A detection method for screening whether T7 RNA polymerase produces dsRNA, a nucleic acid sequence combination and its application
By using specific DNA sequences combined with fluorescent dyes, the dsRNA formation of T7RNA polymerase is monitored in real time, and the problem of complex and inefficient screening of T7RNA polymerase in the prior art is solved, and efficient and low-cost mutant screening and dsRNA formation activity evaluation is achieved.
Patent Information
- Application Number
- CN202411449617.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-17
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2044-10-17
AI Technical Summary
Existing methods are used to screen whether T7RNA polymerase produces dsRNA complex, inefficient, costly, and difficult to quickly and high-throughput screening of mutants that reduce dsRNA formation.
The real-time detection method based on nucleic acid sequence and fluorescent dye is used to monitor the dsRNA formation of T7RNA polymerase in real time through the combination of specific DNA sequences and fluorescent dyes. The size of fluorescence changes is positively correlated with the speed of dsRNA formation.
It has achieved efficient and rapid screening of T7RNA polymerase mutants, which is low in cost and high efficiency, and can accurately distinguish whether the mutant can form dsRNA, and quantitatively judge the dsRNA formation activity based on the rate of fluorescence signal drop.
Smart Images

Figure CN118957023B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological detection technologies, and more specifically, to a method for screening whether RNA polymerase produces dsRNA, a nucleic acid sequence combination, a combination of a nucleic acid sequence and a fluorescent dye, and their applications. Background Art
[0002] T7 RNA polymerase is currently the most commonly used RNA (ribonucleic acid) polymerase that uses DNA (deoxyribonucleic acid) as a template. It can specifically recognize the T7 promoter sequence and transcribe the downstream sequence of the promoter. Cazenave et al. published "RNA template-directed RNA synthesis by T7 RNA polymerase" in PNAS ( Proceedings of the National Academy of Sciences of the United States of America Proceedings of the National Academy of Sciences of the United States of America) in 1994, stating that T7 RNA polymerase can synthesize RNA using RNA as a template. Nadège et al. published an article in 1999 suggesting that T7 RNA polymerase can transcribe double-stranded or single-stranded RNA downstream of the T7 promoter, but the yield is only 1 / 100 to 1 / 10 of that of the DNA template. Papers published by Mu (2018), Zhu (2024), etc. proposed that the double-stranded RNA in the T7 RNA polymerase transcription reaction is DNA-dependent transcription (non-promoter-dependent) caused by the base sequence at the end of the DNA template.
[0003] The reaction mechanism of the process of T7 RNAP synthesizing RNA from a DNA template has been well studied. It has been determined that certain by-products will be produced during in vitro synthesis, and these by-products will trigger the cellular immune response, including double-stranded RNA (dsRNA), which has been proven to be the main trigger factor for the immune pathway. T7 RNA polymerase has the activity of transcribing and producing RNA, but in a small number of cases, it has also been found to have weak activity of forming dsRNA. The former (producing RNA) is desired in production preparation, while the latter (dsRNA) is considered a by-product.
[0004] As a type of RNA, mRNA has become a new drug route. As a by-product of transcription, dsRNA is immunogenic to the human body and can induce an immune response in the body, thereby reducing the efficacy of mRNA-based biological products. Therefore, it is necessary to remove the dsRNA by-product during mRNA production. The simplest way to remove the dsRNA by-product is to select a T7 RNA polymerase or its mutant that does not have the ability to form dsRNA or has a low ability to form dsRNA.
[0005] Researchers actively screen for mutants of T7 RNA polymerase to eliminate or reduce the formation of dsRNA. The current methodology for differentiating whether T7 RNA polymerase can form dsRNA is very complex. Currently, to determine whether an RNA polymerase can form dsRNA, it is mostly detected using dsRNA-specific antibodies. This method is costly (the antibodies are expensive), time-consuming, and inefficient, which is not conducive to the screening of T7 RNA polymerase mutants that can reduce the formation of dsRNA. In research, nucleic acid electrophoresis, mass spectrometry analysis, or RNA sequencing are also used to determine whether dsRNA is formed. However, generally speaking, the efficiency is low, the throughput is low, and the cost is relatively high. Summary of the Invention
[0006] To solve the above problems, the present invention provides a detection method, a nucleic acid sequence combination, a nucleic acid sequence and a fluorescent dye combination, and their applications for rapidly screening whether T7 RNA polymerase produces dsRNA. This is a real-time detection method based on nucleic acid sequences and fluorescent dyes, which can efficiently distinguish whether mutants of T7 RNA polymerase can form dsRNA, and the magnitude of the fluorescence change is positively correlated with the rate of dsRNA formation. The present invention can be applied to the high-throughput and rapid screening of T7 RNA polymerase mutants, with low cost and high efficiency.
[0007] The present invention is implemented by the following technical solutions: A detection method for screening whether T7 RNA polymerase produces dsRNA, the detection method has the following steps:
[0008] 1) Preparation of the reaction system: The reaction system contains 10 - 50 mM Tris-HAc, pH 6.0 - 8.8, 3 - 50 mM MgCl2, 0 - 5 mM spermidine, 0 - 50 mM NaCl, 0.1 - 5 mM KCl, 0 - 30 mM DTT, 0 - 200 μg / ml BSA, 0 - 5% DMSO, 0 - 0.05% Triton X-100, 0 - 8% polyethylene glycol PEG8000, 0.2 - 10 mM of each ribonucleoside triphosphate (i.e., 0.8 - 40 mM total rNTP), 0.25 - 10 μM of the synthetic GV-DNA probe template, 0 - 0.025 U of inorganic pyrophosphatase, and 3 - 200 μM of the DFHBI-1T dye;
[0009] 2) Add 0.5 - 20 μM of the T7 RNA polymerase mutant to the reaction system;
[0010] 3) Fluorescence detection;
[0011] 4) Perform subsequent steps based on the fluorescence detection results: If the fluorescence value increases, it indicates that the activity of the T7 RNA polymerase mutant in producing dsRNA is low → proceed to the next round of screening; if the fluorescence value decreases, or first increases and then continuously decreases, and finally a fluorescence value lower than the background of the fluorescent dye is obtained, it indicates that the activity of the T7 RNA polymerase mutant in producing dsRNA is high → stop screening.
[0012] Among them, the T7 RNA polymerase mutants include but are not limited to T7 RNA polymerase mutants V3, V5, V6, V7, and V8.
[0013] Among them, the GV-DNA probe template includes:
[0014] GV-DNA probe 1 template: TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTC;
[0015] Or, GV-DNA probe 2 template: TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTT;
[0016] Or, GV-RNA probe 1 template: GGGGAGACGGUCGGGUCCAGAUAUUCGUAUCAGGUCGAUCAGAGUGGGCUC;
[0017] Or, GV-DNA probe 3 template: TAATACGACTCACTATA GGGGACGCAACTGAATGAAATGGTGAAGGACGGGTCCAGGTGTGGCTGCTTCGGCAGTGCAGCTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTCGCGTC.
[0018] Among them, the DFHBI-1T dye can also be DMHBI, DFHBI, DMABI, 2-HBI or their respective derivatives.
[0019] Preferably, the reaction system contains 30 mM Tris-HAc, pH 7.9, 30 mM MgCl2, 2 mM spermidine, 5 mM NaCl, 1 mM KCl, 10 mM DTT, 50 μg / ml BSA, 1.67% DMSO, 0.005% Triton X-100, 2% polyethylene glycol PEG8000, 5 mM each ribonucleoside triphosphate (i.e., 20 mM total rNTP), 2.5 μM synthetic GV-DNA probe template, 0.0025 U inorganic pyrophosphatase, and 60 μM DFHBI-1T dye.
[0020] Among them, the detection method is also applicable to the detection of whether T3 RNA polymerase, SP6 RNA polymerase, and VSW-3 RNA polymerase produce dsRNA.
[0021] Furthermore, the present invention also provides a nucleic acid sequence combination for screening whether T7 RNA polymerase produces dsRNA. The nucleic acid sequence combination is the GV-DNA probe template nucleic acid sequence, including:
[0022] GV-DNA probe 1 template: TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTC;
[0023] Or, GV-DNA probe 2 template TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTT;
[0024] Or, GV-RNA probe 1 template: GGGGAGACGGUCGGGUCCAGAUAUUCGUAUCAGGUCGAUCAGAGUGGGCUC;
[0025] Or, GV-DNA probe 3 template: TAATACGACTCACTATA GGGGACGCAACTGAATGAAATGGTGAAGGACGGGTCCAGGTGTGGCTGCTTCGGCAGTGCAGCTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTCGCGTC.
[0026] Among them, a small number of sites in the nucleic acid sequence of the GV-DNA probe template undergo base mutations, which do not affect the application for screening and detecting whether T7 RNA polymerase produces dsRNA. A small number of sites undergoing base mutations means that the RNA produced after mutation can still bind to the dye, emit fluorescence, and still be extended, thus not affecting the screening and detection.
[0027] Furthermore, the present invention also provides a nucleic acid sequence and a fluorescent dye combination for screening whether T7 RNA polymerase produces dsRNA, and the combination includes:
[0028] 1) The nucleic acid sequence of the GV-DNA probe template, including:
[0029] GV-DNA probe 1 template: TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTC;
[0030] Or, GV-DNA probe 2 template: TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTT;
[0031] Or, GV-RNA probe 1 template: GGGGAGACGGUCGGGUCCAGAUAUUCGUAUCAGGUCGAUCAGAGUGGGCUC;
[0032] Or, GV-DNA probe 3 template: TAATACGACTCACTATA GGGGACGCAACTGAATGAAATGGTGAAGGACGGGTCCAGGTGTGGCTGCTTCGGCAGTGCAGCTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTCGCGTC;
[0033] 2) Fluorescent dyes, including: DFHBI-1T dye, or replaced by derivatives of HBI, including DMHBI, DFHBI, DMABI, 2-HBI and their respective derivatives.
[0034] Among them, a small number of sites in the nucleic acid sequence of the GV-DNA probe template undergo base mutations, which do not affect the application for screening and detecting whether T7 RNA polymerase produces dsRNA. A small number of sites undergoing base mutations means that the RNA produced after mutation can still bind to the dye, emit fluorescence, and still be extended, thus not affecting the screening and detection.
[0035] Furthermore, the present invention also provides an application of the nucleic acid sequence combination for screening whether T7 RNA polymerase produces dsRNA, and the nucleic acid sequence combination is used for screening whether dsRNA is produced during the transcription of T7 RNA polymerase using DNA as a template.
[0036] Among them, the nucleic acid sequence combination can also screen whether dsRNA is produced during the transcription of T3 RNA polymerase, SP6 RNA polymerase, and VSW-3 RNA polymerase.
[0037] Furthermore, the present invention also provides an application of the combination of the nucleic acid sequence for screening whether T7 RNA polymerase produces dsRNA and a fluorescent dye, and the combination of the nucleic acid sequence and the fluorescent dye is used for screening whether dsRNA is produced during the transcription of T7 RNA polymerase using DNA as a template.
[0038] Among them, the combination of the nucleic acid sequence and the fluorescent dye can also screen whether dsRNA is produced during the transcription of T3 RNA polymerase, SP6 RNA polymerase, and VSW-3 RNA polymerase.
[0039] One of the specific DNA sequences in the present invention (GV probe 1) was first reported by Filonov et al. in JACS (Journal of the American Chemical Society) in 2014 and applied to determine the activity of RNA polymerase, and was also applied to screen whether T7 RNA polymerase has activity. GV probe 3 was reported by Paige in 2011 that its transcription product can mimic GFP protein for in vivo RNA tracing. We first discovered a phenomenon that has never been reported in our research. When testing the activity of some mutants of T7 RNA polymerase using the above sequences and dyes, the fluorescence value first increased and then decreased, or continued to decrease, lower than the background fluorescence value (showing a negative fluorescence value on the instrument). By analyzing the RNA products corresponding to these "strange" curves through electrophoresis, mass spectrometry, and sequencing, we found that these products are all longer than the expected transcription products. If the 3' end of the DNA template sequence is mutated, only transcription products can be produced, indicating that in addition to normal transcription, these mutants can also produce dsRNA depending on the RNA template.
[0040] The present invention uses known combinations or mutations of known combinations to detect side reactions of RNA polymerase, while in the prior art, the previous combinations were used to detect the transcriptional activity of RNA polymerase. We found that the signals caused by this side reaction are completely different from the transcriptional activity. In this way, the method that was originally used in the prior art to test the activity of RNA polymerase was found by us to be able to test whether RNA polymerase produces dsRNA.
[0041] The present invention can not only efficiently distinguish whether mutants of T7 RNA polymerase can form dsRNA, but also finds that the magnitude of the fluorescence change is positively correlated with the rate of dsRNA formation. The stronger the fluorescence, the more double-stranded RNA in the corresponding mass spectrum, which is reflected as a higher high molecular weight ratio. If a strong, negative fluorescence signal appears, it indicates that the RNA polymerase or mutant has a strong ability to form dsRNA. If screening for RNA polymerase for mRNA synthesis, enzymes with such characteristics should be excluded. If double-stranded RNA synthesis is required, such enzymes need to be screened and confirmed with emphasis.
[0042] According to the rate of fluorescence signal decline, it is also possible to quantitatively judge the strength of the activity of forming dsRNA. If the activity of forming dsRNA is strong, it needs to be excluded when screening raw materials for mRNA drugs. If double-stranded RNA synthesis is required, these mutants with strong dsRNA-forming activity are candidates.
[0043] The innovation and beneficial effects of the present invention are as follows:
[0044] 1) The present invention discloses the application of specific DNA sequences and their mutants and fluorescent dyes in the screening of dsRNA formation by RNA polymerase.
[0045] 2) The present invention discloses the application of specific DNA sequences and their mutants and fluorescent dyes in the strength of the activity of forming dsRNA by RNA polymerase.
[0046] 3) The present invention discloses the application of DNA with a similar structure and fluorescent dyes in the screening of dsRNA formation by RNA polymerase.
[0047] The above three points can also be extended to ① the translated RNA can bind to the fluorescent dye, ② the 3'-end of the translated RNA can form a palindromic sequence, and ③ the palindromic sequence has extensibility.
[0048] 4) Discloses the application of DNA with a similar structure and fluorescent dyes in the strength of the activity of forming dsRNA by RNA polymerase.
[0049] The above point can also be extended to ① the translated RNA can bind to the fluorescent dye, ② the 3'-end of the translated RNA can form a palindromic sequence, and ③ the palindromic sequence has extensibility.
[0050] 5) Discloses the application of specific RNA sequences and their mutants and fluorescent dyes in the screening of dsRNA formation by T7 RNA polymerase.
[0051] 6) Discloses the application of specific RNA sequences and their mutants and fluorescent dyes in the strength of the activity of forming dsRNA by RNA polymerase.
[0052] 7) The application of RNAs with similar structures and fluorescent dyes in the screening of dsRNA formation by RNA polymerase is disclosed.
[0053] The above three points can also be extended to: ① RNA can bind to fluorescent dyes; ② the 3'-end of RNA can form palindromic sequences; ③ the palindromic sequences are extensible.
[0054] 8) The application of RNAs with similar structures and fluorescent dyes in the activity strength of dsRNA formation by RNA polymerase is disclosed.
[0055] The above one point can also be extended to: ① RNA can bind to fluorescent dyes; ② the 3'-end of RNA can form palindromic sequences; ③ the palindromic sequences are extensible.
[0056] In the present invention, a specific sequence is combined with a dye to perform fluorescence detection on T7 RNA polymerase. If a decrease in fluorescence value is found, it indicates that the T7 RNA polymerase mutant can produce dsRNA. When T7 RNA polymerase synthesizes RNA, if dsRNA is formed during the synthesis process, the fluorescence value will decrease. Moreover, the magnitude of the fluorescence change is positively correlated with the rate of dsRNA formation. The stronger the fluorescence, the more double-stranded RNA in the corresponding mass spectrometry, manifested as a higher proportion of high molecular weight. If a strong, negative fluorescence signal appears, it indicates that the RNA polymerase or mutant has a strong ability to form dsRNA.
[0057] The present invention can efficiently distinguish whether mutants of T7 RNA polymerase can form dsRNA, and can be applied to the high-throughput and rapid screening of T7 RNA polymerase mutants, with low cost and high efficiency. The present invention can also be used for detecting whether mutants of T3 RNA polymerase, SP6 RNA polymerase, and VSW-3 RNA polymerase can form dsRNA. BRIEF DESCRIPTION OF THE DRAWINGS
[0058] Figure 1 It is a flow chart for screening T7 RNA polymerase mutants with GV nucleic acid sequences.
[0059] Figure 2 It is the fluorescence result of incubating different T7 RNA polymerase mutants with GV DNA probe 1 in Example 1.
[0060] Figure 3 It is the electrophoresis result of the incubation products of different T7 RNA polymerase mutants with GV DNA probe 1 in Example 1.
[0061] Figure 4 It is the fluorescence result of incubating different T7 RNA polymerase mutants with GV DNA probe 2 in Example 2.
[0062] Figures 5A - 5DFor Example 2, the mass spectrometry analysis results of the products incubated with different T7 RNA polymerase mutants and GV DNA probe 2. Among them, Figure 5A is the mass spectrometry analysis result of the product incubated with T7 wild type and GV DNA probe 2, Figure 5B is the mass spectrometry analysis result of the product incubated with T7(V5) and GV DNA probe 2, Figure 5C is the mass spectrometry analysis result of the product incubated with T7 (V3) and GV DNA probe 2, Figure 5D is the analysis result of the mass spectrometry analysis result of the product incubated with T7 (V7) and GV DNA probe 2.
[0063] Figure 6 For Example 3, the fluorescence results of different T7 RNA polymerase mutants incubated with GV DNA probe 2.
[0064] Figure 7 For Example 3, the electrophoresis results of different T7 RNA polymerase mutants incubated with GV RNA probe 1.
[0065] Figure 8 For Example 3, the liquid chromatography - mass spectrometry analysis results of the T7 RNA polymerase mutant T7 V3 incubated with GV RNA probe 1.
[0066] Figure 9 For Example 3, the liquid chromatography - mass spectrometry analysis results of the T7 RNA polymerase mutant T7 V5 incubated with GV RNA probe 1.
[0067] Figure 10 For Example 3, the liquid chromatography - mass spectrometry analysis results of the T7 RNA polymerase mutant T7 V7 incubated with GV RNA probe 1.
[0068] Figure 11 For Example 4, the fluorescence detection results of different T7 RNA polymerase mutants and GV DNA probe 3. Detailed implementation manners
[0069] The technical solutions of the present invention will be further described below through specific examples. Those skilled in the art should understand that the described examples are only for helping to understand the present invention and should not be regarded as specific limitations to the present invention.
[0070] Example 1: Screening for whether T7 RNA polymerase mutants produce dsRNA using GV - DNA probe 1
[0071] The experimental procedure is as Figure 1As shown. After fluorescence detection, subsequent steps are carried out according to the fluorescence detection results: If the fluorescence value increases, it indicates that the T7 RNA polymerase mutant has low activity and weak ability to produce dsRNA → continue with the next round of screening; If the fluorescence value decreases, or first increases and then decreases, and the final fluorescence value is negative, lower than the fluorescence value of the fluorescence dye background, it indicates that the T7 RNA polymerase mutant has high activity and strong ability to produce dsRNA → stop screening.
[0072] In the present invention, a specific sequence is combined with a dye for fluorescence detection. If it is found that the fluorescence value decreases, it indicates that this T7 RNA polymerase mutant can produce dsRNA. Previously, the same method was used to detect the ability of T7 RNA polymerase to synthesize RNA. The faster the fluorescence value increases, the stronger the ability to synthesize RNA. However, no one has found that the fluorescence value will decrease in this reaction system or reported that if dsRNA is formed, the fluorescence value will decrease.
[0073] To verify this concept, we performed electrophoresis detection on the amplification results. If only RNA is produced, there will be a difference in molecular weight compared to when RNA is produced and then continues to produce dsRNA. If dsRNA continues to be produced, the molecular weight will be larger than that of only producing RNA. Electrophoresis itself can only prove that a larger molecule is produced and cannot alone prove the production of dsRNA. Here, it is inferred that dsRNA is produced, which is in line with biochemical principles. Combining the electrophoresis results with the fluorescence detection results can confirm each other: the ability to produce a negative fluorescence value is due to the production of a larger molecular weight product, dsRNA.
[0074] Similarly, the present invention also uses mass spectrometry detection to verify this concept. If the molecular weight increases, there will be a peak with a larger molecular weight on the mass spectrometry graph. We found that the sizes of these peaks are unchanged under different conditions such as DNA template, or RNA template, V3 mutant, and V5 mutant, indicating that the extended sequence is conserved. Then it can be inferred that the product is dsRNA.
[0075] Thus, the activity of the T7 RNA polymerase mutant to produce dsRNA can be screened and detected, thereby identifying whether the T7 RNA polymerase and its mutants can produce dsRNA.
[0076] Experimental scheme:
[0077] 1.1 Fluorescence detection experiment
[0078] The reaction system contains 30 mM Tris-HAc, pH 7.9, 30 mM MgCl2, 2 mM spermidine, 5 mM NaCl, 1 mM KCl, 10 mM DTT, 50 μg / ml BSA, 1.67% DMSO, 0.005% Triton X-100, 2% polyethylene glycol (PEG8000), 5 mM of each ribonucleoside triphosphate (20 mM total rNTP), 2.5 μM of synthetic GV-DNA probe 1 template (TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTC), 0.0025 U of inorganic pyrophosphatase, and 60 μM of DFHBI-1T dye.
[0079] Add 5 μM of different mutants of T7 RNA polymerase.
[0080] After mixing, place it in an ABI7500 fluorescence detection instrument, set to incubate at 30 °C, 37 °C or 42 °C, detect fluorescence with FAM, scan fluorescence once every 30 seconds, and perform a total of 60 scans.
[0081] 1.2 Detection of amplification products by denaturing PAGE electrophoresis
[0082] The reaction system contains 30 mM Tris-HAc, pH 7.9, 30 mM MgCl2, 2 mM spermidine, 5 mM NaCl, 1 mM KCl, 10 mM DTT, 50 μg / ml BSA, 1.67% DMSO, 0.005% Triton X-100, 2% polyethylene glycol (PEG8000), 5 mM of each ribonucleoside triphosphate (20 mM total rNTP), 2.5 μM of synthetic GV-DNA probe 1 template (TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTC), and 0.0025 U of inorganic pyrophosphatase.
[0083] Add mutants of different T7 RNA polymerases (5 μM). After mixing, incubate at 30 °C, 37 °C or 42 °C for 30 minutes, extract RNA by magnetic beads, and perform denaturing PAGE electrophoresis on the obtained product, stain and take pictures.
[0084] Incubate with T7 RNA polymerase mutants 5, 6, 7, 8 (T7V5, T7V6, T7V7, T7V8), and the experimental results are as Figure 2 and Figure 3 shown.Figure 2 are the fluorescence results of incubating different T7 RNA polymerase mutants with GV DNA probe 1. Figure 3 are the results of electrophoresis of the incubation products of different T7 RNA polymerase mutants with GV DNA probe 1.
[0085] Figure 2 It can be seen that the T7V5 mutant produced a negative fluorescence value. The fluorescence signals produced by different mutants are different. V6, V7, and V8 all produced positive fluorescence signals, while the fluorescence signal of V5 first increased, then decreased to 0, and then continued to decrease to a negative value.
[0086] Figure 3 From the electrophoresis results, compared with V6, V7, and V8, a longer band appeared in the electrophoresis corresponding to T7V5. V5 and V6, V7, and V8 had a common lower band. Above this, V5 had a band with a larger molecular weight, indicating that after the transcription product, V5 produced a product dsRNA with a larger molecular weight.
[0087] Thus, the fluorescence detection and electrophoresis detection results can confirm each other: the production of a negative fluorescence value is due to the production of a product dsRNA with a larger molecular weight.
[0088] Example 2: Screening for whether T7 RNA polymerase mutants produce dsRNA using GV-DNA probe 2
[0089] Experimental protocol:
[0090] 2.1 Fluorescence detection experiment
[0091] The reaction system contains 30 mM Tris-HAc, pH 7.9, 30 mM MgCl2, 2 mM spermidine, 5 mM NaCl, 1 mM KCl, 10 mM DTT, 50 μg / ml BSA, 1.67% DMSO, 0.005% Triton X-100, 2% polyethylene glycol (PEG8000), 5 mM each ribonucleoside triphosphate (20 mM total rNTP), 2.5 μM synthetic GV-DNA probe 2 template (TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTT), 0.0025 U inorganic pyrophosphatase, and 60 μM DFHBI-1T dye.
[0092] Add 5 μM each of mutants V3, V5, V7, and V8 of T7 RNA polymerase. After mixing evenly, place them in an ABI 7500 fluorescence detection instrument, set to incubate at 30 °C, 37 °C, or 42 °C, detect fluorescence as FAM, scan fluorescence once every 30 seconds, and conduct a total of 60 scans.
[0093] 2.2 Mass spectrometry detection experiment
[0094] Under the same reaction conditions as the fluorescence experiment, except without adding fluorescent dyes. After incubating at 37 °C for 1 hour, extract and purify the RNA product with magnetic beads. After subjecting the RNA product to liquid phase separation, perform mass spectrometry analysis on the target fragment.
[0095] The results of mass spectrometry detection are shown in Figure 4 and Figures 5A - 5D as shown.
[0096] Figure 4 is the fluorescence result of incubating different mutants of T7 RNA polymerase with GV DNA probe 2. It can be seen that mutants T7V3 and T7V5 produced negative fluorescence values. V7 and V8 produced positive fluorescence signals, while the fluorescence signals of V3 and V5 first increased, then decreased to 0, and then continued to decrease to negative values. Figures 5A - 5D is the result of liquid chromatography - mass spectrometry (LC - MS) analysis of the products obtained by incubating different mutants of T7 RNA polymerase with GV DNA probe 2. Among them, Figure 5A is T7 wild type (T7 wild type species), Figure 5B is T7(V5), Figure 5C is T7 (V3), Figure 5D is the result of liquid chromatography - mass spectrometry (LC - MS) analysis of the products obtained by incubating T7 (V7) with GV DNA probe 2. Figure 4 In it, mutants T7 V3 and V5 produced negative fluorescence values. The corresponding Figures 5A - 5D mass spectrometry data shows that the main peaks of T7 wild type and T7V7 are 17423, while there are significant offsets for V3 and V5. Among them, V3 shifted to 19014, 19344, and V5 shifted to 19344. This indicates that after the generation of transcription products, V3 and V5 continued to extend to produce products with larger molecular weights. Although the intensities of the peaks on the right side of 17423 for V3 and V5 are different, the sizes of the mass spectrometry fragments are the same (such as 18033, 18669, 19014, 19344, 19649, 19978, etc.), indicating that the extension of this sequence is regular rather than random elongation, that is, dsRNA is formed; while under the same conditions, T7 wild type and T7 (V7) mutants cannot produce longer fragments.
[0097] Example 3: Screening the ability of T7 RNA polymerase mutants to produce dsRNA using GV-RNA probe 1
[0098] Experimental protocol:
[0099] 3.1 Fluorescence detection assay
[0100] The reaction system contains 30 mM Tris-HAc, pH 7.9, 30 mM MgCl2, 2 mM spermidine, 5 mM NaCl, 1 mM KCl, 10 mM DTT, 50 μg / ml BSA, 1.67% DMSO, 0.005% Triton X-100, 2% polyethylene glycol (PEG8000), 5 mM each ribonucleoside triphosphate (20 mM total rNTP), 10 μM synthetic GV-RNA probe 1 template (GGGGAGACGGUCGGGUCCAGAUAUUCGUAUCAGGUCGAUCAGAGUGGGCUC), 0.0025 U inorganic pyrophosphatase and 60 μM DFHBI-1T dye.
[0101] Add 5 μM of each mutant of T7 RNA polymerase, mix well, place in an ABI7500 fluorescence detection instrument, incubate at 30 °C, 37 °C or 42 °C, detect fluorescence as FAM, scan fluorescence once every 30 seconds, and perform a total of 60 scans.
[0102] 3.2 Electrophoresis detection assay
[0103] The reaction system contains 30 mM Tris-HAc, pH 7.9, 30 mM MgCl2, 2 mM spermidine, 5 mM NaCl, 1 mM KCl, 10 mM DTT, 50 μg / ml BSA, 1.67% DMSO, 0.005% Triton X-100, 2% polyethylene glycol (PEG8000), 5 mM each ribonucleoside triphosphate (20 mM total rNTP), 2.5 μM synthetic GV-RNA probe 1 template (GGGGAGACGGUCGGGUCCAGAUAUUCGUAUCAGGUCGAUCAGAGUGGGCUC), 0.0025 U inorganic pyrophosphatase and 60 μM DFHBI-1T dye.
[0104] Add 5 μM of each mutant of T7 RNA polymerase, mix well, place in an ABI7500 fluorescence detection instrument, and perform electrophoresis after incubation for 30 minutes.
[0105] 3.3 Mass spectrometry detection assay
[0106] Using GV RNA probe 1 as a substrate, incubate with T7 V3, V5, and V7 mutants respectively. After the obtained products are purified by magnetic beads, liquid chromatography-mass spectrometry (LC-MS) analysis is performed.
[0107] The experimental results are shown in Figure 6 、 Figure 7 and Figure 8 、 Figure 9 、 Figure 10 as shown.
[0108] Figure 6 are the fluorescence results of incubating different T7 RNA polymerase mutants with GV RNA probe 1. Using RNA as a template, both T7V3 and V5 showed a small increase in fluorescence value followed by a continuous decrease, while the fluorescence value of T7V7 remained near the baseline.
[0109] Figure 7 are the electrophoresis results of incubating different T7 RNA polymerase mutants with GV RNA probe 1. The electrophoresis results showed that bands with larger molecular weights appeared in the lanes with T7 RNA polymerase V3 and V5 added, while the band size of T7V7 did not change. The electrophoresis results showed that T7 RNA polymerase V3 and V5 could extend using RNA as a substrate to produce products with larger molecular weights, while T7 RNA polymerase V7 could not catalyze RNA to produce longer products with larger molecular weights.
[0110] Figure 8 、 Figure 9 、 Figure 10 are the liquid chromatography-mass spectrometry analysis results of the products obtained by incubating T7 RNA polymerase mutants T7 V3, V5, and V7 with GV RNA probe 1 respectively. The results are consistent with the electrophoresis results. For the same substrate, Figure 8 and Figure 9 showed peaks with larger molecular weights such as 18033, 18669, 19014, and 19343 for T7 V3 and V5. While Figure 10 showed that the main peaks of the V7 mutant products were 17423 and 17752, and there were no extended peaks on the right. The peaks with the same molecular weights were obtained by catalysis of T7 RNA polymerase V3 and V5 mutants, indicating that the extended products were ordered dsRNA.
[0111] Example 4 Screening for the ability of T7 RNA polymerase mutants to produce dsRNA using GV-DNA probe 3
[0112] 4.1 Fluorescence detection experiment
[0113] The reaction system contains 30 mM Tris-HAc, pH 7.9, 30 mM MgCl2, 2 mM spermidine, 5 mM NaCl, 1 mM KCl, 10 mM DTT, 50 μg / ml BSA, 1.67% DMSO, 0.005% Triton X-100, 2% polyethylene glycol (PEG8000), 5 mM of each ribonucleoside triphosphate (20 mM total rNTP), 2.5 μM of the synthetic GV-DNA probe 3 template (TAATACGACTCACTATA GGGGACGCAACTGAATGAAATGGTGAAGGACGGGTCCAGGTGTGGCTGCTTCGGCAGTGCAGCTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTCGCGTC), 0.0025 U of inorganic pyrophosphatase and 60 μM of the DFHBI-1T dye.
[0114] Add 5 μM of each mutant of T7 RNA polymerase, mix well, and then place it in an ABI7500 fluorescence detection instrument. Set it to incubate at 30 °C, 37 °C or 42 °C, detect the fluorescence as FAM, scan the fluorescence once every 30 seconds, and perform a total of 60 scans.
[0115] The experimental results are shown in Figure 11 the following figure. Figure 11 It is the result of fluorescence detection of different mutants of T7 RNA polymerase and GV DNA probe 3. Similar to the previous several examples, during the catalysis of T7 RNA polymerase V5, the fluorescence value decreased, indicating the production of dsRNA, while during the catalysis of T7 RNA polymerase V6, the fluorescence value increased, indicating that no dsRNA was produced.
[0116] The experiment shows that the present invention can not only be used to screen whether dsRNA is produced during the transcription of T7 RNA polymerase using DNA as a template, but also can screen whether dsRNA is produced during the transcription of T3 RNA polymerase, SP6 RNA polymerase, and VSW-3 RNA polymerase.
[0117] The present invention uses known combinations or mutations of known combinations to detect the side reactions of T7 RNA polymerase. It can not only efficiently distinguish whether mutants of T7 RNA polymerase can form dsRNA, but also find that the magnitude of the fluorescence change is positively correlated with the rate of dsRNA formation. The stronger the fluorescence, the more double-stranded RNA in the corresponding mass spectrum, manifested as a higher high molecular weight ratio. If a strong, negative fluorescence signal appears, it indicates that the RNA polymerase or mutant has a strong ability to form dsRNA.
[0118] The above-described embodiments are only some preferred solutions of the present invention, but they are not intended to limit the present invention. Those of ordinary skill in the relevant technical field can still make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, all technical solutions obtained by adopting the means of equivalent replacement or equivalent transformation fall within the protection scope of the present invention.
Claims
1. A method for screening whether T7 RNA polymerase produces dsRNA, characterized in that: The detection method comprises the following steps: 1) Reaction system preparation: The reaction system contains 10-50 mM Tris-HAc, pH 6.0-8.8, 3-50 mM MgCl2, 0-5 mM spermidine, 0-50 mM NaCl, 0.1-5 mM KCl, 0-30 mM DTT, 0-200 μg / ml BSA, 0-5% DMSO, 0-0.05% Triton X-100, 0-8% polyethylene glycol PEG8000, 0.2-10 mM of each ribonucleoside triphosphate, i.e., 0.8-40 mM total rNTP, 0.25-10 μM synthetic GV-DNA probe template, 0-0.025 U inorganic pyrophosphatase and 3-200 μM DFHBI-1T dye; 2) Add 0.5-20 μM T7 RNA polymerase mutant to the reaction system; 3) Fluorescence detection; 4) Perform subsequent steps based on the fluorescence detection results: If the fluorescence value increases, it indicates that the activity of the T7 RNA polymerase mutant in producing dsRNA is low → proceed to the next round of screening; if the fluorescence value decreases, or increases first and then continues to decrease, and finally obtains a fluorescence value lower than the background of the fluorescent dye, it indicates that the activity of the T7 RNA polymerase mutant in producing dsRNA is high → stop screening; The GV-DNA probe template includes: GV-DNA probe 1 template: TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTC; or, GV-DNA probe 2 template: TAATACGACTCACTATAGGGGAGACGGTCGGGTCCAGATATTCGTATCTGTCGAGTAGAGTGTGGGCTT; or, GV-RNA probe 1 template: GGGGAGACGGUCGGGUCCAGAUAUUCGUAUCAGGUCGAUCAGAGUGGGCUC; Or, GV-DNA probe 3 template: TAATACGACTCACTATA GGGGACGCAACTGAATGAAATGGTGAAGGACGGGTCCAGGTGTGGCTGCTTCGGCAGTGCAGCTTGTTGAGTAGAGTGTGAGCTCCGTAACTAGTCGCGTC.
2. The method for detecting whether T7 RNA polymerase produces dsRNA according to claim 1, characterized in that: The DFHBI-1T dye may also be DFHBI.
3. The method for detecting whether T7 RNA polymerase produces dsRNA according to claim 1, characterized in that: The composition of the reaction system is as follows: the reaction system contains 30 mM Tris-HAc, pH 7.9, 30 mM MgCl2, 2 mM spermidine, 5 mM NaCl, 1 mM KCl, 10 mM DTT, 50 μg / ml BSA, 1.67% DMSO, 0.005% Triton X-100, 2% polyethylene glycol PEG8000, 5 mM of each ribonucleoside triphosphate, i.e. 20 mM total rNTP, 2.5 μM synthetic GV-DNA probe template, 0.0025 U inorganic pyrophosphatase and 60 μM DFHBI-1T dye.
4. The method for detecting whether T7 RNA polymerase produces dsRNA according to claim 1, characterized in that: The detection method is also applicable to the detection of whether T3 RNA polymerase, SP6 RNA polymerase, and VSW-3 RNA polymerase produce dsRNA.
Citation Information
Patent Citations
T7 rna polymerase variants with expanded substrate range and enhanced transcriptional yield
CN106459879A
Detection method for real-time monitoring of in-vitro transcription synthesized RNA (Ribonucleic Acid)
CN115896213A
T7 RNA polymerase mutant with high thermal stability and application thereof
CN117070493A