A Cas9 protein mutant and its application in gene editing technology

Abstract

The present invention provides a Cas9 protein mutant, a vector expressing the Cas9 protein mutant, and a method for gene editing using the vector. The Cas9 protein mutant provided by the present invention exhibits higher adaptability and gene editing efficiency than the wild type in Pichia pastoris, with a target gene editing probability exceeding 90%.

Description

Technical Field

[0001] The present invention discloses a protein mutant and gene editing technology. Background Art

[0002] Clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 (Cas9) is a highly efficient and precise gene-editing technology that can introduce base insertions, deletions, or substitutions at specific genomic sites, correcting harmful base mutations or disrupting disease-causing genes. Compared to two other base-level gene-editing technologies—zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs)—the CRISPR / Cas9 system is simpler to construct, more efficient, and less expensive. It can be used to program target genes simply by changing the targeting sequence of the guide RNA (gRNA). It has been widely used in cell genetic modification, animal model development, and high-throughput drug screening. The system consists of two components: the Cas9 protein, which cleaves nucleic acids, and the guide RNA (gRNA). Guided by the gRNA, Cas9 reaches the designated site and cleaves, thereby breaking the DNA strand and disrupting the gene. The CRISPR / Cas9 system requires a short guanine-rich sequence, the protospacer-adjacent motif (PAM), to participate in the recognition / cleavage activity, such as Streptococcus pyogenes Cas9 ( Streptococcus pyogenes The PAM sequence of Cas9 (SpCas9) is NGG.

[0003] The CRISPR / Cas9 system has been applied to a variety of organisms, but the natural Cas9 protein may have certain defects or toxic effects in different species. To achieve better species adaptability and better gene editing results, the Cas9 protein can be modified for different organisms to obtain a CRISPR / Cas9 system that is potentially more optimal for a particular species.

[0004] Pichia pastoris, as an emerging exogenous protein expression system following Saccharomyces cerevisiae, has been widely accepted for its advantages, including high protein expression levels, ease of isolation and purification, and glycosylation modifications more similar to those of higher organisms. The wild-type Cas9 sequence may not be able to achieve its optimal performance in Pichia pastoris. The purpose of the present invention is to provide a Pichia pastoris-adapted Cas9 mutant through error-prone PCR, and to construct a CRISPR / Cas9 gene editing system in Pichia pastoris based on this Cas9 mutant, providing a more optimal gene editing tool for precise gene manipulation based on Pichia pastoris. Summary of the Invention

[0005] Based on the above objectives, the present invention first provides a Cas9 protein mutant, which is a mutant having D276N, A421T, and A1184T in the sequence of SEQ ID NO.1. In the present invention, the mutant is named "Cas9M24".

[0006] Secondly, the present invention provides a polynucleotide encoding the above-mentioned Cas9 protein mutant. Based on the common sense of those skilled in the art, following the triplet code rules of protein coding, the same amino acid has different triplet nucleotide codes, so any polynucleotide that can encode the above-mentioned Cas9 protein mutant is within the scope of the polynucleotide defined by the present invention.

[0007] In a preferred embodiment, the sequence of the polynucleotide encoding the mutant having D276N, A421T, and A1184T is shown as SEQ ID NO.4.

[0008] Third, the present invention provides a vector for expressing the aforementioned Cas9 protein mutant, comprising the aforementioned polynucleotide encoding the aforementioned Cas9 protein mutant. In a specific embodiment of the present invention, the vector is pGAP. In the present invention, vectors containing the Cas9 protein encoding gene are collectively referred to as pGAP-Cas9s, including pGAP-Cas9 and pGAP-Cas9-M24.

[0009] Fourthly, the present invention provides a method for gene editing using the above-mentioned vector, the method comprising the following steps:

[0010] (1) transforming the above-mentioned vector expressing the Cas9 protein mutant into a host bacterium to obtain a recombinant host bacterium in which the vector is integrated into the genome;

[0011] (2) constructing a vector containing a gRNA targeting the target gene in the host bacterial genome in step (1), and transforming the vector into the recombinant host bacterial obtained in step (1);

[0012] (3) Cultivate the recombinant host bacteria obtained in step (2) and screen the target gene to obtain edited positive host bacteria.

[0013] In a preferred embodiment, the host bacteria in step (1) is yeast.

[0014] In a more preferred embodiment, the yeast is the yeast strain GS115.

[0015] In a specific embodiment of the present invention, the vector of the gRNA targeting the target gene in the host bacterial genome in step (2) is pTEF. The pTEF vector constructed in the present invention includes: PAS_ Chr4_0783 Gene, pTEF-GUT1-3 expression vector with PAM motif AGG, targeting the Pichia pastoris genome PAS_ Chr4_0783 Gene, pTEF-GUT1-2 expression vector with PAM motif TGG, targeting the Pichia pastoris genome PAS_chr1- 1_0483 Gene, pTEF-AC expression vector with PAM motif CGG, targeting Pichia pastoris genome PAS_chr1-4_0160 The pTEF-H1 expression vector contains a gene and a PAM motif of GGG. The pTEF vectors in the above technical solutions of the present invention are only used to verify the gene editing function of CRISPR-Cas9 protein mutants. Those skilled in the art can use other conventional gRNA vectors according to the target design principles and PAM sequence selection disclosed in the present invention to design corresponding gRNA targeting sequences to achieve site-specific deletion of target bases in target genes.

[0016] In a preferred embodiment, in step (2) of the above method, the PAM motif at the 3' end of the target gene is AGG or TGG.

[0017] In another preferred embodiment, the length of the gRNA target sequence in step (2) of the above method is 20 nt.

[0018] Finally, the present invention provides a gene editing kit, which includes a vector expressing the Cas9 protein mutant of the present invention and a vector containing gRNA targeting the target sequence of the target gene of interest to be edited.

[0019] The CRISPR-Cas9M24 protein mutant and the gene editing method using the mutant provided by the present invention are in Pichia pastoris. This Cas9 mutant shows better stability and compatibility. It can better adapt to the physiological environment of Pichia pastoris and work in conjunction with other biomolecules in the cell, thereby achieving more efficient gene editing. Although both wild-type CRISPR-Cas9 and CRISPR-Cas9M24 can cause base deletion or insertion in the target sequence. When the PAM motif is CGG and GGG, the gene editing efficiency of CRISPR-Cas9 and CRISPR-Cas9M24 is 90-100%. However, when the PAM motif is AGG and TGG, the gene editing efficiency of CRISPR-Cas9M24 is as high as 100%, which is 10% higher than that of CRISPR-Cas9. The above results show that the CRISPR-Cas9M24 system has less toxicity and inhibition to yeast cells and is more suitable for genetic engineering operations in yeast cells. It is also more suitable for site-directed editing of genes when the PAM motif is AGG and TGG.

[0020] Therefore, the excellent gene editing performance of the Cas9 mutant provided by the present invention in Pichia pastoris provides broad prospects for its application in the fields of biomanufacturing, metabolic engineering, drug development, etc. For example, the mutant can be used to precisely edit the metabolic pathways of Pichia pastoris to increase the yield of specific compounds or optimize production conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the pGAP-Cas9 vector structure;

[0022] Figure 2 pGAP-Cas9 plasmid enzyme digestion map and plasmid transformed strain PCR identification map, where A: pGAP-Cas9 Spe Ⅰ and Xho I: Agarose gel electrophoresis results after double enzyme digestion; B: Agarose gel electrophoresis results of colony PCR identification of positive clones after transformation of pGAP-Cas9 recombinant vectors carrying different Cas9 mutants;

[0023] Figure 3 Sequencing comparison of the Cas9M24 mutant and Cas9 sequences;

[0024] Figure 4 Colony PCR results of yeast strains transformed with pGAP-Cas9 and pGAP-Cas9M24 recombinant vectors.

[0025] Figure 5 Schematic diagram of the structures of four gRNA recombinant vectors targeting different PAM motifs

[0026] Figure 6 PCR identification results of colonies after transformation with four gRNA recombinant vectors targeting different PAM motifs;

[0027] Figure 7 Sanger sequencing peaks of pTEF-GUT1-3, pTEF-GUT1-2, pTEF-AC, and pTEF-H1 recombinant vectors;

[0028] Figure 8 Results of positive clone screening plates for four gRNAs with different PAM motifs introduced into CRISPR / Cas9 and CRISPR / Cas9-M24 strains.

[0029] Figure 9 Statistical analysis of the number of positive clones obtained after four different PAM motif gRNAs were introduced into CRISPR / Cas9 and CRISPR / Cas9-M24 strains (n=3).

[0030] Figure 10 Sanger sequencing analysis of four gRNAs with different PAM motifs after they were introduced into CRISPR-Cas9 and CRISPR-Cas9M24 strains. DETAILED DESCRIPTION

[0031] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0032] Example 1. Screening of Cas9 mutants

[0033] 1. Obtaining pGAP (commercially available)-Cas9 recombinant vectors, Cas9 variants, and cloning pGAP-Cas9 recombinant vectors carrying Cas9 variants

[0034] The amino acid sequence of the CRISPR-associated protein Cas9 from Streptococcus pyogenes was obtained from NCBI (SEQ ID NO.1, GenBank: KT031982.1), and the pGAP-Cas9 recombinant vector was a Cas9 expression vector ( Figure 1 ), which initiates the transcriptional expression of Cas9 through the GAP promoter. This vector contains an ampicillin sequence for the transformation and screening of prokaryotic bacteria. HISThe selection marker is used for transformation and selection of yeast strains. The NLS nuclear localization signal sequence (SEQ ID NO. 3, PKKKRKV) is incorporated into the C-terminus of the Cas9 coding sequence (SEQ ID NO. 2) to localize the expressed Cas9 to the cell nucleus for optimal gene editing activity. The above vector was synthesized by Beijing Sino-US Taihe Biotechnology Co., Ltd.

[0035] 2. Obtaining Cas9 variants and cloning pGAP-Cas9 recombinant vectors carrying Cas9 variants

[0036] Cas9 was randomly mutated using Biolabs' ready-to-use error-prone PCR kit (BTN101005) and the pGAP-Cas9 vector as a template.

[0037] Error-prone PCR system (50 μL): 3 μL of 10× error-prone PCR mix (including enzyme), 5 μL each of primers CAS9-F / CAS9-R (AACTATCAAAACACAACTAGTGGATCCCCCGGGAAAAATGGAC / TAATTACATGACTCGAGAAGAGATCACACCTTCCTCTTC), 3 μL of error-prone PCR enhancer, 3 μL of error-prone PCR dNTPs, 3 μL of error-prone PCR MnCl₂, and ultrapure water to 50 μL. Error-prone PCR system and procedure: 1 cycle of initial denaturation at 94°C for 3 min; 40 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min, and extension at 72°C for 4 min; and 1 cycle of final extension at 72°C for 7 min. The amplified Cas9 sequence was used as a template to repeat the error-prone PCR process to accumulate mutation sites. Finally, the amplified sequence was purified by agarose gel electrophoresis.

[0038] By restriction enzyme Spe Ⅰ and Xho Ⅰ Double enzyme digestion of pGAP-Cas9 vector, agarose gel electrophoresis results are as follows Figure 2As shown in Figure A, well 1 is the vector control without enzyme digestion, and well 2 is the vector after enzyme digestion. The band in well 2 shows that pGAP-Cas9 was successfully digested, of which the upper band does not contain the Cas9 fragment (5263 bp) and the lower band contains the Cas9 fragment (4168 bp). The fragment obtained by error-prone PCR amplification was connected with the recovered fragment of the upper band in well 2 by seamless cloning and transformed into Escherichia coli competent cells Top10. Finally, the positive clones were identified by primers GAP-F / CYC-R (CGTCGCTGGCAATAATAGCG / CCTTCCTTTTCGGTTAGAGC) and sequenced to obtain a series of pGAP-Cas9 recombinant vectors carrying Cas9 variants. The results of colony PCR positive clone identification (partial) are shown as follows Figure 2 As shown in Figure B, a band of the target size (4204 bp) was successfully amplified. One recombinant vector carrying the mutation sites D276N, A421T, and A1184T was named pGAP-Cas9M24. The Sanger sequencing results (SEQ ID NO. 4) were compared as shown in Figure 4. Figure 3 shown.

[0039] 3. Construction of Cas9 / GS115 recombinant strain

[0040] First, restriction enzyme Nhe I am HIS4 The pGAP-Cas9 recombinant vector and the pGAP-Cas9M24 recombinant vector were linearized on the element, and then the linearized vector was transformed into GS115 competent cells by electroporation. The linearized pGAP-Cas9 recombinant vector was integrated into the Pichia pastoris GS115 genome using the intracellular homologous end repair mechanism and cultured at 30°C for 2-3 days using MD solid medium. Six clones on the MD plate were selected, and the growing clones were identified by colony PCR using primers GAP-F / CYC-R: (CGTCGCTGGCAATAATAGCG / CCTTCCTTTTCGGTTAGAGC) and sequenced for confirmation. The agarose gel electrophoresis results are shown in Figure 2. Figure 4 As shown, the target size band (4414 bp) was amplified. In the present invention, the recombinant strain in which pGAP-Cas9 was integrated into the yeast strain was named CRISPR-Cas9, and the recombinant strain in which pGAP-Cas9M24 was integrated into the yeast strain was named CRISPR-Cas9M24.

[0041] Example 2. Functional evaluation of CRISPR-Cas9 and CRISPR-Cas9M24

[0042] To verify the gene editing function of CRISPR-Cas9 and CRISPR-Cas9M24, we constructed four gRNAs targeting different PAM motifs.

[0043] 1. gRNA recombinant vector cloning

[0044] pTEF (commercially available) is used as a gRNA expression vector and is maintained by our laboratory. This vector carries a bleomycin resistance gene for transformation and screening of prokaryotic bacteria and yeast strains. The gRNA expression cassette is transcribed by the TEF promoter, which contains restriction endonucleases. Afl Ⅱ is used to add 20nt target sequence and gRNA scaffold. The present invention selects four target sites from the Pichia pastoris genome for gRNA construction ( Figure 5 ) to verify the functionality of CRISPR-Cas9 and CRISPR-Cas9M24.

[0045] (1) pTEF-GUT1-3 expression vector: from the Pichia pastoris genome PAS_Chr4_0783 The gene selected a sequence with a PAM motif of AGG (GTTGTTTGGTCCAAGAAGAC 412-431 ) Primers GUT1-3-F / GUT1-3-R (AGGACGAAACGAGTAAGCTCGTCTCAGATC GTTGTTTGGTCCAAGAAGAC / ATTTTAACTTGCTATTTCTAGCTCTAAAAC GTCTTCTTGGACCAAACAAC) with homology arms at both ends of the pTEF vector and the target sequence were synthesized, and the target fragment was obtained by primer overlap extension PCR.

[0046] (2) pTEF-GUT1-2 expression vector: from the Pichia pastoris genome PAS_Chr4_0783 The gene selected a sequence with a PAM motif of TGG (TGCAATTTCCTCAGCCAGGC 239-256 ) Primers GUT1-2-F / GUT1-2-R (AGGACGAAACGAGTAAGCTCGTCTCAGATC TGCAATTTCCTCAGCCAGGC / ATTTTAACTTGCTATTTCTAGCTCTAAAAC GCCTGGCTGAGGAAATTGCA) with homology arms at both ends of the pTEF vector and the target sequence were synthesized, and the target fragment was obtained by primer overlap extension PCR.

[0047] (3) pTEF-AC expression vector: from the Pichia pastoris genome PAS_chr1-1_0483 The gene selects a sequence with a PAM motif of CGG (ACACAACACACACACATTAG2745-2764 ) Primers AC-F / AC-R (AGGACGAAACGAGTAAGCTCGTCTCAGATCACACAACACACACACATTAG / ATTTTAACTTGCTATTTCTAGCTCTAAAACCTAATGTGTGTGTGTTGTGT) with homology arms at both ends of the pTEF vector and the target sequence were synthesized, and the target fragment was obtained by primer overlap extension PCR.

[0048] (4) pTEF-H1 expression vector: from the Pichia pastoris genome PAS_chr1-4_0160 The gene selects a sequence with a PAM motif of GGG (GGCAGGAACACCCAGCATCA 1637-1656 ) Primers AC-F / AC-R (AGGACGAAACGAGTAAGCTCGTCTCAGATC GGCAGGAACACCCAGCATCA / ATTTTAACTTGCTATTTCTAGCTCTAAAAC TGATGCTGGGTGTTCCTGCC) with homology arms at both ends of the pTEF vector and the target sequence were synthesized, and the target fragment was obtained by primer overlap extension PCR.

[0049] pTEF vector is cleaved by restriction enzymes Afl Ⅱ was linearized and then purified and recovered. The four amplified fragments were seamlessly cloned with the linearized vector and transformed. The positive clones were identified and sequenced using primers gRNA-F / 3AOX (AGTAAGCTCGTCTCAGATCTTAAG / GCAAATGGCATTCTGACATCC) to obtain the correct recombinant vectors. The structural diagrams of pTEF-GUT1-3, pTEF-GUT1-2, pTEF-AC and pTEF-H1 are shown in the figure. Figure 5 Table 1 shows the gRNA target sequences and PAM sequences for four different PAM motifs, all of which are 20 nt in length.

[0050] Table 1. gRNA target sequences and PAM sequences

[0051]

[0052] Figure 6 This is the colony PCR identification image after the above four gRNA recombinant vectors were constructed and transformed. The band size is correct (245bp). The Sanger sequencing results are as follows Figure 7 As shown, the recombinant vectors pTEF-GUT1-3, pTEF-GUT1-2, pTEF-AC, and pTEF-H1 were successfully constructed.

[0053] 2. Functional Verification of CRISPR-Cas9 and CRISPR-Cas9M24

[0054] The four gRNAs were transferred into the recombinant strains containing CRISPR-Cas9 and CRISPR-Cas9M24 by electroporation, and positive clones were screened on YPDS Z+ solid plates. The growth of positive clones on the YPDS Z+ solid plates was photographed and counted. Figure 8 This is a typical plate screening clone diagram. Figure 9 Statistical analysis of the number of surviving positive clones. The above results show that compared with CRISPR-Cas9, the number of positive clones screened on YPDS Z+ solid plates increased by approximately 2-11 times after the CRISPR-Cas9M24 strain was transfected with the four gRNAs (560 vs 280, 2160 vs 188, 258 vs 65, 475 vs 268). This suggests that the gene editing system in the CRISPR-Cas9M24 strain may be more beneficial to yeast survival, meaning that the Cas9 protein mutant Cas9M24 may be less toxic to yeast.

[0055] Subsequently, we picked 10 single clones from the YPDS Z+ solid plates after the four gRNAs were transferred into CRISPR-Cas9 and CRISPR-Cas9M24 to amplify the target gene containing the target sequence and sent it for Sanger sequencing. The Sanger sequencing results are as follows Figure 10 As shown, both CRISPR-Cas9 and CRISPR-Cas9M24 can cause base deletions or insertions within the targeted sequence. When the PAM motifs are CGG and GGG, both CRISPR-Cas9 and CRISPR-Cas9M24 achieve gene editing efficiencies of 90-100%. When the PAM motifs are AGG and TGG, CRISPR-Cas9M24 achieves a gene editing efficiency of up to 100%, a 10% improvement over CRISPR-Cas9. In the case of TGG, CRISPR-Cas9M24 achieves a 20% higher deletion efficiency than CRISPR-Cas9 at the fourth base upstream of the 5' end of the PAM. These results demonstrate that the CRISPR-Cas9M24 system is less toxic and less inhibitory to yeast cells, making it more suitable for genetic engineering operations in yeast cells.

[0056] Therefore, this Cas9 mutant exhibits improved stability and compatibility within Pichia pastoris. It can better adapt to the physiological environment of Pichia pastoris and work synergistically with other biomolecules within the cell, achieving more efficient gene editing. The excellent performance of this Cas9 mutant in Pichia pastoris offers broad prospects for its application in biomanufacturing, metabolic engineering, drug discovery, and other fields. For example, this mutant can be used to precisely edit Pichia pastoris metabolic pathways to increase the yield of specific compounds or optimize production conditions.

Claims

1. A Cas9 protein mutant, characterized in that: The Cas9 protein mutant is a mutant having only D276N, A421T, and A1184T in the sequence of SEQ ID NO.

1.

2. A polynucleotide encoding the Cas9 protein mutant according to claim 1.

3. The polynucleotide according to claim 2, wherein The sequence of the polynucleotide is shown in SEQ ID NO.

4.

4. A vector expressing the Cas9 protein mutant according to claim 1, characterized in that: The vector contains the polynucleotide according to claim 2 or 3.

5. A method for gene editing using the vector according to claim 4, characterized in that: The method comprises the following steps: (1) Transforming the vector of claim 4 into a host bacterium to obtain a recombinant host bacterium in which the vector is integrated into its genome; (2) constructing a vector containing a gRNA targeting the target gene in the host bacterial genome in step (1), and transforming the vector into the recombinant host bacterial obtained in step (1); (3) Cultivate the recombinant host bacteria obtained in step (2) and screen the target gene to obtain edited positive host bacteria.

6. The method according to claim 5, characterized in that The host bacteria in step (1) is yeast.

7. The method according to claim 6, characterized in that The yeast is the yeast GS115 strain.

8. The method according to claim 5, characterized in that In step (2), the PAM motif at the 3' end of the target gene is AGG or TGG.

9. The method according to claim 5, characterized in that The length of the gRNA target sequence in step (2) is 20 nt.

10. A gene editing kit, characterized in that The kit includes a vector for expressing the Cas9 protein mutant according to claim 1, and a vector containing a gRNA targeting the target sequence of the target gene to be edited.

Images