A single domain antibody targeting HLA-DRB5 and its application

Abstract

The present invention belongs to the field of biotechnology, and discloses a single-domain antibody targeting HLA-DRB5 and its application. The amino acid sequence of the single-domain antibody targeting HLA-DRB5 of the present invention is: any sequence shown in SEQ ID NO.3, 5, 7, 9, 11, 13, 15, 17, 19, 21. The single-domain antibody targeting HLA-DRB5 of the present invention has good tissue penetration, high specificity, good water solubility, high stability, and low storage condition requirements. It can be used to diagnose changes in HLA-DRB5 expression and treat related diseases caused by increased HLA-DRB5 expression.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a single domain antibody targeting HLA-DRB5 and an application thereof. Background Art

[0002] Human leukocyte antigen (HLA) and histocompatibility complex (MHC) antibodies play an important role in immunopeptidomics, and high-performance liquid chromatography-tandem mass spectrometry has facilitated the identification and characterization of new antigens. HLA is a glycoprotein encoded by MHC that specifically delivers short peptides to T cells and plays a key role in the body's immune defense.

[0003] HLA-DRB5 belongs to the HLA class II beta chain paralog gene. This class II molecule expressed in antigen presenting cells (B lymphocytes, dendritic cells, macrophages, etc.) is a heterodimer composed of one alpha (DRA) chain and one beta (DRB) chain, both of which are anchored to the membrane. The beta chain is about 26kDa-28kDa, and its gene contains 6 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain, and exon 5 encodes the cytoplasmic tail. In the DR molecule, the beta chain contains all polymorphisms that specify the binding specificity of the peptide. These polymorphisms are usually typed in bone marrow and kidney transplants. The expression level of DRB1 is five times higher than that of its homologs DRB3, DRB4, and DRB5. The presence of DRB5 is associated with allelic variation in DRB1, which is otherwise omitted. Other related genes include: DRB2, DRB6, DRB7, DRB8 and DRB9. It has been found that the gene variation of DRB1 is associated with autoimmune diseases, some inflammatory diseases and cancers, and its correlation with diseases has also been confirmed, while the expression level of DRB5 gene is low and the research technology is limited. Although a few studies have reported that abnormal expression of DRB5 gene can increase the risk of diseases such as type I diabetes, vitiligo and systemic sclerosis, its correlation with diseases is still unclear, and there has been no report on the development and application of single-domain antibodies targeting HLA-DRB5.

[0004] In addition, based on the antigen-antibody reaction, the preparation of antibodies in the existing technology requires animal experiments, and the conditions for the storage and use of the antibodies themselves are relatively harsh and have many unstable factors. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a single domain antibody targeting HLA-DRB5 and its application.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a single domain antibody targeting HLA-DRB5, the amino acid sequence of which is:

[0008] A sequence as shown in any one of SEQ ID NO. 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21.

[0009] The present invention uses HLA-DRB5 recombinant protein to immunize alpaca (Alpaca), and the immunization interval is 14 days. Starting from the second immunization, peripheral blood is collected seven days after each immunization to monitor the titer of immune serum. After the immunization is completed, 100 ml of peripheral blood is collected, PBMC is separated, and the following steps are performed: ① single domain antibody yeast display library construction, ② yeast display library magnetic sorting, ③ yeast display library two-round flow sorting, ④ yeast monoclonal flow detection, ⑤ antibody eukaryotic expression vector construction, ⑥ candidate single domain antibody expression and purification, ⑦ ELISA detection of the binding of recombinant antibodies to target proteins, ⑧ FACS detection of the binding of candidate antibodies to overexpressing cell lines, and ⑨ single domain antibody affinity detection. Finally, the candidate HLA-DRB5 single domain antibody sequence is obtained. The single domain antibody targeting HLA-DRB5 of the present invention has good tissue penetration, high specificity, good water solubility, high stability, and low storage conditions. It can be used to diagnose changes in HLA-DRB5 expression and treat related diseases caused by increased HLA-DRB5 expression.

[0010] In a second aspect, the present invention provides a nucleic acid encoding a single domain antibody targeting HLA-DRB5, the nucleotide sequence of which is:

[0011] A sequence as shown in any one of SEQ ID NO. 4, 6, 8, 10, 12, 14, 16, 18, 20, 22;

[0012] The nucleic acid encodes a single domain antibody targeting HLA-DRB5 with a sequence as shown in any one of SEQ ID NO. 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21.

[0013] In a third aspect, the present invention provides a vector comprising the nucleic acid.

[0014] In a fourth aspect, the present invention provides a cell comprising the vector.

[0015] In a fifth aspect, the present invention provides a method for preparing a single domain antibody targeting HLA-DRB5, comprising the following steps:

[0016] (1) culturing the cells under conditions suitable for expressing the recombinant foreign protein;

[0017] (2) Isolate and purify the protein targeting HLA-DRB5 from cell culture.

[0018] In a sixth aspect, the present invention provides a pharmaceutical composition comprising the single domain antibody targeting HLA-DRB5.

[0019] As a preferred embodiment of the pharmaceutical composition of the present invention, it also includes at least one pharmaceutically acceptable carrier.

[0020] In a seventh aspect, the present invention provides the use of the single domain antibody targeting HLA-DRB5, the nucleic acid, the vector, the cell, the preparation method, and the pharmaceutical composition in any of the following fields, including:

[0021] i. preparing drugs or reagents for treating diseases targeting HLA-DRB5;

[0022] ii. preparing drugs or reagents for diagnosing diseases targeting HLA-DRB5;

[0023] iii. Treatment of diseases for which HLA-DRB5 is the target, for purposes other than diagnosis or treatment of the disease;

[0024] iv. Diagnosis of diseases for which HLA-DRB5 is the target, for purposes other than diagnosis or treatment of diseases;

[0025] v. Detection of HLA-DRB5 expression.

[0026] Preferably, the diseases for which HLA-DRB5 is a target include: Alzheimer's disease, Parkinson's disease, narcolepsy, multiple sclerosis, arthritis, rheumatoid arthritis, Takayasu arteritis, systemic lupus erythematosus, mixed connective tissue disease, autoimmune hepatitis, idiopathic nephropathy, liver fibrosis, graft-versus-host disease, immune thrombocytopenia and other immune-related diseases.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The single-domain antibody targeting HLA-DRB5 of the present invention is a new type of small molecule antibody fragment, which is obtained by cloning the heavy chain variable region (VHH) of the natural heavy chain antibody of camels; it has excellent biological properties, can overcome the disadvantages of large molecular weight of natural antibodies while having complete antigen binding sites, has good tissue penetration, high specificity, and good water solubility; it has the advantages of both traditional antibodies and small molecule drugs, perfectly overcomes the defects of long development cycle, low stability, and harsh storage conditions of traditional antibodies, has high stability, and low storage conditions. The sequences of the various single-domain antibodies targeting HLA-DRB5 described in the present invention can be well combined with HLA-DRB5, and can be used to diagnose or treat diseases with HLA-DRB5 as the target, such as diagnosing changes in HLA-DRB5 expression, and treating related diseases caused by increased HLA-DRB5 expression. And the preparation method is simple and low cost, which can lay a solid foundation for the extensive use of later clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the electrophoresis diagram of the VHH fragment amplification of the yeast display library;

[0030] Figure 2 Electropherograms showing vector linearization for yeast;

[0031] Figure 3 Display library diversity for yeast;

[0032] Figure 4 Results of one round of magnetic sorting for the yeast display library; Figure 4 Middle, A: NC group; B: original library: FITC-V5; C: 1MACS: primary antibody: Biotin-DRB1-His+Bio-DRB4-His, secondary antibody: APC-streptavidin, V5-FITC; D: 1MACS: primary antibody: Biotin-DRB5-His, secondary antibody: APC-streptavidin, V5-FITC;

[0033] Figure 5 Flow sorting results for the yeast display library; Figure 5 Middle, A: NC; B: 1MACS: primary antibody: Biotin-DRB5-His, secondary antibody: APC-streptavidin, V5-FITC (sorted P3, obtained cells: 3005);

[0034] Figure 6 This is the result of yeast monoclonal detection;

[0035] Figure 7 The electrophoresis diagram of the candidate antibody;

[0036] Figure 8 The results of the test for the binding of candidate antibodies to 293F cells;

[0037] Fig. 9 The results of the test for the binding of candidate antibodies to Hela cells;

[0038] Fig.10 The results of the test for binding of candidate antibodies to Jurka cells;

[0039] Fig.11 The results of the test for the binding of candidate antibodies to Raji cells;

[0040] Fig.12 The results of the test for the binding of candidate antibodies to HepG2 cells;

[0041] Fig.13 The results of affinity testing of candidate antibodies. DETAILED DESCRIPTION

[0042] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0043] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0044] Example 1: Alpaca Immunization

[0045] Alpaca (3 years old, 60 kg in weight) was immunized with recombinant protein (HLA-DRB5) (purchased from Solebao, P06281). The interval between immunizations was 14 days. Starting from the second immunization, peripheral blood was collected seven days after each immunization to monitor the titer of immune serum. After the immunization was completed, 100 mL of peripheral blood was collected, PBMC was isolated, and a single domain antibody display library was constructed. The immunization schedule is shown in Table 1:

[0046] Table 1 Immunization schedule

[0047]

[0048] 1.2 Immune titer detection

[0049] (1) Collect 5 mL of peripheral blood from the immune alpaca, place the centrifuge tube containing the blood sample in a 37°C incubator for 1 hour; then transfer the blood sample to 4°C overnight; (2) Place the centrifuge tube containing the blood sample in a centrifuge and centrifuge at 5000 rpm for 20 minutes; separate the upper serum, transfer the serum to a new sterile centrifuge tube, and collect the immune serum. (3) Use sterile CBS (carbonate buffer) to dilute the target recombinant protein to a final concentration of 1 µg / mL. Take a new 96-well ELISA plate, add 100 μL / well of antigen HLA-DRB5 and coat it at 4°C overnight. (4) Remove the antigen coating solution and wash 5 times with PBST (containing 0.05% Tween 20). (5) Add 200 μL / well of 3% MPBS and block at 37℃ for 2 hours; (6) After removing the blocking buffer, wash the plate 5 times with PBST; (7) Add 100 μL of serially diluted serum (100 μL / well) and incubate at room temperature for 1 hour. The control well is PBS; (8) Remove the liquid in the well and wash 5 times with PBST; (9) Add 100 μL of HRP anti-Llama IgG (H+L) antibody (1:50000 dilution) (purchased from Novus, AT# NB7242) and incubate at room temperature for 1 hour; (10) After removing the liquid in the well, wash the plate 5 times with PBST; (11) Add 100 μL / well of TMB colorimetric solution; (12) Incubate at room temperature in the dark for 10-15 minutes; (13) Add 50 μL / well of stop solution; (14) Read the OD in the well using an ELISA reader 450 value.

[0050] The results of the immune titer ELISA test are shown in Table 2:

[0051] Table 2 Test results

[0052]

[0053] The serum was separated from the immune alpaca, and the limiting dilution was performed according to the dilution gradient shown in the figure, and the ELISA experiment was performed on the 96-well plate pre-coated with the antigen. According to the ELISA test results, the immune serum can bind to the target recombinant protein, and with the gradient dilution of the immune serum, the OD value changes in a gradient, and the serum titer reaches 1:64K. The titer of the alpaca serum is significantly improved to meet the requirements of blood collection and library construction. Subsequently, 100mL of peripheral blood was collected for the construction of the antibody display library.

[0054] Example 2: Construction of yeast display library

[0055] 1. PBMC isolation and VHH antibody fragment cloning

[0056] (1) Collect 100 mL of peripheral blood from the immunized alpaca in Example 1, and separate PBMC using lymphocyte separation solution.

[0057] (2) Extract RNA and perform reverse transcription using PrimeScript™ II 1st Strand cDNA Synthesis Kit (purchased from TaKaRa, CAT# 6210B) to prepare cDNA.

[0058] 1) Prepare the following reaction mixture Mix 1 in 200 μL PCR;

[0059] Table 3 Reaction mixture

[0060]

[0061] 2) Keep at 65 °C for 5 min and then cool rapidly on ice;

[0062] 3) Prepare the following reaction mixture in the above PCR tube;

[0063] Table 4 Reaction mixture

[0064]

[0065] 4) After mixing by pipetting, aliquot into 80 μL / tube, place in a PCR instrument at 42°C for 1 hour, heat inactivate at 70°C for 15 minutes, and finally place the cDNA sample on ice or at -20°C for long-term storage.

[0066] (3) Amplification of VHH fragments

[0067] 1) Prepare the first round of PCR reaction system (50 μL / tube): the upstream primer binds to the signal peptide, and the downstream primer binds to the CH2 region.

[0068] Upstream primer: 5′ GTCCTGGCTGCTCTTCTACAAGG 3′;

[0069] Downstream primer: 5' GGTACGTGCTGTTGAACTGTTCC 3'.

[0070] Table 5 PCR reaction system

[0071]

[0072] After configuring the PCR reaction system, set up the PCR instrument as follows:

[0073] Table 6 PCR reaction program

[0074]

[0075] 2) Agarose electrophoresis of PCR products

[0076] 1% agarose gel electrophoresis was used to analyze the PCR products and the fragments with a molecular weight of about 750 bp were separated. The PCR products were recovered using a gel recovery kit and the concentration was determined using NanoDrop.

[0077] 3) Configure the second-round PCR reaction system (50 μL / tube): the upstream primer binds to the antibody FR1 region, the downstream primer binds to the antibody Hinge and FR4 regions, and the restriction site is SfiI.

[0078] Upstream primer: 5′ AGKTGCAGCTCGTGGAGTCNGGNGG 3′;

[0079] Downstream primer: 5′ GATCACTAGTGGGGTCTTCGCTGTGGTGCG 3′.

[0080] Table 7 PCR reaction system

[0081]

[0082] After configuring the PCR reaction system, set up the PCR instrument as follows:

[0083] Table 8 PCR reaction program

[0084]

[0085] 4) Agarose electrophoresis analysis of the second-round PCR products

[0086] PCR products were analyzed by electrophoresis using 1% agarose gel to separate VHH fragments with a molecular weight of about 400 bp. VHH PCR products were recovered using a gel recovery kit and the concentration was determined using NanoDrop.

[0087] 5) PCR product precipitation

[0088] Aliquot 200 μL of the recovered three-round PCR products into each 1.5 mL centrifuge tube, add 1 / 10 volume (20 μL) of 3 M sodium acetate and 1 μg / μL glycogen, pipette to mix, add 880 μL of anhydrous ethanol, invert to mix, and freeze at -80°C.

[0089] The electrophoresis diagram of the amplified VHH fragment of the yeast display library is shown in Figure 1As shown. Peripheral blood was collected to separate PBMC cells, and RNA was extracted and a reverse transcription kit was used to prepare a cDNA library. Single-domain antibody amplification primers were used for 1 round of PCR, and the results of PCR products were analyzed by agarose gel electrophoresis. In the first round of PCR, PCR bands of about 1000 bp and 750 bp were obtained, and the 750 bp fragment was recovered as a template for the second round of PCR; the second round of PCR obtained a band of about 400 bp, which was a VHH fragment. The third round of PCR obtained a band of about 500 bp, which was a fragment with added homology arms.

[0090] 2. Linearization of yeast display vector pYDisplay (purchased from iCareab)

[0091] Use SfiI to digest the pYDisplay vector, aliquot 100 μL / tube, and digest at 50 °C overnight; the digestion system is as follows:

[0092] Table 9 Enzyme Digestion System

[0093]

[0094] 1) Separate the pYDisplay vector fragment using 1% agarose gel, cut out a 5000 bp vector fragment for gel recovery, and determine the concentration using NanoDrop;

[0095] 2) Aliquot 200 μL of the recovered pYDisplay digestion product into each 1.5 mL centrifuge tube, add 1 / 10 volume (20 μL) of 3 M sodium acetate and 1 μg / μL glycogen, pipette to mix, add 880 μL of anhydrous ethanol, invert to mix, and freeze at -80 °C.

[0096] The linearized electrophoresis of yeast display vector pYDisplay is shown in Figure 2 ( Figure 2 The left band in the middle is the pYDisplay linearized band, and the right band is the DNA electrophoresis marker band). Subsequently, the obtained VHH fragments with added recombinant arms were electroporated into EBY100 with the yeast display vector.

[0097] 3. Electroporation to construct yeast display library

[0098] (1) Streak the yeast competent strain frozen at -80 °C onto a YPD solid medium plate and activate at 30 °C for 3-5 days;

[0099] (2) Inoculate a single colony of competent yeast into 50 mL of YPD medium and shake at 250 rpm and 30°C for 1-2 days;

[0100] (3) Prepare yeast competent strains. Mix the linearized vector fragment and three-round PCR products, add them to the electroporation cup, and electroporate. After electroporation, shake the yeast competent transfection culture bottle at 220 rpm and 30°C for 1 h.

[0101] (4) Take 20 μL of the resuspension, dilute it 5000 times with SDCAA, take 100 μL, apply it to the SDCAA plate, culture it for 2-3 days, calculate the reservoir capacity, and continue to culture the rest of the bacterial solution for 24 h;

[0102] (5) Preservation of bacteria: Collect the remaining bacterial liquid into a 50 mL centrifuge tube, centrifuge at 3000 x g for 5 min, discard the supernatant, add 10 mL of SDCAA to resuspend, mix with 50% glycerol: resuspension solution in a ratio of 1:1, and freeze at -80°C.

[0103] 50 single clones were randomly selected for sequencing to analyze the diversity of the yeast display library. Figure 3 As shown: According to the sequencing results, after removing the double-peak frameshift sequence, the remaining clones are all antibody difference sequences, and the library diversity is good; the yeast display library capacity is: 2.66×10 9 .

[0104] Example 3: Magnetic sorting of yeast display library

[0105] (1) The yeast cultured in SDCAA of Example 2 was added to a 250 mL shake flask containing 50 mL SGCAA medium and cultured in a shaker at 30°C and 240 rpm for 16 h.

[0106] (2) After centrifugation, discard the supernatant, resuspend with 1 mL of 0.5% PBSA, add to a 1.5 mL centrifuge tube, centrifuge at 3000 g for 5 min, discard the supernatant, and wash again with 0.5% PBSA.

[0107] (3) Wash the streptavidin magnetic beads incubated with the antigen twice with 0.5% PBSA (rotating and incubating at 4°C for 5 minutes each time), place them on a magnetic rack for 5 minutes, and discard the supernatant.

[0108] (4) Add the yeast solution to the antigen-bound magnetic beads, incubate with rotation at 4°C for 60 min, and place on a magnetic rack for 15 min.

[0109] (5) Discard the yeast solution and retain the magnetic beads, then wash three times with 0.5% PBSA (rotating and incubating at 4°C for 5 minutes each time).

[0110] (6) Resuspend the magnetic beads in 1 mL of SDCAA medium, pipette 0.5 μL-5 μL of the resuspension into 100 μL of SDCAA medium and spread on a plate. Divide the resuspension into two portions, add 500 μL of 50% glycerol (stored at -80°C) to one portion, add the other portion to a shaking tube, add 2 mL of SDCAA medium, and culture at 30°C, 240 rpm for 16 h.

[0111] (7) Transfer the bacterial solution in the shake tube into 50 mL SDCAA medium (250 mL shake flask) and culture overnight at 30°C and 240 rpm.

[0112] (8) Measure the OD600 value of the bacterial solution. Centrifuge a portion of the bacterial solution according to the OD600 value, resuspend it in SGCAA, and transfer it to 50 mL SGCAA culture medium to make the final OD600 value 1. Culture it overnight at 30°C and 240 rpm. Resuspend the remaining bacterial solution in SDCAA:50% glycerol = 1:1 and freeze it at -80°C.

[0113] After negative selection and blocking using DRB1, DRB3, and DRB4 proteins in a round of magnetic sorting, DRB5 was used for positive selection; according to the flow cytometry detection results, after one round of magnetic sorting, the positive proportion of DRB1+DRB4 in the display library was 5.27%, and the positive proportion of DRB5 was 1.56%. The blocking of one round of magnetic sorting was not thorough, and after blocking again using DRB1, DRB3, and DRB4 proteins, DRB5 protein was used for subsequent flow sorting.

[0114] Example 4: Yeast display library second round sorting

[0115] (1) Take 1 ml of the yeast cultured with SGCAA in Example 3 into a 1.5 ml centrifuge tube, centrifuge and remove the supernatant, wash twice with 1 ml PBS, resuspend with 1 ml PBS, take 100 ul of the yeast culture into a new 1.5 ml centrifuge tube (as NC), centrifuge and remove the supernatant.

[0116] (2) Dilute the Biotin-antigen protein with 100 μL PBS to a concentration of 10 μg / mL, resuspend the experimental group bacteria, incubate with rotation at 4°C for 60 min, centrifuge at 3000g for 3 min, discard the supernatant, and wash twice with 1 ml PBS.

[0117] (3) Dilute APC-Streptavidin at 1:1000 and resuspend the experimental group bacteria. Incubate with rotation at 4°C for 60 min. Centrifuge at 3000g for 3 min. Discard the supernatant, wash twice with 1 ml PBS, and resuspend with 1 ml PBS.

[0118] (4) Add the resuspended bacteria to the flow cytometry tube for flow cytometry.

[0119] (5) Prepare 1 ml of SDCAA medium in a 15 ml centrifuge tube as a collection tube.

[0120] (6) Put the flow cytometer on and adjust the gate with the NC group to sort the APC-positive yeast.

[0121] After blocking again with DRB1, DRB3, and DRB4 proteins, flow cytometry was used to select DRB5 protein, and 3005 cells were obtained. Due to the small number of cells, single clones were directly selected for yeast monoclonal flow cytometry detection.

[0122] Example 5: Flow cytometry detection of yeast monoclonal

[0123] The yeast liquid after sorting in Example 4 was coated on an SDCAA plate, and a single clone was picked for culture. After inducing expression for 48 hours, it was incubated with Biotin-antigen, and PE-Streptavidin was used as the secondary antibody. After the incubation was completed, flow cytometry was performed. The yeast clones bound to the target antigen were resuspended with 0.2% SDS, incubated at 95°C for 10 minutes for lysis, and the supernatant of the bacterial liquid was obtained by centrifugation. 0.5 μL was taken as a template for PCR amplification and sent for testing (the remaining bacterial liquid was stored at -20°C).

[0124] The positive yeast clones were subjected to PCR to obtain the antibody sequence, which was digested with SfiI and connected to the eukaryotic expression vector pcDNA3.4-human IgG1Fc (Icareab full gene synthesis, the amino acid sequence of human IgG1Fc is shown in SEQIDNO.1, and the nucleotide sequence is shown in SEQIDNO.2) to construct the antibody expression vector. The antibody eukaryotic expression vector was transiently transfected into 293F cells, and the antibody expression supernatant was taken to detect the binding of the candidate antibody and the antigen protein by FACS.

[0125] 1. Construction of antibody eukaryotic expression vector

[0126] Upstream primer: 5′ AGKTGCAGCTCGTGGAGTCNGGNGG 3′;

[0127] Downstream primer: 5′ GATCACTAGTGGGGTCTTCGCTGTGGTGCG 3′.

[0128] Table 10 PCR reaction system

[0129]

[0130] After configuring the PCR reaction system, set up the PCR instrument as follows:

[0131] Table 11 PCR reaction program

[0132]

[0133] 2. Expression and purification of candidate single domain antibodies

[0134] 1) Based on the ELISA test results of the candidate antibodies, select positive clones and prepare the antibody expression;

[0135] 2) Take out LVTransm transfection reagent and pcDNA3.4-human IgG1Fc antibody expression vector from the refrigerator, thaw at room temperature, and mix thoroughly by pipetting up and down. Take out PBS buffer and warm it to room temperature. Take 2mL PBS to one well of a 6-well plate, add 20μg antibody expression vector respectively, mix thoroughly by pipetting up and down, add 60μL LVTransm, and immediately mix thoroughly by pipetting up and down, and let stand at room temperature for 10 minutes;

[0136] 3) Add the above DNA / LVTransm complex to 20mL 293F cells and gently shake to mix thoroughly. Place the cells in an incubator at 37°C, 5% CO2, 130rpm and continue to culture;

[0137] 4) After 5-7 days of continuous culture, collect the culture supernatant by centrifugation, filter with a 0.45 μm filter membrane, transfer the filtrate to a sterile centrifuge tube, and purify the antibody using a Protein A column.

[0138] From the enriched yeast display library, monoclonal cells were randomly selected, and after amplification and induction, antigens were used for detection to determine the binding of single-domain antibodies displayed on the surface of monoclonal yeast cells to the target antigen. The results are as follows Figure 6 shown.

[0139] According to the results of yeast monoclonal flow cytometry, positive clones that bind to DRB5-His but do not bind or weakly bind to DRB1 and DRB4 were selected to extract genomic DNA, and the antibody sequence was obtained by PCR.

[0140] The antibody information is as follows: the amino acid sequence of SDAB22133-106-107-1-B06 is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4; the amino acid sequence of SDAB22133-106-107-1-B10 is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6; the amino acid sequence of SDAB22133-106-107-1-C10 is shown in SEQ ID NO.7, and the nucleotide sequence is shown in SEQ ID NO.8; the amino acid sequence of SDAB22133-106-107-1-E06 is shown in SEQ ID NO.9, and the nucleotide sequence is shown in SEQ ID NO.10; the amino acid sequence of SDAB22133-106-107-1-F02 is shown in SEQ ID NO.11, and the nucleotide sequence is shown in SEQ ID NO.12 ; The amino acid sequence of SDAB22133-106-107-1-F09 is shown in SEQIDNO.13, and the nucleotide sequence is shown in SEQIDNO.14; the amino acid sequence of SDAB22133-106-107-1-G03 is shown in SEQIDNO.15, and the nucleotide sequence is shown in SEQIDNO.16; the amino acid sequence of SDAB22133-106-107-1-G04 is shown in SEQIDNO.17, and the nucleotide sequence is shown in SEQIDNO.18; the amino acid sequence of SDAB22133-106-107-1-G04-3 is shown in SEQIDNO.19, and the nucleotide sequence is shown in SEQIDNO.20; the amino acid sequence of 106-107-1-G09 (negative clone) is shown in SEQIDNO.21, and the nucleotide sequence is shown in SEQIDNO.22.

[0141] According to the sequencing results of PCR products, differential clones were selected and digested to construct eukaryotic expression vectors, and VHH C was fused to express hIgG1Fc. The constructed single-domain antibody eukaryotic expression vector was transiently transfected into 293F cells, and the expressed antibody supernatant was taken for detection.

[0142] Example 6: ELISA detection of binding between recombinant antibodies and target proteins

[0143] 1) Use sterile CBS to dilute the recombinant protein to a final concentration of 1µg / mL. Take a new 96-well ELISA plate, add 100μL / well of antigen HLA-DRB5 and coat overnight at 4°C;

[0144] 2) Remove the antigen coating solution and wash five times with PBST (containing 0.05% Tween 20);

[0145] 3) Add 200 μL / well of 3% MPBS and block at 37°C for 2 hours;

[0146] 4) After removing the blocking buffer, wash the plate 5 times with PBST;

[0147] 5) Add the expressed recombinant antibody, 50 μL / well of transfection supernatant or purified antibody (starting concentration is 10 μg / mL, 3-fold gradient dilution 7 points, 100 μL / well), incubate at room temperature for 1 hour, and the control well is PBS;

[0148] 6) Remove the liquid in the wells and wash 5 times with PBST;

[0149] 7) Add 100 μL / well HRP-Protein A antibody (1:50000 dilution) (purchased from Boster, CAT#BA1080) and incubate at room temperature for 1 hour;

[0150] 8) After removing the liquid in the wells, wash the plate 5 times with PBST;

[0151] 9) Add 100 μL / well TMB colorimetric solution;

[0152] 10) Incubate at room temperature in the dark for 10-15 minutes;

[0153] 11) Add 50 μL / well stop solution;

[0154] 12) Use a microplate reader to read the OD in the well 450 value.

[0155] The results are as follows:

[0156] Table 12 ELISA binding test results of candidate antibodies

[0157]

[0158] According to the experimental data, all candidate antibodies do not bind to the DRB3 protein. Among them, the binding strength of candidate antibodies 106-107-1-B10, 106-107-1-C10, 106-107-1-F02, and 106-107-1-G03 to DRB5 is significantly higher than that to DRB1 and DRB4; the binding activity of candidate antibodies 106-107-1-B06, 106-107-1-E06, 106-107-1-F09, and 106-107-1-G04 to DRB1, DRB4, and DRB5 is equivalent.

[0159] Candidate antibody preparation QC results are as follows Figure 7 As shown, according to the test results, except for 106-107-1-E06, the purity of the remaining antibodies is >90%, which can be used for subsequent verification. No antibody was obtained for 106-107-1-E06 after two expressions.

[0160] Example 7: FACS detection of candidate antibodies binding to tumor cells

[0161] 1) Resuscitate tumor cells from liquid nitrogen and adjust the cell state to the logarithmic growth phase;

[0162] 2) Divide the cells into several portions, with the number of cells in each portion being 2×10 5 cells;

[0163] 3) Incubate the candidate antibody or transfection supernatant with the target cells, mix thoroughly, and incubate at room temperature for 1 hour;

[0164] 4) Centrifuge at 800 x g for 3 minutes at room temperature, remove the supernatant containing antibodies, and wash the cells three times with PBS;

[0165] 5) Add secondary antibody PE anti human IgG (1:5000 dilution) (purchased from eBioscience, Cat#:12-4998-82), mix thoroughly, and incubate at room temperature in the dark for 30 minutes;

[0166] 6) Centrifuge at 800 x g for 3 minutes at room temperature, remove the supernatant containing the secondary antibody, and wash the cells three times with PBS;

[0167] 7) Resuspend the cells in 500 μL PBS and perform flow cytometry analysis.

[0168] The results are as follows Figures 8 to 12 As shown:

[0169] According to the test results, none of the candidate antibodies bind to 293F cells; none of the candidate antibodies bind to Hela cells; all of the candidate antibodies bind weakly to Jurka cells; all of the candidate antibodies bind specifically to Raji cells, among which candidate antibodies 106-107-1-G03 and 106-107-1-G04 bind strongest to Raji cells; candidate antibodies 106-107-1-F02, 106-107-1-F09, 106-107-1-G03, and 106-107-1-G04 bind weakly to HepG2 cells.

[0170] Example 8: Single domain antibody affinity detection

[0171] 1) Antibody affinity was determined using the ForteBio OCTET R2 instrument, and HLADRB5 was immobilized using the HIS1K sensor at a concentration of 5ug / ml and a curing time of 200s;

[0172] 2) The buffer is PBST (PBS + 0.02% tween20), and the candidate antibody is diluted to 10nM, 5nM, 2.5nM, 1.25nM, 0.625nM, 0nM;

[0173] 3) Affinity detection: 60 s of equilibrium, 180 s of binding, 180 s of dissociation, and detection temperature of 25°C;

[0174] 4) Kinetic characterization analysis was performed using the ForteBio OCTET R2 system.

[0175] The results are as follows Fig.13 As shown: The affinity of candidate antibodies 106-107-1-G03 and 106-107-1-G04 to HLA-DRB5 reaches the nm level.

[0176] The single-domain antibody targeting HLA-DRB5 of the present invention is a new type of small molecule antibody fragment, which is obtained by cloning the heavy chain variable region (VHH) of the natural heavy chain antibody of camels; it has excellent biological properties, a molecular weight of 12-15KD, which is one-tenth of the complete antibody, and can overcome the disadvantages of the large molecular weight of natural antibodies while having a complete antigen binding site, with good tissue penetration, high specificity, and good water solubility; it has the advantages of both traditional antibodies and small molecule drugs, and perfectly overcomes the defects of traditional antibodies such as long development cycle, low stability, and harsh storage conditions, with high stability and low storage conditions. The sequences of the various single-domain antibodies targeting HLA-DRB5 described in the present invention can be well combined with HLA-DRB5, and can be used to diagnose or treat diseases with HLA-DRB5 as the target, such as diagnosing changes in HLA-DRB5 expression, and treating related diseases caused by increased HLA-DRB5 expression. And the preparation method is simple and low cost, which can lay a solid foundation for the extensive use of later clinical practice.

[0177] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A single domain antibody targeting HLA-DRB5, characterized in that: Its amino acid sequence is: A sequence as shown in any one of SEQ ID NO. 3, 5, 7, 11, 13, 15, and 17.

2. A nucleic acid encoding a single domain antibody targeting HLA-DRB5, characterized in that Its nucleotide sequence is: A sequence as shown in any one of SEQ ID NO. 4, 6, 8, 12, 14, 16, and 18; The nucleic acid encodes the single domain antibody targeting HLA-DRB5 according to claim 1.

3. A carrier, characterized in that Comprising the nucleic acid of claim 2.

4. A cell, characterized in that Comprising the vector of claim 3.

5. A method for preparing a single domain antibody targeting HLA-DRB5, characterized in that: The following steps are involved: (1) culturing the cell according to claim 4 under conditions suitable for expressing the recombinant foreign protein; (2) Isolate and purify the protein targeting HLA-DRB5 from cell culture.

6. Use of the single domain antibody targeting HLA-DRB5 according to claim 1, the nucleic acid according to claim 2, the vector according to claim 3, the cell according to claim 4, and the preparation method according to claim 5 in preparing a reagent for detecting the expression of HLA-DRB5.

Images