, Probe Corneometer CM825 (CK, Germany). The higher the test value, the more hydrated the skin.

[0210] The transepidermal water loss rate of the skin was tested on the cheeks of the subjects using the transepidermal water loss TEWL and water evaporation heat loss test probe ProbeTewameter TM Hex (CK, Germany). The lower the test value, the better the skin barrier function.

[0211] The red zone a value was tested on the cheeks of the subjects using the facial image analyzer VISIA (CaNFIELD, USA). The higher the test value, the more severe the skin inflammation.

[0212] During the test, the instrument testing phase should be carried out under the environmental conditions of 21±1℃ and 50±10%RH, and all subjects should sit still and balance for at least 30 minutes under this environmental condition before starting the evaluation and testing. Figure 4-Figure 6 .

[0213] Summary: Figure 4 It can be seen that after using the test product continuously for 28 days, the moisture content of the subjects' skin stratum corneum increased significantly compared with the baseline value (P≤0.001). After using the test product continuously for 28 days, the change rate of the moisture content of the subjects' skin stratum corneum compared with the baseline value was 29.04%.

[0214] Depend on Figure 5 It can be seen that after using the test product continuously for 28 days, the subjects' transepidermal water loss rate was significantly decreased compared with the baseline value (P≤0.001). After using the test product continuously for 28 days, the change rate of the subjects' transepidermal water loss rate compared with the baseline value was -10.14%.

[0215] Depend on Figure 6It can be seen that after 28 days of continuous use of the test product, the a value of the red area of the subjects decreased significantly compared with the baseline value (0.01 < P ≤ 0.05), and the change rate of the a value of the red area of the subjects after 28 days of continuous use of the test product compared with the baseline value was -7.05%.

[0216] Although the embodiments of the present application have been described above, the present application is not limited to the above specific embodiments and application fields. The above specific embodiments are merely illustrative and guiding, rather than restrictive. Those of ordinary skill in the art can also make many forms under the inspiration of this specification and without departing from the scope protected by the claims of the present application, and these all belong to the scope of protection of the present application.

Claims

1. A polypeptide having a repairing effect, wherein: The polypeptide has the following amino acid sequence: (IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK) n , n is 1 or 2.

2. The polypeptide according to claim 1, wherein The amino acid sequence of the polypeptide is SEQ ID NO. 2, and the SEQ ID NO. 2 is (IINEPTAAALAYGLDKKGHYTEGAELVDSVLDVVRK)2.

3. The polypeptide according to claim 1 or 2, wherein The polypeptide is derived from sea cucumber.

4. A method for preparing a polypeptide, wherein: The polypeptide is the polypeptide according to claim 1 or 2; The polypeptide is obtained by expressing and purifying Pichia pastoris, and the Pichia pastoris carries an expression vector having the nucleic acid sequence of the polypeptide.

5. The method according to claim 4, wherein: The Pichia pastoris is Pichia pastoris GS115.

6. The method according to claim 5, wherein: The expression vector is pPIC9K.

7. Use of the polypeptide according to any one of claims 1 to 3 or the polypeptide prepared by the method according to any one of claims 4 to 6 in the preparation of cosmetics.

8. A cosmetic comprising the polypeptide according to any one of claims 1 to 3 or a polypeptide prepared by the method according to any one of claims 4 to 6.

Images