Application of UHRF1 in the preparation of CAR-T cell therapy for tumor synergists

Abstract

The present invention discloses the use of UHRF1 in the preparation of a synergist for CAR-T cell therapy of tumors. Overexpression of the epigenetic regulatory factor UHRF1 improves the infiltration ability of CAR-T cells in mice, resolving the problem of poor infiltration of reinfused CAR-T cells into solid tumors. It also reduces exhaustion, differentiation, and apoptosis of CAR-T cells in mice, thereby enhancing the effect and killing ability of CAR-T cells in mice. This invention improves the effectiveness of T cell adoptive therapy for solid tumors and significantly enhances the ability of CAR-T cells to fight solid tumors.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and more specifically, to the application of UHRF1 in the preparation of a synergist for CAR-T cell therapy of tumors. Background Art

[0002] In recent years, immune cell therapy has achieved remarkable results in clinical cancer treatment, particularly with the use of chimeric antigen receptor (CAR) T cells for the treatment of hematologic malignancies, generating great anticipation for the technology's future. CAR-T therapy fuses a scFv fragment that recognizes tumor-specific antigens like CD19 and CEA to a transmembrane domain composed of a series of molecules involved in T cell activation, including CD28, CD137, and CD3-ζ. The transfection then modifies the patient's T cells to express the chimeric antigen receptor, achieving targeted therapy.

[0003] While adoptive CAR-T cell therapy has achieved remarkable clinical efficacy and demonstrated significant advantages in the treatment of hematologic malignancies, it remains plagued by a range of side effects and challenges, particularly in the exploration of solid tumor treatments. First, CAR-T cell infusion-induced toxicity can include conditions associated with CAR-T cell immune activation and the subsequent release of high levels of cytokines, such as cytokine storm and macrophage activation syndrome, as well as off-target effects of CAR-T cells on normal tissue cells expressing the target antigen, leading to inadvertent killing. Second, immune escape can occur due to loss of tumor antigens or heterogeneity. Third, due to prolonged in vitro culture or a suppressive tumor microenvironment, infused CAR-T cells can experience short in vivo survival or cell exhaustion, resulting in weak cytotoxicity. Furthermore, infused CAR-T cells exhibit poor infiltration into solid tumors.

[0004] How to make CAR-T cells show good killing and therapeutic effects in solid tumors is a question of great practical significance and research value.

[0005] Ubiquitin-like, containing PHD and RING finger domains 1 (UHRF1), as an epigenetic regulatory molecule, is considered to be the key to maintaining DNA methylation and plays a key role in important epigenetic modification events in DNA replication, such as the recruitment of DNA methyltransferase 1 (DNMT1). Summary of the Invention

[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and provide the application of UHRF1 in the preparation of a synergist for CAR-T cell therapy of tumors.

[0007] The applicant discovered that overexpression of the epigenetic regulatory factor UHRF1 increased the number of CEA-CAR-T cells in mice, particularly those infiltrating tumors, reduced the exhaustion phenotype and apoptosis of CEA-CAR-T cells in mice, and enhanced the effector and killing abilities of CEA-CAR-T cells in mice. In other words, overexpression of UHRF1 enhanced the anti-tumor ability of CEA-CAR-T cells in mice. CAR-T cells that can resist T cell exhaustion and increase T cell infiltration and survival hold great promise for improving clinical responses.

[0008] The first object of the present invention is to provide the use of UHRF1 protein in the preparation of a synergist for CAR-T cell therapy of tumors.

[0009] The second object of the present invention is to provide a plasmid for use in the preparation of CAR-T cell therapy products for tumors.

[0010] The third object of the present invention is to provide a use of a recombinant lentivirus in the preparation of a CAR-T cell tumor treatment product.

[0011] The fourth object of the present invention is to provide a method for constructing CAR-T cells.

[0012] The fifth object of the present invention is to provide a CAR-T cell.

[0013] The sixth object of the present invention is to provide a method for constructing CAR-T cells or the use of the CAR-T cells in preparing products for preparing tumors.

[0014] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0015] The present invention modifies CAR-T cells to express CAR and overexpress UHRF1 at the same time, obtains UHRF1-overexpressing CAR-T cells and applies them to treat tumor-bearing Nod / scid immunodeficient mice. Compared with CAR-T cells that normally express UHRF1, CAR-T cells that overexpress UHRF1 have a more obvious killing effect on solid tumors. The tumor size of mice in the UHRF1-overexpressing CAR-T cell treatment group is significantly smaller than that in the normal CAR-T cell treatment group.

[0016] Therefore, the present invention claims the following:

[0017] Application of UHRF1 protein in the preparation of CAR-T cell enhancers for tumor therapy.

[0018] The accession number of the UHRF1 in the NCBI database is: NM_001290051.2.

[0019] Preferably, the enhancer increases the proliferation ability of CAR-T cells.

[0020] Preferably, the potentiator improves the immune response of CAR-T cells.

[0021] Preferably, the enhancer improves the effector killing function of CAR-T cells.

[0022] Preferably, the enhancer improves the survival ability of CAR-T cells.

[0023] Preferably, the CAR-T cells are CD8 + T cell subsets.

[0024] Preferably, the CAR-T cells are CAR-T cells targeting carcinoembryonic antigen CEA.

[0025] Preferably, the tumor is a solid tumor.

[0026] The present invention also claims protection for the use of a plasmid in preparing a product for CAR-T cell therapy of tumors, wherein the plasmid contains a nucleic acid molecule encoding UHRF1 protein and a nucleic acid molecule encoding a CAR chimeric antigen receptor domain.

[0027] Preferably, the CAR-T cells are CD8 + T cell subsets.

[0028] Preferably, the CAR-T cells are CAR-T cells targeting carcinoembryonic antigen CEA.

[0029] Preferably, the tumor is a solid tumor.

[0030] As a specific example: the nucleotide sequence of the nucleic acid molecule encoding the CAR chimeric antigen receptor domain is shown in SEQ ID NO: 1.

[0031] Preferably, the plasmid contains the nucleotide sequence shown in SEQ ID NO: 2.

[0032] A recombinant lentivirus is used in the preparation of a product for CAR-T cell therapy of tumors, wherein the recombinant lentivirus carries a nucleic acid molecule encoding UHRF1 protein and a nucleic acid molecule encoding a CAR chimeric antigen receptor domain, or expresses UHRF1 protein and a CAR chimeric antigen receptor domain.

[0033] Preferably, the CAR-T cells are CD8 + T cell subsets.

[0034] Preferably, the CAR-T cells are CAR-T cells targeting carcinoembryonic antigen CEA.

[0035] Preferably, the tumor is a solid tumor.

[0036] As a specific example: the nucleotide sequence of the nucleic acid molecule encoding the CAR chimeric antigen receptor domain is shown in SEQ ID NO: 1.

[0037] A method for constructing CAR-T cells, comprising infecting T cells with the recombinant lentivirus.

[0038] Preferably, the T cells are CD8 + T cell subsets.

[0039] A CAR-T cell is a CAR-T cell that overexpresses UHRF1 protein and is obtained by infecting T cells with the recombinant lentivirus.

[0040] Preferably, the CAR-T cells are CD8 + T cell subsets.

[0041] The use of CAR-T cells constructed by the method or the use of the CAR-T cells in preparing tumor products also falls within the scope of protection of the present invention.

[0042] Preferably, the tumor is a solid tumor.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] This invention discloses the use of UHRF1 in the preparation of a synergist for CAR-T cell therapy of tumors. Overexpression of the epigenetic regulatory factor UHRF1 enhances the infiltration ability of CAR-T cells in mice, resolving the problem of poor infiltration of infused CAR-T cells into solid tumors. It also reduces exhaustion, differentiation, and apoptosis of CAR-T cells in mice, enhancing the effect and killing capacity of CAR-T cells in mice. This invention improves the effectiveness of T cell adoptive therapy for solid tumors and significantly enhances the anti-solid tumor capacity of CAR-T cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Schematic diagram of the constructed CEA-OE-CAR fragment overexpressing UHRF1.

[0046] Figure 2 Schematic diagram of the CEA-CAR lentiviral vector structure carrying mCherry and overexpressing UHRF1.

[0047] Figure 3 The titer determination results of 293T cells infected with lentivirus after successful packaging; left: bright field view; right: mCherry fluorescence channel view.

[0048] Figure 4 The results of infection efficiency detection by flow cytometry; the Control group is the uninfected control CD8 + T cells, CEA-OE-CAR group, and CEA-CAR group are CAR-T cells infected with two groups of CAR lentiviruses; the value on the upper right is the mean fluorescence intensity (MFI); the value above the gate is the positive rate of each group, that is, the infection efficiency.

[0049] Figure 5 Figure 3 shows the results of real-time fluorescence quantitative PCR and western blotting to detect UHRF1 expression; A: Real-time fluorescence quantitative PCR was used to detect the transcriptional expression of CEA-scFv in each cell group; B: Real-time fluorescence quantitative PCR was used to detect the transcriptional expression of UHRF1 in each cell group; C: Western blotting was used to detect the protein expression of UHRF1 in each cell group; ****P < 0.0001.

[0050] Figure 6 Figure 3: Effect of overexpression of UHRF1 on the proliferation of CEA-CAR-T cells cultured in vitro; A: Absolute counts of CAR-T cells cultured in vitro on the fourth day after infection; B and C: Flow cytometry analysis of CAR-T cells cultured in vitro on the seventh day after infection, B: Difference in CD98 expression between the two groups of cells, C: Difference in Ki67 expression between the two groups of cells; *P < 0.05, **P < 0.01.

[0051] Figure 7 Figure 3 is the effect of overexpression of UHRF1 on the function of CEA-CAR-T cells cultured in vitro; A to C: CAR-T cells cultured in vitro were detected by flow cytometry on the seventh day after infection, A: GZMB expression difference between the two groups of cells; B: IL-2 expression difference between the two groups of cells; C: TCF1 expression difference between the two groups of cells; *P < 0.05.

[0052] Figure 8 Figure 3 shows the effect of overexpression of UHRF1 on the in vitro cytotoxicity of CEA-CAR-T cells; A: In vitro cytotoxicity assay, the test results were statistically analyzed based on three independent repeated experiments, and the samples for each test were provided by different healthy donors; B: ELISPOT assay, the test results were statistically analyzed based on three independent repeated experiments, and the samples for each test were provided by different healthy donors; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0053] Figure 9Figure 1: Effect of UHRF1 overexpression on the in vivo anti-tumor function of CEA-CAR-T cells. A: Tumor growth curves of mice after infusion of CAR-T cells in each group (CEA-CAR group: n=5; CEA-OE-CAR group: n=5). B: UHRF1 expression levels of CAR-T cells in the spleens of mice after infusion. ***P<0.001.

[0054] Figure 10 Figure 1 shows the effect of UHRF1 overexpression on CEA-CAR-T cell proliferation in mice. AB: Flow cytometry analysis of tumor-infiltrating CAR-T cells on day 8 after infusion. A: Difference in Ki67 expression between the two groups. B: Difference in apoptosis rate between the two groups. *P < 0.05, **P < 0.01.

[0055] Figure 11 Figure 3 is the effect of overexpression of UHRF1 on the function of CEA-CAR-T cells in mice; A to D: Flow cytometry analysis of tumor-infiltrating CAR-T cells on the 8th day after reinfusion, A: difference in IFN-γ expression between the two groups of cells, B: difference in GZMB expression between the two groups of cells, C: difference in IL-2 expression between the two groups of cells, B: difference in TNF-α expression between the two groups of cells *P < 0.05, **P < 0.01, ***P < 0.001. DETAILED DESCRIPTION

[0056] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified.

[0057] 1. Experimental Materials

[0058] (1) Human embryonic kidney epithelial cell line (293T) and CEA + Human colorectal cancer cell lines (LS174T) were purchased from ATCC. Competent DH5α cells were purchased from Beijing Qingke Biotechnology Co., Ltd. Peripheral blood T cells were obtained from healthy donors.

[0059] (2) Three-plasmid lentiviral vector system: shuttle plasmid pLVX-IRES-mCherry, helper plasmid psPAX2 and envelope plasmid pMD2.G.

[0060] (3) Nod / scid immunodeficient mice: 6-8 weeks old, purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd., and routinely raised in an SPF-grade environment at the Experimental Animal Center of Sun Yat-sen University.

[0061] 2. Experimental instruments and software

[0062] (1) Flow cytometer BD LSRFortessa (BD Biosciences, USA)

[0063] (2) Multifunctional detector Promega GM3000 (Promega Corporation, USA)

[0064] (3) Real-time fluorescence quantitative PCR detector Bio-Rad CFX-96PCR (Bio-Rad, USA)

[0065] (4) Infrared laser dual-color imaging system Odyssey CLX imager (LI-COR, USA)

[0066] (5) Flow cytometry analysis software BD Flowjo V10 (BD Biosciences, USA)

[0067] (6) Data analysis software GraphPad Prism (GraphPad Software, USA)

[0068] 3. Main Reagents

[0069] 1. Antibodies

[0070]

[0071] 2. Compounds and Reagents

[0072]

[0073]

[0074] 3. Functional antibodies and cytokines

[0075]

[0076] 4. Detection kit

[0077]

[0078] Example 1 Construction and Preparation of CAR Lentiviral Vector

[0079] 1. Construction of CAR chimeric antigen receptor domain (anti CEA scFv-CD8α spacer-CD8αTM-CD28-CD137-CD3ζ)

[0080] A CAR lentiviral plasmid targeting carcinoembryonic antigen CEA was constructed using a single-chain variable region fragment (scFv-fragment, derived from the article published by Yazaki et al. doi:10.1093 / protein / gzs096).

[0081] 1. Experimental methods

[0082] After codon optimization, the scFv-fragment was codon-optimized and an IL-2 signal peptide sequence was added to the front end to form the basic CAR structure. By overlapping PCR, the spacer sequence and transmembrane sequence (TM) derived from the CD8α molecule were inserted into the 5' end of the basic CAR structure, along with intracellular signals designed based on the third-generation CAR structure, including CD28 (nucleotides 460-660; NM_006139.3), CD137 (nucleotides 640-765; NM_001561.5), and CD3ζ (nucleotides 160-492; NM_198053.2). The complete third-generation CAR structure (anti CEA scFv-CD8α spacer-CD8αTM-CD28-CD137-CD3ζ) was obtained and its sequence was confirmed by Sanger sequencing.

[0083] 2. Experimental results

[0084] The Sanger sequencing results of anti CEA scFv-CD8αspacer-CD8αTM-CD28-CD137-CD3ζ were consistent with expectations, and its sequence is shown in SEQ ID NO: 1.

[0085] 2. Construction of CEA-CAR and CEA-OE-CAR Plasmids

[0086] 1. Experimental methods

[0087] The anti CEA scFv-CD8α spacer-CD8αTM-CD28-CD137-CD3ζ (SEQ ID NO: 1) was ligated to the downstream of the CMV promoter of the pLVX-IRES-mCherry vector by double enzyme digestion to obtain pLVX-anti CEA CAR-IRES-mCherry, i.e., CEA-CAR plasmid.

[0088] Using the constructed CEA-CAR plasmid, the full-length reading frame of UHRF1 (nucleotides 114-2495; NM_001290051.2) was further expressed using the self-cleaving P2A peptide bicistronic element upstream of the open reading frame of the second-generation chimeric antigen expression vector to construct UHRF1 cds-P2A-anti CEA scFv-CD8α spacer-CD8αTM-CD28-CD137-CD3ζ, as shown in the schematic diagram. Figure 1 As shown, the genetically modified T cells overexpress UHRF1 while expressing CAR, that is, the CEA-OE-CAR plasmid (plasmid structure as shown Figure 2 and its sequence was identified by Sanger sequencing.

[0089] 2. Experimental results

[0090] The Sanger sequencing results were consistent with expectations, and the sequence of UHRF1 cds-P2A-anti CEA scFv-CD8αspacer-CD8αTM-CD28-CD137-CD3ζ was shown in SEQ ID NO: 2.

[0091] 3. Preparation of CEA-CAR and CEA-OE-CAR Plasmids

[0092] Lentiviral vector plasmids obtained using gene cloning technology are obtained in bulk through transformation, amplification, and extraction. DH5α competent cells are used in the transformation process. The lentiviral vector plasmids in this invention are ampicillin-resistant, so ampicillin is added to the LB culture medium for selection. The amplified plasmids are then extracted using the Endo-free Plasmid Maxi Kit (Omega Bio-tek, USA).

[0093] Example 2 Packaging of CAR Lentivirus

[0094] 1. Lentivirus Packaging

[0095] 1. Experimental methods

[0096] To achieve better cell adhesion, 10 cm culture dishes were incubated with 1× poly k at 37°C for 20 minutes before plating, and poly k was recovered and the treated culture dishes were washed once with PBS. After digestion and counting of 293T cells with good growth status and negative mycoplasma test, 2×10 cells were seeded in each treated 10 cm cell culture dish. 6 The next day, when the growth density of 293T cells reached about 80%, transfection was performed.

[0097] Prepare the following transfection mixtures:

[0098] Solution 1:

[0099]

[0100] Solution 2:

[0101] PEI-MAX 75μL

[0102] Opti-MEM 500 μL

[0103] After incubating solution 1 and solution 2 at room temperature for 5 minutes, they were premixed and incubated at room temperature for another 20 minutes before being added to the prepared 10 cm culture dish.

[0104] After incubation in a 37°C cell culture incubator for 8 to 12 hours, the culture medium containing the transfection reagent was discarded and replaced with fresh DMEM high-glucose complete medium.

[0105] 2. Experimental results

[0106] After 24 hours of continuous culture, the cells were observed under a fluorescent microscope. Figure 3 As shown, red fluorescence appeared in the cells, indicating that mCherry was expressed, thus achieving lentiviral packaging.

[0107] 2. Preparation of pseudovirus concentrate

[0108] After approximately 48 hours of culture, the cell culture supernatant was collected to form the lentiviral solution (CEA-CAR group and CEA-OE-CAR group). To achieve efficient infection, the lentiviral solution was concentrated. After filtering the lentiviral solution with a 0.45 μm filter membrane to remove cell debris, the concentration system was configured according to the following table:

[0109] 10 mL of the filtered culture supernatant, 3 mL of 50% (w / v) PEG6000, 1.28 mL of 4M NaCl, and 1.37 mL of 1×PBS were added.

[0110] Mix the prepared concentrated solution by inversion and place at 4°C overnight. Centrifuge the solution at 4000 rcf for 40 minutes at 4°C. Carefully remove the supernatant and add one-thirtieth of the original KBM581 medium. Resuspend the pellet to obtain the pseudovirus concentrate (30x concentrated). This can be used for direct infection or frozen at -80°C.

[0111] Example 3 Preparation of CAR-T cells

[0112] 1. Extraction of peripheral blood mononuclear cells (PBMC) from healthy subjects.

[0113] (1) 50 ml of peripheral blood was collected from healthy volunteers using EDTA anticoagulant tubes;

[0114] (2) Centrifugation at 450 g for 10 minutes at room temperature to separate the upper plasma layer from the lower blood cell layer;

[0115] (3) After collecting the upper plasma layer, dilute the peripheral blood cells in the lower layer with twice the volume of PBS solution;

[0116] (4) Take a 50 mL centrifuge tube, add approximately 25 mL of human peripheral blood lymphocyte separation fluid (hereinafter referred to as separation fluid), and use a Pasteur pipette to slowly add the diluted blood cells along the junction of the tube wall and the liquid surface to the top of the separation fluid, and avoid mixing the separation fluid and the blood sample;

[0117] (5) Centrifuge at 1440 rcf for 25 minutes at room temperature, setting the speed to 2 and then to 0;

[0118] (6) After centrifugation, use a sterile Pasteur pipette to aspirate the thin white layer of mononuclear cells in the middle into a new centrifuge tube, add excess PBS to wash the cells twice, and the resulting cell pellet is human PBMC.

[0119] 2. CD8 in PBMC + Sorting and enrichment of T cells.

[0120] (1) Count the obtained human PBMCs and resuspend the cells in PBS to a cell concentration of 5×10 7 cells / mL;

[0121] (2) Add 75 μL of biotin-coupled CD8 + T lymphocyte enrichment cocktail (Reagent in Human CD8 T Lymphocyte Enrichment Set, BD) and incubated on ice for 15 min;

[0122] (3) Add excess PBS to wash the unbound cocktail and centrifuge at 450 g for 5 minutes at room temperature;

[0123] (4) After removing the supernatant, thoroughly vortex the streptavidin-coupled magnetic beads and add an equal amount of magnetic beads to the cocktail to resuspend the cell pellet. Incubate at room temperature for 30 minutes, mixing every 10 minutes.

[0124] (5) Add 1-2 mL of PBS to dilute the cell suspension and transfer it to a clean flow cytometry tube. Place it on a cell sorting magnetic stand for 6-8 minutes until the magnetic beads are fully bound to the tube wall.

[0125] (6) Carefully aspirate the liquid in the tube into a new flow tube and place it on the magnetic stand for 6-8 minutes to completely remove the magnetic beads. The remaining cells in the cell suspension are high-purity CD8 + T cells.

[0126] 3. Lentivirus infection of activated T cells.

[0127] (1) Resuspend the obtained CD8 + T cells, 1×10 6 The concentration of 1 μg / mL was plated in a 12-well plate, 1 mL of the system was added to each well, and anti-human CD3 and CD28 antibodies were added to activate CD8 + T cells;

[0128] (2) The CEA-CAR and CEA-OE-CAR lentiviral concentrates packaged in Example 2 were diluted 4-fold with KBM581 medium and dispensed into each well at 1 mL per well. Polybrene was then added to each well at a final concentration of 6 μg / mL and mixed thoroughly.

[0129] (3) Centrifuge at 500 g at 30°C for 90 minutes, set the speed to 2 gears, and then to 2 gears. After centrifugation, place the cells in a 37°C cell culture incubator and culture overnight.

[0130] (4) After 8–12 hours, carefully collect the cells to prevent PEG 6000 deposited at the bottom of the well from being carried into new wells. Discard the medium containing the lentivirus and replace it with fresh KBM581 complete medium.

[0131] (5) Count cells, based on 5×10 5 / mL concentration was plated into a new 12-well plate, 1mL system per well, IL-2 was added for expansion culture, and fresh KBM581 medium containing IL-2 was added or half-changed every other day to maintain the growth and expansion of CAR-T cells.

[0132] Example 4 Examination of the infection efficiency of CAR-T cells

[0133] 1. Flow cytometry to examine the infection efficiency of CAR-T cells

[0134] 1. Experimental methods

[0135] On the third day after the lentiviral infection activated T cells in Example 3, the uninfected CD8 +T cells (Control group) and infected CAR-T cells (CEA-CAR group and CEA-OE-CAR group) were resuspended in a premix of Fixable Viability Dye (FVD) and anti-hCD8 antibody prepared in PBS buffer and stained on ice or at 4 degrees for half an hour for labeling. After adding excess PBS to wash the antibodies, the cells were resuspended in 200 μL PBS and analyzed by an analyzer to detect the expression of mCherry in infected T cells.

[0136] 2. Experimental results

[0137] like Figure 4 As shown, the detection found that CD8 + In T cell subsets, compared with the Control group, the expression of mCherry in the CEA-CAR group and CEA-OE-CAR group was significantly increased, and the positive rate was about 30%, that is, the infection efficiency was about 30%.

[0138] 2. qPCR detection of CEA-scFv and UHRF1 expression

[0139] On the third day after the lentiviral infection of activated T cells in Example 3, 1×10 6 After removing the culture medium from T cells, 1 ml of Trizol reagent was added, and the cellular RNA was extracted by the phenol-chloroform method. The cDNA was obtained using the 1st Strand cDNA Synthsis Kit (Novozymes) for quantitative detection by qPCR.

[0140] The primers are as follows:

[0141] ceascfv-F:AGAGCAAGCAACCTCGAGTC;

[0142] ceascfv-R: TGGCCAAATGTGTAGGGGTC;

[0143] hu-uhrf1-F:GCCATACCCTCTCGACTACG;

[0144] hu-uhrf1-R: GCCCCAATTCCGTCTCATCC.

[0145] 2. Experimental results

[0146] like Figure 5 A and Figure 5As shown in Figure B, compared to the control group, where no CEA-scFv expression was detected, both groups of CAR-T cells (CEA-CAR group and CEA-OE-CAR group) expressed CEA-scFv to a certain extent, thus achieving the construction of CAR-T cells. Furthermore, compared to the CEA-CAR group, the expression levels of CEA-scFv and UHRF1 in the CEA-OE-CAR group were significantly increased, thus achieving the goal of overexpressing UHRF1.

[0147] 3. Detection of UHRF1 expression by Western blotting

[0148] On the third day after the lentivirus infection of activated T cells in Example 3, 1×10 6 After removing the culture medium from T cells and washing them once with PBS, the cells were lysed to obtain intracellular denatured proteins. The proteins were separated by SDS-PAGE electrophoresis and transferred to the NC membrane. After blocking and washing the membrane, a 1:1000 diluted primary antibody corresponding to the detection protein was added and incubated overnight at 4°C. Then, a secondary antibody corresponding to the primary antibody species was added and incubated at room temperature for 1 hour and imaging was performed.

[0149] 2. Experimental results

[0150] like Figure 5 As shown in C, the expression level of UHRF1 in the CEA-OE-CAR group was much higher than that in the other groups, confirming the overexpression of UHRF1 at the protein level.

[0151] Example 5 Effect of Overexpression of UHRF1 on CAR-T Cells

[0152] 1. Effect of UHRF1 overexpression on the absolute number of CAR-T cells

[0153] 1. Experimental methods

[0154] On the fourth day after the lentiviral infection and activation of T cells in Example 3, the CAR-T cells in each well were collected and completely resuspended, and were counted using a fully automatic cell counter to analyze the absolute number of cells in each well.

[0155] 2. Experimental results

[0156] The results are as follows Figure 6 As shown in A, compared with the CEA-CAR group, the number of cells in the CEA-OE-CAR group increased significantly, indicating that the cells in the CEA-OE-CAR group had stronger proliferation ability, and overexpression of UHRF1 enhanced the proliferation ability of CAR-T cells.

[0157] 2. Effect of UHRF1 overexpression on CAR-T cell proliferation indicators

[0158] 1. Experimental methods

[0159] On the 7th day after the lentiviral infection and activation of T cells in Example 3, the cultured CAR-T cells were collected for flow cytometry analysis.

[0160] (1) Sample processing: On the 7th day of in vitro culture, the cell suspensions of each group in the 12-well plate were mixed and counted, and 1×10 6 Transfer CAR-T cells to a clean EP tube and resuspend the cells with 50 μL PBS;

[0161] (2) Labeling cell surface antibodies: Add cell surface molecule flow cytometry antibodies of corresponding dilution ratio to each group of sample tubes and incubate in the dark at 4 degrees for 30 minutes. In this experiment, the flow cytometry antibodies are FVD, anti-CD8 and anti-CD98;

[0162] (3) Washing: Add 1 mL of PBS buffer to each tube, mix thoroughly, centrifuge at 450 g for 5 minutes at room temperature, and discard the supernatant;

[0163] (4) Fixation and permeabilization: Use Foxp3 / Transcription Factor Staining Buffer Set to fix and permeabilize cell surface molecules. Prepare 1× fixative according to the kit instructions. Add 200 μL of 1× fixative to each tube and let it stand overnight at 4°C. Then, add 1 mL of 1× permeabilization buffer to each tube and resuspend and mix. Centrifuge at 450 g for 5 minutes at room temperature, discard the supernatant, and resuspend the cells with 50 μL of 1× permeabilization buffer. Subsequent antibody labeling must be performed in the 1× permeabilization buffer.

[0164] (5) Labeling intracellular antibodies: Add intracellular molecule flow cytometry antibodies of corresponding dilution ratio to each group of sample tubes and incubate in the dark at 4 degrees for 30 minutes. The flow cytometry antibody is anti-Ki67;

[0165] (6) Detection and analysis: Resuspend the labeled cells in 200 μL PBS buffer and analyze them on a flow cytometer. Flowjo V10 software was used to analyze CD8 + Molecular expression in T cell subsets.

[0166] 2. Experimental results

[0167] The results are as follows Figure 6 B and Figure 6As shown in Figure C, compared to the CEA-CAR group, the UHRF1-overexpressing CEA-OE-CAR group showed significantly elevated levels of CD98 and Ki67. Ki67 is a cell proliferation-related transcription factor that indicates the cell's proliferative potential; CD98 is a surface molecule highly expressed in actively proliferating cells, responsible for amino acid transport and indicating the cell's proliferation strength. This further confirmed at the molecular level that UHRF1 overexpression enhances the proliferation capacity of CAR-T cells.

[0168] 3. Detection of CAR-T Cell Function

[0169] 1. Experimental methods

[0170] On the 7th day after the lentiviral infection and activation of T cells in Example 3, the cultured CAR-T cells were collected for flow cytometry analysis.

[0171] (1) In vitro reactivation: On the 7th day of in vitro culture, the cell suspensions of each group in the 12-well plate were mixed and counted, and 1×10 6 CAR-T cells were cultured in RPMI1640 complete medium and incubated with Cell Stimulation Cocktail (plus protein transport inhibitors) (500X) for 6 hours;

[0172] (2) Antibody labeling: The restimulated samples were collected according to the method described in Example 4 and stained for cell surface markers, and FVD and anti-CD8 were labeled;

[0173] (3) Fixation and permeabilization: Use the Intracellular Fixation & Permeabilization Buffer Set to fix and permeabilize cell surface molecules. Resuspend the cells with 200 μL IC buffer and fix them at 4°C overnight. Add 1 mL of 1× permeabilization buffer to each tube and resuspend and mix thoroughly. Centrifuge at 450 g for 5 minutes at room temperature, discard the supernatant, and resuspend the cells with 50 μL of 1× permeabilization buffer. Subsequent antibody labeling must be performed in the 1× permeabilization buffer environment.

[0174] (4) Labeling intracellular antibodies: Add intracellular molecule flow cytometry antibodies of corresponding dilution ratio to each group of sample tubes and incubate in the dark at 4 degrees for 30 minutes. The flow cytometry antibodies are anti-IL-2, anti-GZMB, and anti-TCF1.

[0175] (5) Detection and analysis were performed according to the method described in Example 4.

[0176] 2. Experimental results

[0177] The results are as follows Figure 7As shown in Figure 2, compared with the CEA-CAR group, the secretion of cytokines such as GZMB and IL-2, which play an important role in immune response and effector killing, was increased in the CEA-OE-CAR group ( Figure 7 A and Figure 7 -B), and the expression of the functional effect-related transcription factor TCF-1 was also elevated in the CEA-OE-CAR group cells ( Figure 7 C), indicating that the immune function of the CEA-OE-CAR group was significantly better than that of the CEA-CAR group. Overexpression of UHRF1 affected the function of CAR-T cells, enhancing the immune response and effector killing function of CAR-T cells.

[0178] Example 6: Expression of UHRF1 enhances CAR-T cell killing ability

[0179] 1. Effect of UHRF1 expression on the killing efficiency of CAR-T cells in vitro

[0180] 1. Experimental methods

[0181] On the 7th day of in vitro culture, the cultured CAR-T cells were collected for killing experiments.

[0182] (1) Cell preparation: DMEM high-glucose complete medium is used to culture CEA + Collect LS174T human colorectal cancer cell line cells, count the cells and adjust the LS174T cell density to 2 × 10 5 / mL; collect the cultured CAR-T cells from each group and adjust the CAR-T cell density to 3x10 6 / mL;

[0183] (2) Cell plating: cells were plated at a ratio of 16:1 (1.6×10 5 CAR-T: 10 4 LS 174T), 8:1(8×10 4 CAR-T: 10 4 LS174T), 4:1(4×10 4 CAR-T: 10 4 LS 174T), 2:1(2×10 4 CAR-T: 10 4 LS174T) were mixed and added to a total volume of 150 μL. The background control group received an equal volume of KBM581 medium; the volume correction control group received an equal volume of KBM581 medium; the effector cell self-release group received only an equal amount of CAR-T cells and the volume was filled with KBM581 medium; the target cell self-release group received 10 4 target cells; the maximum release group of target cells is 10 4Each group has 3 secondary wells;

[0184] (3) Cell incubation: After adding the sample, centrifuge at 500 rcf for 3 minutes at room temperature. Incubate at the bottom of a U-bottom 96-well plate. Incubate at 37°C in a culture incubator for 24 hours.

[0185] (4) Cell lysis: The next day, 16.5 μL of 10× cell lysis buffer was added to the target cell maximum release group and volume correction control group and incubated for another 1 hour;

[0186] (5) Cell sampling and detection: Before sampling, the culture plate was centrifuged at 500g for 5 minutes at room temperature. Subsequently, 30 μL of supernatant was transferred from each well to a new flat-bottom 96-well plate, and 30 μL of LDH reaction substrate was added. After reacting at room temperature in the dark for 30 minutes, 30 μL of stop solution was added and the absorbance reading at 490 nm was detected. The specific killing efficiency of CAR-T cells against target cells was calculated using the following formula.

[0187]

[0188] 2. Experimental results

[0189] The results are as follows Figure 8 As shown in Figure A, as the ratio of CAR-T cells to LS174T target cells increases, the specific killing rate also increases; and the specific killing rate of the CEA-OE-CAR group is significantly higher than that of the CEA-CAR group. This shows that the specific killing ability of cells in the CEA-OE-CAR group is significantly higher than that of cells in the CEA-CAR group. In other words, the in vitro killing experiment shows that overexpressing UHRF1 can significantly enhance the anti-tumor ability of CAR-T cells.

[0190] 2. Effect of cytokine release by UHRF1-expressing CAR-T cells

[0191] 1. Experimental methods

[0192] On the 7th day of in vitro culture, the cultured CAR-T cells were collected and their IFNγ secretion was detected by ELISPOT assay. The ELISPOT assay was performed using Human IFN-γ Precoated ELISPOT Kit (Dayou). The specific steps were referred to the kit instructions. The stimulus was 10 4 LS174T target cells were used, and different concentrations of CAR-T cells were added to the effector target cell groups with different ratios. After incubation and color development, the IFNγ secretion at the single-cell level was detected by counting the spots.

[0193] 2. Experimental results

[0194] The results are as follows Figure 8As shown in Figure 2, as the ratio of CAR-T cells to LS174T target cells increased, the number of cells secreting IFNγ also increased with the increase of concentration, showing effector activity; and the IFNγ in the CEA-OE-CAR group + The cell numbers were higher than those in the CEA-CAR group, showing significantly enhanced effector ability, indicating that CAR-T cells overexpressing UHRF1 have stronger effector ability and a higher anti-tumor response rate.

[0195] Example 7 Overexpression of UHRF1 improves the anti-tumor ability of CAR-T cells

[0196] 1. Experimental Methods

[0197] The phenomenon that overexpression of UHRF1 improves the anti-tumor ability of CAR-T cells was verified in vivo through the construction of a humanized tumor model and adoptive transfer experiments.

[0198] (1) In vivo model construction: Resuscitated human colorectal cancer cell line LS174T cells were cultured and expanded; after digestion and discarding the culture medium, the cultured LS174T cells were washed with PBS and counted, and then resuspended with PBS to a cell concentration of 6×10 6 / mL; several 6-8 week old Nod / scid mice of similar weight were selected, the right inguinal tumor-bearing site was shaved and 100 μL of the prepared tumor cell suspension was injected subcutaneously per mouse. A tumor model was successfully established when a spherical swelling appeared under the skin.

[0199] (2) CAR-T adoptive transfusion: About 7 days after tumor loading or when the mean tumor volume reaches 100, the in vitro expanded CAR-T cells are transfused into the mice in groups. Before transfusion, they are treated once with human peripheral blood lymphocyte separation medium to remove impurities. Each mouse is transfused with 1x10 6 cell.

[0200] (3) Plotting tumor growth curves: Measure the tumor size of mice on the day of infusion and every other day after infusion until the tumor size reaches the humane endpoint, and then euthanize the experimental mice. Tumor size is calculated using the following formula (where a and b represent length and width, respectively):

[0201]

[0202] (4) The spleen tissue of the experimental mice was collected, ground and digested to obtain a single cell suspension for flow cytometry as described above to detect the expression of UHRF1 in CAR-T cells in vivo. In this embodiment, the flow cytometry antibodies were FVD, anti-CD8, and anti-UHRF1.

[0203] 2. Experimental Results

[0204] The results are as follows Figure 9 As shown in Figure A, after CAR-T cell infusion, tumor growth in mice in the UHRF1-overexpressing CEA-OE-CAR group was significantly slowed and inhibited compared to the CEA-CAR group. Tumors in mice infused with CEA-CAR cells reached the humane endpoint within 15 days, while those infused with CEA-OE-CAR cells took 21 days to reach the humane endpoint. In vivo experiments demonstrated that CAR-T cells overexpressing UHRF1 possessed enhanced anti-tumor activity and were able to better inhibit tumor growth.

[0205] And, as Figure 9 As shown in Figure B, cells in the UHRF1-overexpressing CEA-OE-CAR group maintained overexpression of UHRF1 after reinfusion. Compared with the CEA-CAR group, the expression of UHRF1 in the spleen of mice in the CEA-OE-CAR group was significantly increased after reinfusion.

[0206] Example 8 Effect of UHRF1 Expression on Tumor-Infiltrating CAR-T Cells

[0207] 1. Experimental Methods

[0208] A tumor and transfusion model was established using the method of Example 7. Approximately 8 days after transfusion, when the tumor volume fraction reached approximately 800, the spleen was ground and the tumor digested to obtain a single-cell suspension. Tumor-infiltrating CAR-T cells in each group of mice were then analyzed by flow cytometry for proliferation, function, and apoptosis, using the method of Example 4. Apoptosis detection was performed in 1× Annexin V binding buffer.

[0209] 2. Experimental Results

[0210] The results are as follows Figure 10 As shown in A, the Ki67 expression in the CEA-OE-CAR group was significantly higher than that in the CEA-CAR group, indicating that CAR-T cells overexpressing UHRF1 also have stronger proliferation ability after infiltration into the tumor microenvironment after reinfusion; Figure 10 As shown in B, the positive rate of Annexin V in the CEA-OE-CAR group was significantly lower than that in the CEA-CAR group, indicating that CAR-T cells overexpressing UHRF1 were less likely to undergo apoptosis when infiltrating into the tumor microenvironment after reinfusion. That is, compared with the CEA-CAR group, the CEA-OE-CAR group had reduced apoptosis, enhanced proliferation ability, and better survival ability.

[0211] like Figure 11As shown in the results, the secretion capacity of function-related cytokines such as IFN-γ, GZMB, IL-2, and TNF-α in the CEA-OE-CAR group was significantly enhanced compared with the CEA-CAR group, indicating that compared with the CEA-CAR group, CAR-T cells overexpressing UHRF1 had a more active immune response and stronger effector capacity when infiltrating into the tumor microenvironment after reinfusion. In other words, overexpression of UHRF1 improved the survival and effector capacity of CEA-CAR-T cells in vivo, enhancing their anti-tumor ability.

Claims

1. Use of a plasmid in preparing a product for CAR-T cell therapy of solid tumors, characterized in that: The plasmid contains a nucleic acid molecule encoding UHRF1 protein and a nucleic acid molecule encoding a CAR chimeric antigen receptor domain, and the CAR-T cell is a CD8 + T cell subset cells, wherein the CAR-T cells are CAR-T cells targeting carcinoembryonic antigen CEA.

2. Use of a recombinant lentivirus in the preparation of a product for CAR-T cell therapy of solid tumors, characterized in that: The recombinant lentivirus carries a nucleic acid molecule encoding UHRF1 protein and a nucleic acid molecule encoding a CAR chimeric antigen receptor domain, and the CAR-T cell is a CD8 + T cell subset cells, wherein the CAR-T cells are CAR-T cells targeting carcinoembryonic antigen CEA.

3. A method for constructing CAR-T cells, characterized in that: The recombinant lentivirus of claim 2 is used to infect T cells, wherein the CAR-T cells are CD8 + T cell subset cells, wherein the CAR-T cells are CAR-T cells targeting carcinoembryonic antigen CEA.

4. A CAR-T cell, characterized in that: The CAR-T cells are CAR-T cells that overexpress UHRF1 protein obtained by infecting T cells with the recombinant lentivirus described in claim 2, and the CAR-T cells are CD8 + T cell subset cells, wherein the CAR-T cells are CAR-T cells targeting carcinoembryonic antigen CEA.

5. The use of the CAR-T cells according to claim 4 in preparing a product for treating solid tumors, characterized in that: The CAR-T cells are CD8 + T cell subset cells, wherein the CAR-T cells are CAR-T cells targeting carcinoembryonic antigen CEA.

Images