An oleanolic acid-producing industrial hemp endophytic fungus HSDMZ07 and its application

Abstract

An oleanolic acid-producing industrial hemp endophyte fungus, HSDMZ07, and its applications relate to the field of microbiology. This fungus, belonging to the genus Fusarium, has been deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, on June 17, 2024, with a deposit number of CCTCC NO: M20241243. This fungus, HSDMZ07, can ferment to produce oleanolic acid and exhibits good antibacterial activity, showing some inhibitory effects against Escherichia coli, Klebsiella pneumoniae, and Enterococcus faecalis. The present invention is used for both antibacterial and oleanolic acid production.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and in particular to an oleanolic acid-producing industrial hemp endophytic fungus HSDMZ07 and applications thereof. Background Art

[0002] Oleanolic acid, a natural pentacyclic triterpenoid compound, is widely used in the treatment of liver diseases due to its significant hepatoprotective properties and is an important raw material for the production of hepatoprotective drugs. Oleanolic acid also has anti-inflammatory, antioxidant, lipid-lowering, blood sugar-regulating, antibacterial, antiviral, and anti-tumor properties.

[0003] Oleanolic acid exists in various plants as a free form and as a glycoside. Its production is primarily based on plant extraction, but the oleanolic acid content in plant raw materials is low, typically 0.2% to 2%, failing to meet market demand. Compared to plant extraction, microbial fermentation offers numerous advantages in producing natural compounds, including a shorter production cycle and the absence of plant raw material consumption. Summary of the Invention

[0004] The present invention aims to solve the problem that the existing plant extraction method of oleanolic acid has low yield and cannot meet market demand, and provides an industrial hemp endophytic fungus HSDMZ07 that produces oleanolic acid and its application.

[0005] The present invention provides an oleanolic acid-producing industrial hemp endophytic fungus HSDMZ07, which is a Fusarium sp. HSDMZ07 and has been deposited in the China Center for Type Culture Collection at Wuhan University in Wuhan on June 17, 2024, with a deposit number of CCTCC NO: M 20241243.

[0006] The colony center of the industrial hemp endophytic fungus HSDMZ07 of the present invention is yellow, the hyphae are dense and velvety, and the matrix is ​​white.

[0007] The ITS rDNA sequence of the industrial hemp endophyte HSDMZ07 of the present invention was subjected to a Blast homology comparison in GenBank, and then the strain sequences with the highest homology to the industrial hemp endophyte HSDMZ07 sequence were analyzed using MEGA 7 software. The sequence of the industrial hemp endophyte HSDMZ07 strain showed 100% similarity to Fusarium incarnatum (OM955964), and therefore the HSDMZ07 strain was identified as a Fusarium sp.

[0008] The invention discloses an application of the industrial hemp endophytic fungus HSDMZ07 in producing oleanolic acid by fermentation.

[0009] The invention discloses an application of the industrial hemp endophytic fungus HSDMZ07 in inhibiting bacteria.

[0010] Furthermore, the bacteria are Escherichia coli, Klebsiella pneumoniae and Enterococcus faecalis.

[0011] Beneficial effects of the present invention:

[0012] The present invention isolated an endophytic fungus strain, HSDMZ07, from industrial hemp and identified as Fusarium sp. This strain can ferment to produce oleanolic acid. Due to its high yield, low byproducts, minimal pollution, short production cycle, and relatively simple product separation, it has broad application prospects in industrial production.

[0013] The industrial hemp endophytic fungus HSDMZ07 of the present invention has good antibacterial activity and has a certain inhibitory effect on Escherichia coli, Klebsiella pneumoniae and Enterococcus faecalis. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a colony morphology diagram of the industrial hemp endophytic fungus HSDMZ07 of the present invention;

[0015] Figure 2 This is a mycelial morphology diagram of the industrial hemp endophytic fungus HSDMZ07 of the present invention;

[0016] Figure 3 This is the phylogenetic tree of the industrial hemp endophytic fungus HSDMZ07 of the present invention;

[0017] Figure 4 This is the total ion chromatogram of secondary metabolites in the fermentation broth of endophytic fungus HSDMZ07 by UPLC-QTOF-MS;

[0018] Figure 5 This is the UPLC-QTOF-MS primary mass spectrum of the fermentation broth of endophytic fungus HSDMZ07;

[0019] Figure 6 This is the UPLC-QTOF-MS secondary mass spectrum of the fermentation broth of endophytic fungus HSDMZ07;

[0020] Figure 7 This is the HPLC chromatogram of the ethyl acetate extraction part of the endophytic fungus HSDMZ07. DETAILED DESCRIPTION

[0021] The following embodiments of the present invention are described in detail. The following embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation plans and specific operating processes are given, but the protection scope of the present invention is not limited to the following embodiments.

[0022] Example 1:

[0023] The industrial hemp endophytic fungus HSDMZ07 in this embodiment is Fusarium sp. HSDMZ07, which has been deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, the deposit date is June 17, 2024, and the deposit number is CCTCC NO: M 20241243.

[0024] The method for obtaining the industrial hemp endophytic fungus HSDMZ07 in this embodiment is as follows:

[0025] Industrial hemp (Cannabis sativa L.) leaves (Longma No. 5, collected from the Science and Technology Innovation Farm of Suihua Branch of Heilongjiang Academy of Agricultural Sciences) were taken and surface disinfected. The disinfection procedure was as follows: the seeds were soaked in 75% alcohol for 30 seconds, washed with sterile water, then rinsed in sodium hypochlorite for 5 minutes, washed with sterile water, then soaked in 75% alcohol for 30 seconds, and finally washed with sterile water.

[0026] Use a sterile scalpel to cut the sterilized experimental materials into small square pieces with a side length of 5 mm, place them in PDA culture medium, and culture them at a constant temperature of 28°C for 5 to 7 days.

[0027] The final wash solution from the sterilization procedure was removed and inoculated into PDA culture medium. The sterilized, uncut experimental material was placed on the PDA culture medium, rolled once, and then removed and incubated with the endophytic fungus isolation medium as a control.

[0028] Preparation of potato solid culture medium (PDA): Weigh 200 g of freshly peeled potato chunks and place them in boiling water. Keep boiling for 30 minutes, filter, and add 20 g of glucose and 20 g of agar powder as specified in the formula to the filtrate. After they are completely dissolved, add water to make up the total volume of the culture medium to 1 L. Adjust the pH to natural, aliquot, sterilize (121°C, 0.1 MPa, 30 minutes), and let cool for later use.

[0029] The endophytic fungus HSDMZ07 was isolated from industrial hemp leaves. No bacteria grew in the negative control plates and negative control liquid culture medium, and this was repeated many times, thus proving that the isolated bacteria were endophytic fungi of industrial hemp.

[0030] Example 2: Identification of industrial hemp endophyte HSDMZ07

[0031] The strains were identified by colony and spore morphology observation and ITS sequence analysis.

[0032] The colony morphology of industrial hemp endophytic fungus HSDMZ07 is shown in the figure Figure 1 As shown in the figure, the mycelial morphology is as follows Figure 2As shown in the figure, the colony center of the industrial hemp endophytic fungus HSDMZ07 is yellow, the hyphae are dense and velvety, and the matrix is ​​white.

[0033] The ITS rDNA sequence (549 bp) of the industrial hemp endophytic fungus HSDMZ07 of the present invention was subjected to Blast homology alignment in GenBank, and then the phylogenetic tree of the industrial hemp endophytic fungus HSDMZ07 was constructed using MEGA 7 software, as shown in FIG. Figure 3 The sequence of HSDMZ07 strain was 100% similar to that of Fusarium incarnatum (OM955964), so HSDMZ07 strain was identified as Fusarium sp.

[0034] The ITS rDNA sequence of the industrial hemp endophytic fungus HSDMZ07 is as follows:

[0035] TCCGTAGGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTATAC

[0036] GTTGCCTCGGCGGATCAGCCCGCGCCCCGTAACAAGGGACGGCCCGCCCGAGGACCCCTAAACTCTGTTTTTAGTGG

[0037] AACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC

[0038] AGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAG

[0039] TATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTGTTGGGACTCGCGGTAACCCG

[0040] CGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCG

[0041] CGGCCACGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC

[0042] AATAAGCCGGAGGAA.

[0043] Example 3: Analysis of secondary metabolites in fermentation broth of industrial hemp endophytic fungus HSDMZ07

[0044] 1. Preparation of test solution

[0045] Take the activated endophytic fungus HSDMZ07, pick the mycelium under sterile conditions and inoculate it into 50 mL PDB medium, shake and culture it at 28 ° C and 120 r / min for 3 days to make 1×10 7 CFU / mL seed liquid; the seed liquid was transferred to 3 L sterilized PDB medium at a 20% (v / v) inoculation amount, and cultured in a shaking incubator at 28°C and 120 r / min for 14 days. The fermentation broth was filtered and concentrated under reduced pressure at 50°C. The concentrated fermentation broth was extracted 3 times with ethyl acetate (3×100 mL), the extracts were combined, concentrated to dryness at 50°C, and dissolved in 1 mL of methanol as the test solution for later use.

[0046] 2. Preparation of industrial hemp leaf extract

[0047] Accurately weigh 5g of industrial hemp leaves, crush them, add 95% ethanol at a solid-liquid ratio of 1:50, perform ultrasonic extraction (50°C, 3×250mL), filter, combine the extracts, concentrate under reduced pressure at 50°C to 100mL, and extract with ethyl acetate (3×100mL) to obtain the extract. Combine the ethyl acetate extracts, concentrate under reduced pressure to dryness, dissolve in 1mL of chromatographic methanol, and set aside.

[0048] 3. Preparation of reference solution

[0049] Accurately weigh 0.5 mg of oleanolic acid reference substance, place it in a 1 mL centrifuge tube, add 1 mL of chromatographic methanol to dissolve it, and prepare the reference substance solution for later use.

[0050] Take 300 mL of PDB culture medium and concentrate it under reduced pressure at 50°C. Extract the concentrated PDB culture medium with ethyl acetate three times (3×100 mL). Combine the extracts, concentrate to dryness at 50°C, and dissolve it in 1 mL of methanol as a blank control solution for later use.

[0051] 4. Analysis of secondary metabolites in HSDMZ07 fermentation broth by UPLC-QTOF-MS

[0052] The test samples were analyzed by UPLC-QTOF-MS under the following conditions:

[0053] Liquid phase conditions: chromatographic column is Waters BEH C 18 Column (2.1×100 mm, 1.7 μm); column temperature: 35°C; injection volume: 10 μL.

[0054] Mass spectrometry conditions: positive ion spray ionization (ESI) mode, ion spray voltage: 5000 V (positive ion mode); temperature: 500°C; ion source gas pressure: 50 psi; curtain gas flow: 35 L / min; declustering potential: 80 V; collision energy: 35 eV; collision energy spread (CES): ±15 eV. The mass spectrometer was operated in full-scan TOF-MS mode with an m / z range of 100 to 1000 and MS / MS (50 to 1000) mode.

[0055] Based on the precise relative molecular mass and fragment ion information provided by high-resolution mass spectrometry, the secondary metabolites of HSDMZ07 fermentation broth were analyzed in combination with the UPLC-MS / MS detection platform, a self-built database, and relevant literature reports.

[0056] 5. Analysis of secondary metabolites in HSDMZ07 fermentation broth by HPLC

[0057] Chromatographic column: Venusil XBP-C 18 Column (4.6 mm × 250 mm, 5 μm, USA) Mobile phase: methanol-water-glacial acetic acid (90:10:0.2); Flow rate: 1 mL min -1 ; Column temperature: 25℃; Detection wavelength: 245nm; Injection volume: 10μL.

[0058] 6. Analysis results of secondary metabolites of endophytic fungus HSDMZ07 fermentation broth

[0059] The results of UPLC-QTOF-MS analysis of secondary metabolites in the fermentation broth of endophytic fungus HSDMZ07 are as follows: Figure 4-Figure 6 shown. Figure 4 This is the total ion current of HSDMZ07 fermentation broth UPLC-QTOF-MS. Figure 5 This is the UPLC-QTOF-MS primary mass spectrum of HSDMZ07 fermentation broth. Figure 6 The UPLC-QTOF-MS secondary mass spectrum of HSDMZ07 fermentation broth shows that positive ionization and quasi-molecular ion [M+1] were detected in the fermentation broth of endophytic fungus HSDMZ07. + :m / z457.34,oleanolic acid molecular weight M:456.7,C 30 H 48 O3.

[0060] Based on the results of UPLC-QTOF-MS analysis, the fermentation broth of endophytic fungus HSDMZ07 was analyzed by HPLC. Figure 7 , Figure 7 A is the ethyl acetate extraction sample of HSDMZ07, B is the oleanolic acid reference substance, and C is the PDB blank control. Figure 7 It can be seen that in the ethyl acetate extraction part of the fermentation broth of the industrial hemp endophytic fungus HSDMZ07, there is a chromatographic peak with the same retention time as the oleanolic acid reference substance, and there is no interference in the negative (blank PDB culture medium), indicating that oleanolic acid exists in the ethyl acetate extraction part.

[0061] Example 4: Analysis of antibacterial activity of endophytic fungus HSDMZ07

[0062] 1. Activation of endophytic fungus HSDMZ07: Take endophytic fungus HSDMZ07 and inoculate it onto the test surface containing PDA culture medium under sterile conditions. Culture it at a constant temperature of 28°C for 3 days and set aside.

[0063] 2. Preparation of fermentation broth of endophytic fungus HSDMZ07: Take the activated endophytic fungus HSDMZ07, pick the mycelium under sterile conditions and inoculate it into 50 mL PDB medium, and culture it in a shaker at 28°C and 120 rpm for 3 days to make 1×10 7 CFU / mL seed liquid; the seed liquid was transferred to 3 L of sterilized PDB medium at a 20% (v / v) inoculation volume, cultured in a shaking incubator at 28°C and 120 r / min for 14 days, and the fermentation liquid was filtered.

[0064] 3. Preparation of test solution: Take the fermentation broth of endophytic fungus HSDMZ07 and concentrate it under reduced pressure to 50 mL at 50°C. Add 50 mL of methanol and perform ultrasonic extraction three times to obtain the extract. Concentrate it under reduced pressure to dryness and dissolve it in 10 mL of methanol. This is used as the test solution. Take appropriate amounts of streptomycin and nystatin powders and dissolve them in appropriate amounts of methanol to prepare a 200 μg / mL positive control solution for later use.

[0065] 4. Preparation of plates containing test strains:

[0066] Activated test bacteria (Escherichia coli, Bacillus subtilis, Staphylococcus aureus, Bacillus pumilus, Pseudomonas aeruginosa, Listeria monocytogenes, Klebsiella pneumoniae, Acinetobacter baumannii, Enterococcus facalis, and Enterococcus faecium) were inoculated onto NA tube slants and cultured at 37°C for 1 day. Activated test fungi (Candida albicans) were inoculated onto PDA tube slants and cultured at 28°C for 3 days before use. These test strains were purchased from the Heilongjiang Institute of Microbiology.

[0067] Take the activated test strains mentioned above, add appropriate amount of sterile water, shake and dilute each strain to 1×10 7 Pour the bacterial suspension of 500 CFU / mL into the corresponding culture medium and dispense it into sterile plates with Oxford cups. After it solidifies, remove the Oxford cups and set aside.

[0068] 5. Antibacterial activity analysis:

[0069] Accurately add 150 μL of the test solution, positive control solution, and negative control solution to two wells of the prepared bacterial plates. Incubate the plates containing bacteria at a constant temperature (37°C, 1 day) and measure the diameter of the inhibition zone (n = 3). Incubate the plates containing fungi at a constant temperature (28°C, 3 days) and measure the diameter of the inhibition zone (n = 3).

[0070] The antibacterial activity of endophytic fungus HSDMZ07 is shown in Table 1. As can be seen from the results in Table 1, industrial hemp endophytic fungus HSDMZ07 has a certain inhibitory effect on Escherichia coli, Klebsiella pneumoniae and Enterococcus faecalis.

[0071] Table 1 Antibacterial activity results of industrial hemp endophytic fungus HSDMZ07 fermentation broth

[0072]

[0073] In Table 1, A: Escherichia coli; B: Bacillus subtilis; C: Staphylococcus aureus; D: Bacillus pumilus; E: Pseudomonas aeruginosa; F: Listeria monocytogenes; G: Klebsiella pneumoniae; H: Acinetobacter baumannii; I: Enterococcus faecium; J: Enterococcus faecalis; K: Candida albicans; Str: Streptomycin; Nys: Nystatin.

Claims

1. An oleanolic acid-producing industrial hemp endophyte fungus HSDMZ07, characterized by: The industrial hemp endophytic fungus HSDMZ07 is a Fusarium spp. Fusarium sp.) HSDMZ07, has been deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, the deposit date is June 17, 2024, and the deposit number is CCTCC NO: M 20241243.

2. Use of the industrial hemp endophytic fungus HSDMZ07 as claimed in claim 1 in fermentation to produce oleanolic acid.

3. Use of the industrial hemp endophytic fungus HSDMZ07 according to claim 1 in the preparation of an antibacterial drug; the bacteria are Escherichia coli, Klebsiella pneumoniae and Enterococcus faecalis.

Images