Application of PgMYC3 in regulating ginsenoside biosynthesis
By cloning the PgMYC3 gene and constructing a plant expression vector, the synthesis of ginsenosides was enhanced using Agrobacterium-mediated transformation. This solved the problem of insufficient research on the function of PgMYC3 in ginseng, and achieved a significant increase in ginsenoside content, thereby improving the medicinal and economic value of ginseng.
Patent Information
- Application Number
- CN202411329933.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-24
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2044-09-24
AI Technical Summary
The function of the PgMYC3 gene in ginseng is not yet fully understood, and existing technologies have not fully utilized its potential in regulating ginsenoside synthesis, resulting in insufficient accumulation of ginsenosides.
By cloning the PgMYC3 gene and constructing a plant expression vector, ginseng callus tissue was transformed using Agrobacterium-mediated transformation to enhance the transcriptional activity of the PgPPDS gene, thereby promoting the synthesis of ginsenosides.
The PgMYC3 transcription factor can specifically bind to the promoter region of the ginseng PgPPDS gene, significantly increasing the expression level of the PgPPDS gene, leading to an increase in the accumulation of ginsenosides in ginseng, with the total saponin content increasing by 1.5 times, thus enhancing the medicinal and economic value of ginseng.
Smart Images

Figure GDA0005108045210000041 
Figure GDA0005108045210000051 
Figure GDA0005108045210000052
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of biological genetic engineering, and relates to application of PgMYC3 in regulation of ginsenoside biosynthesis. BACKGROUND
[0002] Ginsenosides accumulate in the roots of Panax ginseng, which can endow ginseng with resistance to various potential biotic stresses, such as antibacterial activity against pathogens and anti-herbivory activity against insects and other herbivorous animals.
[0003] The biosynthesis of ginsenosides involves three major stages, including more than twenty enzymatic reactions, in which key enzymes play a regulatory core role. Key enzymes include farnesyl diophosphate synthase (FPS), squalene synthase (SS), squalene epoxidase (SE), dammarenediol-II synthase (DDS), β-amyrin synthase (β-AS), cytochrome P450 (CYP450), and glycosyltransferase (GT), etc. (YANG J L, HU Z F, ZHANG T T, et al. Progress on the studies of the key enzymes of ginsenoside biosynthesis [J]. Molecules, 2018, 23(3): 12.) In this biosynthetic pathway, the cytochrome P450 superfamily (CYP450s) plays a crucial role. In particular, the protein encoded by CYP716A47 gene is identified as the protopanaxadiol synthase (PPDS), which can not only be transcriptionally activated after MeJA treatment, but also promote the expression of squalene synthase to increase the yield of ginsenosides by overexpressing the gene (HAN J Y, KIM H J, KWON Y S, et al. The CYP P450 enzyme CYP716A47 catalyzes the formation of protopanaxadiol from dammarenediol-Ⅱ during ginsenoside biosynthesis in Panax ginseng [J]. Plant Cell Physiol, 2011, 52(12): 2062-2073).
[0004] In plants, the MYC gene family belongs to a class of key transcription factors that play a core role in regulating plant growth and development, synthesis of secondary metabolites, stress response, and plant hormone signaling. MYC family members generally contain one or more conserved DNA binding domains, such as the basic helix-loop-helix (bHLH) domain, however, their protein structures are not completely consistent, which is due to their sequence and functional diversity (Zheng Y C, Gu M Y, Bi W J, et al. Genome-wide identification and expression analysis of MYC transcription factor family in Camellia sinensis [J]. Journal of Fujian Agriculture, 2021, 36(9): 1007-1016 doi:10.19303 / j.issn.1008-0384.2021.09.003). Bioinformatics analysis of the plant MYC gene family reveals that the MYC family in plant genomes can be divided into multiple conserved subfamilies, and these subfamilies show completely different and unrelated differentiation in function (Duan L F, Li W Y, Huang W J, et al. Bioinformatics analysis of plant transcription factor MYC gene family [J]. Molecular Plant Breeding [2024-09-06]).
[0005] MYC family is a member of bHLH transcription factor superfamily and an important transcription factor in the plant jasmonic acid signaling pathway (Duan L F, Li W Y, Huang W J, et al. Bioinformatics analysis of plant transcription factor MYC gene family [J]. Molecular Plant Breeding [2024-09-06].). Even in the same species, the structure and function of MYBbHLH family members show significant diversity. For example, in Panax ginseng, PgMYC24 gene plays a key role in regulating ginsenoside biosynthesis, especially in promoting the synthesis of ginsenoside Rb2 (Wang K Y, Wang Y, Zhang M P, et al. A ginseng PgMYC24 gene and its application: 202310794775 [P] [2024-09-14].). In addition, PgbHLH149 gene is a key factor for ginseng to resist iron toxicity stress, and functional verification experiments in transgenic Arabidopsis further confirmed the important role of this gene in enhancing plant tolerance to iron toxicity stress (Wang Q X, Ma Y Y, Jin Q, et al. Panax ginseng PgbHLH149 transcription factor and its application. CN202011020645.3 [2024-09-14].).
[0006] The prior art CN118185957A provides a PgMYC2 gene for increasing the content of PPD-type ginsenosides in ginseng cells and an application thereof, and belongs to the technical field of genetic engineering.
[0007] The sequence of the PgMYC3 gene in ginseng is quite different from that of the PgMYC2 gene, and the research on the function thereof is still insufficient. SUMMARY
[0008] The PgMYC3 gene in ginseng is quite different from that of the PgMYC2 gene, and the research on the function thereof is still insufficient.
[0009] To achieve the above-mentioned purpose, the technical solution adopted by the present application is as follows:
[0010] The sequence of the PgMYC3 gene in ginseng is quite different from that of the PgMYC2 gene, and the research on the function thereof is still insufficient.
[0011] The sequence of the PgMYC3 gene in ginseng is quite different from that of the PgMYC2 gene, and the research on the function thereof is still insufficient.
[0012] SEQ ID NO. 1 is as follows:
[0013] MTDYRVPTAAMNLWSTTTTDDNTSMMDAFMSADLTSFWPSPTPPPPPPQSSSTSTSTAAAAVFNQESLQHRLQSLIEGAKESWTYAIFWQWQSVSGDIDYSSSQSSLLGWGDGYYKGEDKEKQLKRKPTSAAEQAHRRKVLRELNSLISGSQSFPDDAVDEEVTDTEWFFLVSMTQSFVKGAGLPGQAFFNSSPVWVTRAERLLSTPCERARQAQTFGLQTMVCIPSNNGVVELGSTELIYQSSDLMNKVRILFNFNSIDSGSWSVPSEPNESDPSALWLTDPSPLPNEEIKEIPMNSAKPPQIGFENHSFSTLTENPSTSSVINVQNQHSKQSQQQNGNITRELNFSGFGFDGISSNVRNGNSNSHVCKPESGEKLNFGESKRSCSGNGTLFAGHSQFVGIVEDSKKKRSSSSRGSHHEEGGILSFSSGMILPSSGIVKSSGGGGDSDHSDLEPSVVKEAIVSQVVDPERKPRKRGRKPANGREEPLNHVEAERQRREKLNQKFYALRVVVPNVSKMDKASLLGDAIVFINELKAKLQTSDSEKDELRSQLESLKKELASKESRYSSQKAADKDLKISNDHGNRFINLDIDVKIIGWDAMIRIQCSKKNHPAARLMTALEEMDLEVSHASISVVNDLMIQQATVKMGSRFYTQEQLRVALAAKVSETR.
[0014] The sequence of the ginseng transcription factor PgMYC3 is shown as SEQ ID NO. 2.
[0015] SEQ ID NO. 2 is:
[0016]
[0017] Application of the ginseng transcription factor PgMYC3 in enhancing synthesis of PgPPDS gene, wherein the sequence of the PgMYC3 gene is shown as SEQ ID NO. 2.
[0018] Application of the ginseng transcription factor PgMYC3 in improving activity of PgPPDS gene promoter, wherein the sequence of the PgMYC3 gene is shown as SEQ ID NO. 2.
[0019] Application of the ginseng transcription factor PgMYC3 in preparing a reagent for specifically binding with the cis-acting element G-box (CACGTG) in the PgPPDS gene promoter, wherein the sequence of the PgMYC3 gene is shown as SEQ ID NO. 2.
[0020] A plasmid, characterized in that the plasmid overexpresses a PgMYC3 gene.
[0021] In one preferred embodiment, the plasmid is obtained by cutting a vector, and then connecting the PgMYC3 gene with the cut vector.
[0022] In one preferred embodiment, the vector is a pCAMBIA1301s plasmid.
[0023] An Agrobacterium competent cell, characterized in that the Agrobacterium competent cell overexpresses a PgMYC3 gene.
[0024] In one preferred embodiment, the Agrobacterium competent cell is obtained by transforming the plasmid into a DH5a competent cell.
[0025] The plasmid or the Agrobacterium competent cell is used for enhancing ginsenoside synthesis.
[0026] The present application clones the PgMYC3 gene, constructs a plant expression vector, and uses Agrobacterium-mediated transformation to transform ginseng callus.
[0027] The present application uses biochemical and molecular biology techniques such as Dual-LUC, EMSA and Y1H to confirm that PgMYC3 can directly bind to the G-box element to activate the expression of the ginsenoside synthesis gene PgPPDS.
[0028] Compared with the prior art, the present application has the beneficial effects of:
[0029] The experimental data show that the PgMYC3 transcription factor in ginseng can specifically bind to the promoter region of the PgPPDS gene in ginseng, thereby enhancing the transcription activity of the PgPPDS gene. PgPPDS is a key enzyme in the ginsenoside biosynthesis pathway, and the improvement of the expression level of PgPPDS directly leads to a significant increase in the accumulation of ginsenosides in ginseng in vivo. In addition, the PgMYC3 transcription factor in ginseng, the coding gene thereof, and the overexpression recombinant vector containing the gene involved in the present application can be applied to the regulation of the ginsenoside biosynthesis process to improve the content of ginsenosides in ginseng. Through the method, the yield of ginsenosides can be increased, thereby improving the medicinal value and economic value of ginseng. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 RT-qPCR analysis of key enzymes in the ginsenoside biosynthesis pathway in PgMYC3 transgenic ginseng callus;
[0031] Figure 2 PgMYC3 promotes the accumulation of ginsenosides; Figure A: qualitative analysis of saponin extract in vanillin-perchloric acid color system. The higher the saponin content in the sample, the darker the color; Figure B: determination of total saponin content in PgMYC3 transgenic callus;
[0032] Figure 3 Dual-LUC experiment to analyze the effect of PgMYC3 on the promoter activity of enzyme gene PgPPDS;
[0033] Figure 4 Y1H experiment to analyze the interaction between PgMYC3 and PgPPDS promoter;
[0034] Figure 5 EMSA experiment to show that PgMYC3 binds to G-box element. DETAILED DESCRIPTION
[0035] Example 1 Construction of PgMYC3 overexpression vector
[0036] 1.1 PCR amplification of target fragment
[0037] Takara's PrimeSTAR Max DNA Polymerase was used for PCR amplification. The primers were designed by Primer Premier 5.0 software and synthesized by Beijing Chengke Biological Co., Ltd. The primer sequences are as follows: Primer Sequence (5'→3')
[0038] PC1301s-PgMYC3-F: atttggagaggacagggtaccATGACCGACTATCGTGTACCCAC (SEQ ID NO. 3)
[0039] PC1301s-PgMYC3-R: ttaaagcagggaattggatccTTATCTTGTTTCTGAGACTTTGGCTG (SEQ ID NO. 4)
[0040] The cDNA template was obtained by reverse transcription of total RNA from ginseng callus. The kits for RNA extraction and reverse transcription were: High-purity total RNA rapid extraction kit: Beijing Baitaike Biotechnology Co., Ltd.; RP1202; Trizol: Vazyme, Catalog No: R401-01; Reverse transcription kit: HiScript II 1st Strand cDNA Synthesis Kit(+gDNA wiper): R212-01.
[0041] The reaction system was as follows:
[0042] Table 1 PCR amplification system
[0043]
[0044] The PCR reaction program was set as follows:
[0045] Table 2 PCR reaction program
[0046]
[0047] After the reaction was terminated, the liquid on the wall of the test tube was collected by transient centrifugation, and then it was placed on ice for the subsequent agarose gel purification step, or temporarily stored in a -20°C refrigerator.
[0048] 1.2 PCR product purification and linearization of expression vector
[0049] The PCR product was subjected to gel electrophoresis to remove non-specific amplification bands, and the target DNA fragment was purified using a gel recovery kit from Vazyme. The PCR product was mixed with 6 times the loading buffer, and agarose gel electrophoresis was performed for 30 minutes. Under the irradiation of ultraviolet light source, the agarose gel region containing the target size DNA fragment was accurately cut and placed in a clean 1.5 ml centrifuge tube. Then the weight of the gel was weighed, and the subsequent steps were operated according to the instructions of the kit. The final DNA solution was detected for concentration and quality by ultramicro spectrophotometer, and then stored in a -20°C refrigerator.
[0050] The expression vector pCAMBIA1301 s plasmid (the source of the plasmid is referred to prior art JIANG T, ZHANG Y, ZUOG G, et al. Transcription factor PgNAC72 activates DAMMARENEDIOL SYNTHASE expression to promote ginseng saponin biosynthesis [J]. Plant Physiology, 2024, 195(4): 2952-2969) was cut by BamH I and Kpn I restriction enzymes, and the same gel recovery experiment was also performed.
[0051] The enzyme cutting system is as follows:
[0052] Table 3 Endonuclease cutting reaction system
[0053]
[0054] 1.3 Vector ligation and E. coli transformation
[0055] The homologous recombination reaction is as follows:
[0056] Table 4 Homologous recombination reaction system
[0057]
[0058] After mixing by gently blowing and sucking with a micropipette, the sample was placed in a PCR instrument, set to 37°C for incubation for 30 minutes, and immediately removed and placed on ice after the reaction was completed, and then E. coli transformation experiment was performed. The specific operation steps are as follows:
[0059] (1) One branch of DH5a competent cells stored in a -80°C refrigerator was quickly transferred to ice and subjected to thawing treatment in ice for 10 minutes. Then, 10 μL of the ligation product was added to the competent cells, mixed uniformly, and then placed on ice for 15 minutes.
[0060] (2) The centrifuge tube in step (1) was placed in a 42°C water bath for 1 minute of heat shock treatment, and then quickly moved to ice for 2 minutes of ice bath.
[0061] (3) 700 μL of LB liquid medium without resistance was added to the centrifuge tube, gently shaken to mix, and then subjected to 60 minutes of shaking culture at 37°C, 200 rpm.
[0062] (4) Centrifuge at 1,0000 x g for 1 min to collect the bacterial cells, remove 700 μL of supernatant, and resuspend the cells in the remaining ~100 μL of culture medium. After mixing well by pipetting, inoculate the bacterial solution onto LB solid medium containing 100 mg / L kanamycin (Kan), spread evenly using a spreader, and incubate at 37°C for 12 h.
[0063] The formula of LB medium is as follows (volume is 1 L):
[0064] Table 5 Formula of LB medium
[0065]
[0066] To prepare LB solid medium, add 15 g / L agar powder to the liquid medium, and then perform high-pressure sterilization at 121°C for 15 min. After sterilization, add an appropriate amount of antibiotic when the sterilized medium cools to about 60°C. The medium can be stored for one week at room temperature.
[0067] 1.4 Identification of positive clones
[0068] Select four single colonies of appropriate size, inoculate them into 200 μL of LB liquid medium containing 100 mg / L Kan, and incubate at 37°C and 200 rpm for 4 h. Then, take an appropriate amount of bacterial solution for PCR identification. The reaction system is configured as follows:
[0069] Table 6 Reaction system for bacterial solution PCR
[0070]
[0071] The PCR reaction program is as follows:
[0072] Table 7 PCR reaction program for bacterial solution
[0073]
[0074] Analyze the PCR products by agarose gel electrophoresis to verify whether the bands are single and their sizes are consistent with expectations. If the PCR product identification is correct, send the corresponding bacterial solution sample to Beijing Genesee Biotechnology Co., Ltd. for DNA sequencing. After the sequencing results are correct, expand the remaining bacterial solution. Then, mix 300 μL of fresh bacterial solution with 700 μL of sterile glycerol, freeze quickly in liquid nitrogen, and store in a -80°C refrigerator.
[0075] 1.5 Plasmid extraction
[0076] Use the plasmid extraction kit of Beijing Genesee Biotechnology Co., Ltd. Plasmid Mini Kit, all steps were performed at room temperature:
[0077] (1) Take 4 mL of the bacteria solution of the overnight culture, centrifuge at 12,000 x g for 1 min, collect the bacteria, and try to remove the supernatant;
[0078] (2) Add 250 μL of Buffer PA containing RNase A to the bacteria, and mix well by blowing and sucking until there are no obvious bacterial clumps;
[0079] (3) After adding 250 μL of Buffer PB, gently invert and mix 6-8 times to fully lyse the bacteria;
[0080] (4) After adding 350 μL of Buffer PC, gently invert and mix 6-8 times, and then centrifuge at 12,000 rpm for 10 min after fully mixing;
[0081] (5) Transfer the supernatant to the adsorption column without sucking out the precipitate, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and place the adsorption column back into the collection tube;
[0082] (6) Add 600 μL of Buffer PW containing anhydrous ethanol along the wall of the adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste, and repeat this step once;
[0083] (7) Place the adsorption column back into the collection tube, and centrifuge the empty tube at 12,000 rpm for 2 min;
[0084] (8) Place the adsorption column into a new clean 1.5 mL centrifuge tube, open the tube cap, and place it at room temperature for 2 min to evaporate the residual ethanol;
[0085] (9) Add 35-50 μL of Elution Buffer preheated to 60°C to the center of the adsorption membrane, stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 2 min. The final plasmid solution was stored in a -20°C refrigerator.
[0086] Example 2 Construction of ginseng callus overexpressing PgMYC3
[0087] 2.1 Preparation of Agrobacterium chemical competent cells
[0088] (1) Take the EHA105 strain (purchased from Shanghai Wudidi Biotechnology Co., Ltd.) out of the -80°C refrigerator and quickly freeze it in liquid nitrogen for protection, then use a loop to take an appropriate amount of bacterial solution and spread it on YEB solid medium with Rif (50 μg / mL) to recover the strain. Then, invert culture in a constant temperature incubator at 28°C for 36 hours. The following is the formula of YEB medium:
[0089] Table 8 YEB medium formula
[0090]
[0091] When preparing YEB solid medium, add 15 g / L agar powder according to the formula and autoclave at 121°C for 15 minutes. After the medium cools to about 50°C, add antibiotics and store at room temperature for one week.
[0092] (2) Select a single colony of appropriate size and inoculate it in 5 mL YEB liquid medium containing Rif (50 μg / mL) and shake culture at 28°C and 200 rpm overnight.
[0093] (3) Inoculate 50 μL of the overnight culture into 50 mL of fresh YEB liquid medium and shake culture at 28°C and 200 rpm until the OD 600 value of the bacterial solution reaches about 0.6 to 0.8. Then, transfer the bacterial solution to a 50 mL sterile centrifuge tube and ice-bath for 30 minutes.
[0094] (4) Place the centrifuge tube in a 4°C pre-cooled centrifuge and centrifuge at 4,000 rpm for 10 minutes.
[0095] (5) Remove the supernatant and add 10 mL of pre-cooled 0.15 M NaCl solution to the precipitate, gently blow and suck on ice to resuspend the bacterial solution, then centrifuge at 4°C and 4,000 rpm for 10 minutes.
[0096] (6) After removing the supernatant, add 1 mL of pre-cooled 20 mM CaCl2 solution to the precipitate and gently blow and suck on ice to resuspend the bacterial solution. Then, aliquot the bacterial solution into pre-cooled 1.5 mL sterile centrifuge tubes, quickly freeze with liquid nitrogen, and store at -80°C for later use.
[0097] 2.2 Transformation of Agrobacterium competent cells
[0098] (1) Take a vial of EHA105 competent cells (purchased from Shanghai Wudidi Biotechnology Co., Ltd.) out of the -80°C refrigerator and thaw on ice for 10 minutes. In a clean bench, add 2 μL of plasmid to the bacterial solution and gently blow and suck to mix, then stand on ice for 30 minutes.
[0099] (2) Liquid nitrogen snap-freeze for 2-5 minutes, then heat shock in 37°C water bath for 5 minutes. In a clean bench, add 900 μL YEB liquid medium, then incubate at 28°C, 100 rpm for 4-6 hours to recover the bacterial cells.
[0100] (3) Centrifuge at 8,000 rpm for 1 minute, discard 800 μL supernatant, and resuspend the bacterial cells with the remaining medium. After resuspension, evenly spread the bacterial solution on the surface of YRK (YEB containing 50 mg / L Rif and 50 mg / L Kan) solid medium, then incubate in an inverted manner at 28°C for 2 days.
[0101] (4) Pick single colonies for PCR identification, and the method is the same as that in Example 1. Select the positive colony EHA105-pCAMBIA1301s-PgMYC3 for further culture, and then proceed to the next step of genetic transformation or strain preservation.
[0102] 2.3 Preparation of Agrobacterium EHA105
[0103] (1) Inoculate the identified recombinant strain EHA105-pCAMBIA1301s-PgMYC3 into 100 mL YRK liquid medium, and incubate at 28°C, 200 rpm. When the OD 600 value of the bacterial solution reaches 0.4, add 100 μL AS to make the final concentration 200 μM, and then continue to incubate under shaking conditions until the OD 600 value increases to 0.6.
[0104] (2) Transfer the above bacterial solution to a sterile 50 mL centrifuge tube, centrifuge at 5,000 rpm for 10 minutes, remove the supernatant, and resuspend the bacterial cells with 100 mL liquid MS medium containing 200 μM AS, and wait for use.
[0105] 2.4 Transformation of ginseng callus
[0106] The genetic transformation of ginseng callus referred to the Agrobacterium-mediated transient gene expression analysis system of ginseng adventitious roots established by Yao et al. (Engineering of triterpene metabolism and overexpression of the lignin biosynthesis gene PAL promotes ginsenoside Rg3 accumulation in ginseng plant chassis[J]. J Integr Plant Biol, 2022, 64(9): 1739-1754.) and made appropriate modifications.
[0107] (1) Select ginseng callus with good growth conditions as the infection material, and cut it into blocks with a diameter of about 1 cm using a sterile scalpel. Place the cut callus on MS medium containing 0.5 mg / L 6-BA and 2.0 mg / L NAA, and pre-culture for 2 days.
[0108] (2) Place the pre-cultured ginseng callus in a resuspension solution and incubate at 28°C, 200 rpm for 30 minutes, then use a vacuum pump to perform vacuum soaking at a pressure of 0.08 MPa for 10 minutes.
[0109] (3) Filter the bacterial solution using a sterile funnel, then use sterile filter paper to absorb the surface moisture of the ginseng callus. After treatment, place the callus on MS solid medium containing 200 μM AS and co-culture for 2 days. Part of the callus is collected for gene expression detection and ginsenoside content analysis.
[0110] Example 3 Expression detection of key enzymes in ginsenoside biosynthesis
[0111] 3.1 Extraction of total RNA from ginseng callus
[0112] (1) Add 1 ml Trizol to an RNase-Free centrifuge tube and place it on ice. Use a mortar and pestle to grind the sample into a powder, adding liquid nitrogen to the mortar as needed. Take 50 mg of powder and add it to the centrifuge tube, vortex to mix; room temperature for 5 min;
[0113] (2) 12,000 x g 4°C centrifugation for 5 min, carefully pipette 950 μL supernatant into a new RNase free centrifuge tube, add chloroform at a volume of 1 / 5 of Trizol, mix well; room temperature for 5 min;
[0114] (3) 12,000 x g 4°C centrifugation for 10 min, the homogenate liquid will be divided into three layers, namely: the supernatant containing RNA, the middle protein layer and the lower organic phase;
[0115] (4) 450 μl of supernatant was transferred to another new RNase free centrifuge tube (do not suck out the middle protein layer) ; add an equal volume of Trizol isopropanol 450 μL, mix well, room temperature for 10 min;
[0116] (5) The above mixture was transferred to the adsorption column RA, 13,000 rpm centrifugation for 2 min, the filtrate was discarded;
[0117] (6) Add 500 μL of deproteinization solution RW1, room temperature for 3 min, 13,000 rpm centrifugation for 30 s, discard the filtrate;
[0118] (7) Add 500 μL of pre-ethanol rinsing solution RW, 13,000 rpm centrifugation for 30 s, discard the filtrate; repeat the operation once;
[0119] (8) The adsorption column was placed back into the empty collection tube, 13,000 rpm centrifugation for 2 min;
[0120] (9) The adsorption column was placed in a new RNase free centrifuge tube, the lid was opened and placed at room temperature for 2 min to evaporate the residual ethanol; 30 μL of RNase free water preheated to 70-90°C was added to the adsorption membrane, room temperature for 2 min, 12,000 rpm centrifugation for 1 min.
[0121] The RNA taken out was taken 2 μL for agarose gel electrophoresis to evaluate the integrity of the RNA. The unused RNA sample should be stored in a refrigerator at -80°C for subsequent reverse transcription or other purposes.
[0122] 3.2 Reverse transcription to synthesize cDNA first strand
[0123] (1) Removal of genomic DNA
[0124] In a RNase free 0.2 mL PCR tube, the following reagents were added in order:
[0125] Table 9 Reverse transcription reaction system
[0126]
[0127] After mixing the above reagents, the sample was incubated at 42°C for 2 min in a PCR instrument, and then taken out and immediately placed on ice for subsequent use.
[0128] (2) Synthesis of cDNA first strand
[0129] Add 4 μΐ of 5x HiScript II Enzyme Mix into the PCR tube containing the above reaction solution, and perform the following reaction procedure in a PCR instrument: 50°C, 15 min; 85°C, 5 s. After the reaction is completed, dilute the synthesized cDNA sample by 10 times, and store it in a -20°C refrigerator.
[0130] 3.3 RT-qPCR analysis
[0131] RT-qPCR analysis was performed using the kit Novozyme ChamQ Universal SYBR qPCR Master Mix (Q711-02), and the reaction system of RT-qPCR was as follows:
[0132] Table 10 RT-qPCR reaction system
[0133]
[0134] The amplification procedure was as follows:
[0135] Table 11 RT-qPCR reaction procedure
[0136]
[0137] PgACT as the internal reference gene, each sample was repeated three times. The 2 -ΔΔCt method was used to measure the relative difference of gene transcription level, and the expression level of each gene was analyzed and compared.
[0138] The primer sequences used were as follows:
[0139] Primer Sequence (5'→3')
[0140] qRT-PgMYC3-F: GTGGTGGTGGGGATTCCG (SEQ ID NO. 7)
[0141] qRT-PgMYC3-R: AGCCGGTTTTCTTCCCCG (SEQ ID NO. 8)
[0142] qRT-PgACT-F: TGCCCCAGAAGAGCACCCTGT (SEQ ID NO. 9)
[0143] qRT-PgACT-R: AGCATACAGGGAAAGATCGGCTTGA (SEQ ID NO. 10)
[0144] qRT-PgHMGS-F: TGCTAGCCGGGACCTTGA (SEQ ID NO. 11)
[0145] qRT-PgHMGS-R: AGGGAAGCAAATGCCGCA (SEQ ID NO. 12)
[0146] qRT-PgHMGR-F: GGTTCCCCAAAAGCATAAA (SEQ ID NO. 13)
[0147] qRT-PgHMGR-R: CCGCCACTACTGCGTTAA (SEQ ID NO. 14)
[0148] qRT-PgFPS-F: CAAGTGCTCCTGGTTGGTAGT (SEQ ID NO. 15)
[0149] qRT-PgFPS-R: TCATACTCGGCAAATACATCC (SEQ ID NO. 16)
[0150] qRT-PgSS3-F: TTCAACAGCTCGGACCTCA (SEQ ID NO. 17)
[0151] qRT-PgSS3-R: GAAAAGTGCCAGTCGTTATCAT (SEQ ID NO. 18)
[0152] qRT-PgSE1-F: TCTTTGCCGTGGCTATCTAT (SEQ ID NO. 19)
[0153] qRT-PgSE1-R: CATTTGTCGAAGTCCTTCTGA (SEQ ID NO. 20)
[0154] qRT-PgDDS-F: TGAGATTAGATGAAAACGAAC (SEQ ID NO. 21)
[0155] qRT-PgDDS-R: GGCAATGATAAGGGGAGGTGT (SEQ ID NO. 22)
[0156] qRT-PgPPDS-F: CGGTTAAGAAATACACGGTCA (SEQ ID NO. 23)
[0157] qRT-PgPPDS-R: TGGCACGATTCATAGCAGTC (SEQ ID NO. 24)
[0158] Figure 1 The influence of PgMYC3 transcription factor on the expression level of the core enzyme genes of ginsenoside biosynthesis pathway was demonstrated. Under the condition of PgMYC3 overexpression, the expression levels of PgSE1 and PgPPDS were slightly increased compared with the control group, while the expression levels of all other core enzyme genes did not change significantly.
[0159] Example 4 Determination of total ginsenoside content
[0160] In the determination of total ginsenoside content, the total ginsenoside content kit provided by Shanghai Zucaibiotechnology Co., Ltd. was used for experimental operation. The specific steps are as follows:
[0161] (1) An appropriate amount of sample to be tested was placed in a 15 mL centrifuge tube, and liquid nitrogen was used for quick freezing. After the sample was completely frozen, it was subjected to 24 hours of vacuum freeze-drying treatment.
[0162] (2) After the sample was completely dried, it was crushed into powder. Then, 0.05 g of sample was weighed and 1 ml of extraction solution was added, and ultrasonic extraction was performed for 1 hour, followed by centrifugation at 8,000 x g for 10 minutes.
[0163] (3) 0.5 ml of supernatant was taken and placed in a 1.5 ml centrifuge tube. For the blank control group, 0.5 ml of extraction solution was directly taken. Subsequently, it was placed in an oven at 70°C and evaporated to dryness. Then, 0.2 ml of reagent I and 0.8 ml of perchloric acid were added, and then incubated in a water bath at 55°C for 20 minutes.
[0164] (4) 40 μL of reaction solution was taken with a pipette and placed in a 96-well plate, with 3 replicate wells for each group. Then, 200 μL of glacial acetic acid was added, mixed thoroughly, and the absorbance of each sample well was measured using an enzyme marker at a wavelength of 589 nm. The absorbance value of the experimental group was recorded as A1, and the absorbance value of the blank control group was recorded as A2, and the absorbance difference ΔA = A1-A2 was calculated.
[0165] (5) Calculation of total ginsenoside content: using ginsenoside Re as the control
[0166] Total ginsenoside content (μg / g dry weight) = 977.23 x (△A + 0.0016) ÷ W, where W represents the dry weight of the sample.
[0167] Figure 2 The change of ginsenoside accumulation in PgMYC3 transgenic callus was demonstrated. Figure 2As shown in Figure A, the color development of OE-PgMYC3 extract was darker than that of the control group. The total ginsenoside content was calculated using ginsenoside Re as the control. The total ginsenoside content of the control group was 1390.7 μg / g DW, while that of the transgenic ginseng callus was 2089.9 μg / g DW. Figure 2 B). Compared with the EV control group, the total ginsenoside content of the OE-PgMYC3 line was increased by 1.5-fold. Therefore, based on the above experimental results, PgMYC3 plays a promoting role in the accumulation of ginsenosides.
[0168] Example 6 Prokaryotic expression and purification of PgMYC3 protein
[0169] 5.1 Construction of prokaryotic expression vector
[0170] By homologous recombination, the present application successfully constructed a pCold / TF-PgMYC3 prokaryotic expression vector for expressing PgMYC3 protein, and selected BamH I and Kpn I as the restriction enzyme sites of the pCold / TF vector. The specific vector construction steps are referred to Example 1. The successfully constructed vector was transformed into BL21 competent cells and subjected to subsequent processing according to the screening and identification method described in Example 1. The primer sequences are as follows:
[0171] Primer Sequence (5'→3')
[0172] pCold-TF-PgMYC3-F: aggcatatggagctcggtaccATGACCGACTATCGTGTACCCAC (SEQ ID NO. 25)
[0173] pCold-TF-PgMYC3-R: agcagagattacctatctagaTTATCTTGTTTCTGAGACTTTGGCTG (SEQ ID NO. 26)
[0174] 5.2 Induced expression of recombinant protein
[0175] (1) The correctly identified BL21 / pCold / TF-PgMYC3 expression strain was inoculated into 4 mL of LB liquid medium (containing 50 mg / L Amp), and then subjected to overnight shaking culture at 37°C and 200 rpm.
[0176] (2) The above bacterial solution was transferred into 200 mL of LB liquid medium (containing Amp 50 mg / L) for expansion culture. The culture was performed under the same conditions for 2 hours until the OD600 value reached 0.6-0.8.
[0177] (3) Add 200 μL 1M IPTG to induce the expression of PgMYC3 protein, then induce for 4 hours at 37°C, 200 rpm.
[0178] (4) Transfer the induced bacterial solution to a 50 mL centrifuge tube, centrifuge at 4°C, 4,900 x g for 10 minutes, discard the supernatant after multiple batch centrifugations, and collect the bacterial cells.
[0179] (5) Resuspend the bacterial cells with 15 mL pre-cooled PBS buffer, centrifuge at 4°C, 4,900 x g for 10 minutes, discard the supernatant; repeat this step once to collect the bacterial cells.
[0180] (6) Resuspend the bacterial cells with 2-5 mL Lysis buffer per g of wet weight, then add lysozyme (final concentration 1 mg / mL), mix well, and place on ice for 30 minutes.
[0181] (7) Use an ultrasonic cell disruptor to lyse the bacterial cells on ice, set the power to 250 W, ultrasonic for 5 s, cool for 5 s, for a total of 5 minutes, until lysis is complete.
[0182] (8) Centrifuge at 4°C, 10,000 x g for 20 minutes, transfer the supernatant to a new centrifuge tube, and the resulting protein crude extract is obtained.
[0183] 5.3 Purification and concentration of recombinant protein
[0184] (1) Take 500 μL of Ni-NTA suspension (previously mixed well, column bed volume 250 μL) to a 2 mL centrifuge tube, centrifuge for a moment and discard the supernatant.
[0185] (2) Add 1 mL of Lysis buffer to the Ni-NTA matrix for equilibration, shake gently and centrifuge for a moment, discard the supernatant.
[0186] (3) Add the protein crude extract to the equilibrated Ni-NTA matrix, mix well and rotate at 4°C, 100 rpm for 60 minutes.
[0187] (4) Slowly add the mixture to the purification column, fill it and open the bottom cap to drain the waste liquid.
[0188] (5) After the liquid flows out, slowly add 1 mL of pre-cooled Wash buffer to the column to wash the impurities, repeat 8 times.
[0189] (6) Slowly add 1 mL of Elution buffer to the column, pay attention to collect the eluate, repeat 4 times.
[0190] (7) Transfer the eluate into 5 mL ultrafiltration tube, centrifuge at 4°C, 4000 x g for 10 min.
[0191] (8) Discard the filtrate, add 4 mL 20 mM Tris-HCl (pH = 7.2) to the ultrafiltration tube, centrifuge at 4,000 x g for 10 min at 4°C, discard the filtrate, repeat this step once.
[0192] (9) Add 2 mL 20 mM Tris-HCl to the ultrafiltration tube, gently blow and suck to dissolve the membrane protein, take 10 μL to measure the protein concentration, and the remaining protein solution is aliquoted into new 1.5 mL tubes and stored at -80°C.
[0193] 5.4 Preparation of buffers related to protein expression and purification experiments
[0194] In the preparation of Lysis buffer, Wash buffer and Elution buffer, the required basic components are consistent, but the imidazole content will be different in each buffer:
[0195] Table 12 Formulation of buffers related to protein expression and purification experiments
[0196]
[0197] The amount of imidazole required for each buffer:
[0198] Table 13 Formulation of buffers related to protein expression and purification experiments (continued)
[0199]
[0200] Adjust the pH of the buffer to 8.0 using 1M NaOH and store at room temperature.
[0201] Example 6 Dual luciferase reporter gene experiment
[0202] 6.1 Construction of reporter gene vector
[0203] Search for the promoter sequence of PgPPDS in the Panax ginseng genome database, select BamH I and Kpn I as the enzyme digestion sites of pGreen II 0800-LUC reporter vector and promoter fragment, design specific primers to amplify the full-length 2000 bp sequence of PgPPDS-pro, the primer name is PgPPDS-pro-F / R, the detailed information is shown below; the vector construction process refers to Example 1, and the recombinant Agrobacterium strain is obtained.
[0204] Primer Sequence (5'→3')
[0205] PgPPDS-pro-F: ctatagggcgaattgggtaccTTGTAAGTTTGTAATTACAATATTTTCAGCT (SEQ ID NO. 27)
[0206] PgPPDS-pro-R: atcgataccgtcgacctcgagTCTTTTAAACAGGCGTGAAACATG (SEQ ID NO. 28)
[0207] 6.2 Tobacco Cultivation
[0208] (1) Wild-type N. benthamiana seeds were placed in 1% sodium hypochlorite solution for 10 minutes of shaking sterilization, then rinsed with sterile water for 6 times to remove residual sodium hypochlorite, and the sterile seeds were transferred to solid MS medium, and cultured at 28°C, 16 hours light / 8 hours dark for 5-7 days to the seedling stage. The formula of MS medium is as follows:
[0209] Table 14. Formula of tobacco seedling medium
[0210]
[0211] Adjust pH to 5.8, add 8 g / L agar powder, and autoclave at 121°C for 15 min.
[0212] (2) The tobacco seedlings were transferred to soil and continued to grow at 28°C, 16 hours light / 8 hours dark until 3-4 robust leaves were grown.
[0213] 6.3 Activation and expansion culture of Agrobacterium GV3101
[0214] (1) The constructed recombinant Agrobacterium strain was inoculated into YRK liquid medium and cultured at 28°C, 200 rpm for about 36 hours.
[0215] (2) A single colony was picked and inoculated into 3 mL YRK liquid medium, and cultured at 28°C, 200 rpm overnight.
[0216] (3) 200 μL of bacterial solution was added to 5 mL of YRK medium containing 10 mM MES (pH = 5.6), 200 μM AS, and cultured at 28°C, 200 rpm until OD600 = 1.5.
[0217] (4) Centrifuged at 5000 x g for 10 min, discarded the supernatant, resuspended the bacterial pellet with an equal volume of 10 mM MgCl2solution, then added 200 μM AS, and placed in the dark for 3 hours.
[0218] 6.4 Tobacco transient transformation
[0219] The pCAMBIA1301s-PgMYC3 effector vector (prepared in Example 1) and the reporter vector (prepared in Step 6.1) were transformed into Agrobacterium GV3101 respectively, and the transformation method is described in Example 2. The two Agrobacterium strains verified to be successful were mixed in equal volume and mixed uniformly, and then co-infiltrated into the epidermal cells under the tobacco leaf by injection infiltration method, and each sample group was infiltrated into three tobacco leaves.
[0220] 6.5 Quantitative detection of double luciferase
[0221] The quantitative detection of firefly luciferase and sea renate luciferase was performed using the double luciferase detection kit of TransGen company, and the specific steps were as follows:
[0222] (1) Sample collection was started 2 days after injection, and a puncher with an inner diameter of 2 centimeters was used for sampling to avoid the large vein area, and each sample was sampled once and quickly placed in a 1.5 mL centrifuge tube and quickly frozen using liquid nitrogen.
[0223] (2) The sample was quickly crushed using an electric grinder, and 100 μL of protein extraction solution (containing 1 mM DTT and PBS buffer with pH 7.8) was added twice, homogenized, and centrifuged at 4°C, 12,000 rpm for 10 minutes, and the supernatant was the crude enzyme extract.
[0224] (3) The supernatant was collected, and the steps according to the attached instructions of Double-Luciferase Reporter Assay Kit kit (Beijing Zomanbio Biotechnology Co., Ltd.) were followed to determine the enzyme activity of firefly luciferase and sea renate luciferase; then, the ratio of the activities of firefly luciferase and sea renate luciferase was calculated.
[0225] The determination results of the relative activity of luciferase (LUC) are shown. Under the condition of overexpression of PgMYC3 transcription factor, the activity of PgPPDS gene promoter is significantly improved, reaching an enhancement amplitude of about 1.4 times. This result shows that the PgMYC3 transcription factor has a positive regulation on the PgPPDS gene promoter, and can significantly improve its transcription activity. Figure 3 Example 7 Yeast one-hybrid experiment
[0226] 7.1 Construction of yeast one-hybrid vector
[0227]
[0228] In the present application, the yeast one-hybrid system is used, including prey plasmid pB42AD7 (AD for short) and bait plasmid pLacZi-2μ (LacZ for short), both of which are purchased from BioVector NTCC. The bait vector AD-PgMYC3 is constructed by homologous recombination technology. The primers used for amplifying the PgMYC3 fragment are pB42AD-PgMYC3-F / R, and the detailed primer sequences are shown as follows. According to the sequence of the G-box element in the PgPPDS promoter, three tandem repeat primers are designed (Table 18). The primers are dissolved in TE buffer to 10 μM, and mixed at a ratio of 1:1, and then annealing reaction is carried out according to the following program: 95°C, 30 s; 72°C, 2 min; 37°C, 2 min; 25°C, 2 min; finally stored at 4°C. After the annealing reaction is completed, the end of the obtained sequence forms EcoR I and Xho I double enzyme digestion sites compatible with the pLacZi-2μ vector.
[0229] Primer Sequence (5'→3')
[0230] pB42AD-PgMYC3-F: gattatgcctctcccgaattcATGACCGACTATCGTGTACCCAC (SEQ ID NO. 29)
[0231] pB42AD-PgMYC3-R: agaagtccaaagcttctcgagTTATCTTGTTTCTGAGACTTTGGCTG (SEQ ID NO. 30)
[0232] Table 15 Primers used for constructing yeast one-hybrid vector
[0233]
[0234] Subsequently, the annealed G-box double-stranded nucleotide fragment is ligated with the pLacZi-2μ vector using T4 DNA ligase to obtain G-box-LacZ. The ligation product is transformed into DH5α cells, and the specific operation and subsequent steps are described in detail in Example 1. The ligation system is configured in a PCR tube as follows:
[0235] Table 16 Ligation system for constructing bait vector
[0236]
[0237]
[0238] 7.2 Preparation of EGY48 yeast competence:
[0239] (1) First, the stored EGY48 yeast strain (purchased from Beijing Coolab Technology Co., Ltd.) was taken out from the refrigerator at -80°C and cultured on a YPDA plate for recovery, and the process was inverted in an incubator at 28°C for 2 days. A single colony of EGY48 yeast was picked and inoculated into 3 mL of YPDA liquid medium, and cultured at 28°C, 200 rpm for 24 hours.
[0240] (2) Then, 3 mL of activated bacterial solution was added to 50 mL of YPDA liquid medium, and cultured at 28°C, 200 rpm until the OD 600 value reached between 0.5-0.8.
[0241] (3) After that, the bacterial solution was transferred to a 50 mL sterile centrifuge tube and centrifuged at 2,500 rpm for 5 minutes, the supernatant was discarded, then 30 mL of sterile deionized water was added, the bacterial cells were completely suspended by gentle blowing, then ice bath for 30 minutes, and then centrifuged at 2,500 rpm for 5 minutes, the supernatant was discarded.
[0242] (4) Finally, 5 mL of TE / LiAc solution was added to resuspend the bacterial cells, and they were aliquoted into 1.5 mL sterile centrifuge tubes, centrifuged at 2,500 rpm for 30 seconds, the supernatant was discarded, and then the bacterial cell pellet was resuspended with 600 μL of TE / LiAc solution to obtain EGY48 yeast competent cells.
[0243] 7.3 Yeast transformation of yeast competent cells
[0244] (1) First, 50 μL of EGY48 competent cells were taken, then 1 μg of LacZ and AD plasmid, 10 μL of salmon sperm DNA (purchased from Beijing Coolab Technology Co., Ltd.), and 500 μL of PEG / LiAc were added in order, then mixed by blowing and sucking, then treated in a constant temperature water bath at 30°C for 30 minutes, and inverted every 10 minutes during the process. The total plasmid combination is as follows:
[0245] Table 17 Transformation combination of yeast one-hybrid plasmid
[0246]
[0247] (2) Then, 20 μL of DMSO was added to each centrifuge tube, and then treated in a constant temperature water bath at 42°C for 20 minutes, mixed every 5 minutes during the process, and centrifuged at 2,500 rpm for 30 seconds, and the supernatant was discarded.
[0248] (3) Then, the cells were resuspended in 1 mL of YPDA liquid medium and activated at 30°C, 200 rpm for 90 min.
[0249] (4) Finally, the cells were centrifuged at 2,500 rpm for 30 s, the supernatant was discarded, and the cells were resuspended in 100 μL of 0.9% physiological saline. The cell suspension was spread on SD / -Trp-Ura selection plates, and qualitative analysis was performed after two days of culture in an incubator at 30°C.
[0250] 7.4 Qualitative analysis
[0251] In the qualitative analysis, four well-grown single colonies were selected from each selection plate, inoculated into 200 μL liquid culture tubes containing YPDA medium, and cultured at 30°C, 200 rpm for 24 h. Then, 7 μL of the culture was spotted on a qualitative plate for sterile operation, and the color development was observed after 2 days of culture at 30°C.
[0252] Table 18 Formulation of YPDA medium
[0253]
[0254] If YPDA solid medium is configured, 15 g / L of agar powder is further added.
[0255] Table 19 Formulation of qualitative plate for yeast one-hybrid experiment
[0256]
[0257] The above reagents were purchased from Beijing Coolaber Science and Technology Co., Ltd.
[0258] Figure 4 The cloning of the G-box element in the form of three tandem repeats upstream of the LacZ reporter gene in the pLacZ2μ vector is shown. The experimental design includes negative controls (pB42AD + pLacZ2μ; pB42AD-PgMYC3 + pLacZ2μ; pB42AD + pLacZ2μ-G-box) and experimental groups (pB42AD-PgMYC3 + pLacZ2μ-G-box). These plasmid combinations were then co-transformed into the yeast strain EYG48 and grown on SD / -Ura-Trp medium to confirm the successful transformation of the plasmids. As shown in Figure 1, the experimental group pB42AD-PgMYC3 + pLacZ2μ-G-box showed a blue color, while the negative control pB42AD + pLacZ2μ did not show a blue color. Figure 4As shown, only the experimental group of yeast presented blue spots in SD / -Ura-Trp medium containing 80 μg / mL X-gal, which indicated that PgMYC3 combined with the cis-acting element G-box in the yeast cells, and then activated the expression of the LacZ reporter gene, producing β-galactosidase, which acted on the X-gal substrate to generate galactose and 5-bromo-4-chloroindigotin, which was dark blue.
[0259] Example 8 Gel Mobility Shift Assay
[0260] 8.1 Labeling and Annealing of Probes
[0261] (1) The following probes were designed according to the sequence of the G-box site in the PgPPDS promoter:
[0262] Table 20 Probe Name and Sequence
[0263]
[0264]
[0265] The underlined part indicates the predicted G-box and its mutant sequence. The probe was attached with a biotin label at the 5' end and purified by high-performance liquid chromatography. The synthesis, labeling, and purification of the probe were completed by Beijing Genki Biological Company.
[0266] (2) The forward and reverse strands were mixed according to the equimolar ratio, and the probe was diluted to a final concentration of 10 μM using Tris buffer containing 10 mM Tris, 1 mM EDTA, and 50 mM NaCl. Annealing was performed in a PCR instrument according to the following program: 95°C for 5 min, then 1°C lower for each cycle for a total of 70 cycles, with each cycle lasting 1 min. After completion, the probe was stored at -20°C.
[0267] 8.2 Gel Mobility Shift Assay
[0268] (1) Prepare 6% TBE gel according to the formula, and pay special attention to prevent air bubbles from forming during the process. After the gel is solidified, rinse the loading well with 0.5x TBE solution and pre-electrophorese for 30 minutes at 100V, using 0.5x TBE as the electrophoresis buffer.
[0269] (2) Under low temperature conditions, prepare the protein and probe binding reaction system according to the following formula (unit: μL):
[0270] Table 21 EMSA Reaction System
[0271]
[0272] The sequence list of the labeled probe, unlabeled probe and mutant probe is shown in Table 20. The preparation method of the purified protein is the prokaryotic expression and purification of PgMYC3 protein in Example 5. The EMSA kit is purchased from Biyun Tian Biotechnology Co., Ltd.
[0273] X represents the TF tag protein, and Y represents the PgMYC3-TF fusion protein. Various reagents are added in a predetermined order, and the labeled probe is thoroughly mixed before being added. Then, the mixture is placed at room temperature for 10 minutes to eliminate non-specific binding that may occur between the probe and the protein or to preferentially perform the reaction of the cold probe. Then, the labeled probe is added and mixed thoroughly, and the mixture is placed at room temperature for 20 minutes.
[0274] (3) Electrophoresis: After the reaction is completed, 1 μl of EMSA / Gel-Shift loading buffer (colorless, 10x) is added, and the mixture is mixed uniformly and then immediately loaded. 0.5x TBE is used as the electrophoresis buffer, and the voltage is set to 100 V. When the indicator travels to the 3 / 4 position of the gel, the electrophoresis is stopped.
[0275] (4) Membrane transfer: The nylon membrane is soaked in 0.5x TBE for at least 10 minutes. During the membrane transfer, the cathode plate-sponge-filter paper-gel-membrane-filter paper-sponge-anode plate is arranged in order, and a glass rod is used to remove air bubbles. The membrane transfer is performed in an ice bath, and the current is set to 380 mA for 1 hour.
[0276] (5) UV crosslinking: The membrane is placed on a clean filter paper (ensuring that the side containing the bromophenol blue faces upwards), and then quickly transferred to the UV light source, maintaining a distance of 10 cm from the UV lamp for 15 minutes of irradiation.
[0277] (6) Blocking: An appropriate container is selected, 15 mL of blocking solution is added, and the UV-crosslinked nylon membrane is placed in the container. Then, the mixture is incubated on a horizontal shaker at a slow speed for 15 minutes.
[0278] (7) Hybridization: 7.5 μl of Streptavidin-HRP Conjugate (1:2000 dilution) is added to 15 mL of blocking solution, and the mixture is thoroughly mixed. The blocking solution on the nylon membrane is removed, and new blocking solution containing Streptavidin-HRP Conjugate is added, and the mixture is incubated on a horizontal shaker at a slow speed for 15 minutes.
[0279] (8) Rinsing: 25 ml of washing solution (5x) and 100 ml of pure water are mixed to prepare 125 ml of washing solution. The nylon membrane is transferred to a container containing 15 ml of washing solution, and rinsed for 1 minute. The washing solution is replaced and the process is repeated three times, each time for 5 minutes.
[0280] (9) Equilibrium: The nylon membrane was transferred to a container with 20 ml of detection equilibrium solution and slowly incubated on a horizontal shaker for 5 minutes.
[0281] (10) Luminescence inspection: Mix 5 ml of BeyoECL Moon A solution with 5 ml of BeyoECL Moon B solution to make a working solution. Take out the nylon membrane, remove excess liquid, evenly coat the substrate working solution, and stand at room temperature for 3 minutes. Absorb the excess substrate on the membrane side, avoid drying, and then place it under the chemiluminescence imager for development.
[0282] 8.3 Buffers and reagents required for EMSA experiment
[0283] (1) 5×TBE formula:
[0284] Table 22 TBE buffer formula
[0285]
[0286] Adjust the pH of the solution to 8.3, and dilute to 0.5× with deionized water when used;
[0287] (2) 6% non-denaturing polyacrylamide gel formula:
[0288] Table 23 EMSA non-denaturing polyacrylamide gel formula
[0289]
[0290] (3) Other buffers are from Beyotime's Chemiluminescence EMSA Kit (GS009).
[0291] Figure 5 The in vitro binding characteristics between PgMYC3 and G-box cis-acting elements were further studied by electrophoretic mobility shift assay (EMSA). A G-box element with biotin labeling was designed as a probe, and a triplex form was used for EMSA experiments to verify the binding ability of PgMYC3 to the site. The results are shown in Figure 5 Compared with the empty vector TF protein, the TF-PgMYC3 fusion protein can bind to the biotin-labeled probe, and the DNA-protein complex formed causes a decrease in electrophoretic migration speed, forming a lagging band. Through the use of 50-fold and 200-fold unlabeled competitive probes and 200-fold mutant competitive probes for competitive experiments, it can be observed that the lagging band gradually weakens with the increase in the concentration of the unlabeled competitive probe. On the contrary, when the mutant probe is introduced, the binding of the protein to the probe is less affected, showing the retention of specific binding. Therefore, these results fully prove that PgMYC3 protein can specifically bind to the G-box site in the PgPPDS promoter.
[0292] Obviously, the above-mentioned embodiments are only examples for clearly illustrating the present application, and are not intended to limit the present application. Based on the above description, other different forms of changes or variations can be made by those skilled in the art. Here, it is not necessary and also impossible to enumerate all the embodiments. The obvious changes or variations derived from the above description are still within the protection scope of the present application.
Claims
1. Application of ginseng transcription factor PgMYC3 in enhancing ginsenoside synthesis in ginseng, characterized in that, The sequence of the ginseng transcription factor PgMYC3 is shown as SEQ ID NO.
2.
2. A plasmid, characterized in that, The plasmid overexpresses the PgMYC3 gene, and the sequence of the PgMYC3 gene is shown as SEQ ID NO.
2.
3. The plasmid of claim 2, wherein, The plasmid is obtained by cutting the vector, and then connecting the PgMYC3 gene with the cut vector.
4. An Agrobacterium competent cell, characterized in that, The Agrobacterium competent cell overexpresses the PgMYC3 gene, and the sequence of the PgMYC3 gene is shown as SEQ ID NO.
2.
5. The Agrobacterium competent cell of claim 4, wherein, The Agrobacterium competent cell is obtained by transforming the plasmid of claim 2 or 3 into the EHA105 competent cell.
6. The plasmid of claim 2 or 3 or the Agrobacterium competent cell of claim 4 or 5 is used for enhancing ginsenoside synthesis in ginseng.
Citation Information
Patent Citations
PgMYC2 gene for increasing content of PPD type ginsenoside in ginseng cells and application of PgMYC2 gene
CN118185957A
Method for producing transgenic plant with increased saponin content
WO2025110670A1