Zif-8 nanomaterial with targeted covering of red blood cell membranes, and preparation method and application thereof

Abstract

The application discloses a kind of ZIF-8 nanometer materials with targeted covering red blood cell membrane and preparation method and application.The provided nanometer material includes: metal organic framework material, red blood cell membrane wrapped in the surface of metal organic framework material, and aptamer connected with the red blood cell membrane;The aptamer is Apt19S, and the metal organic framework material is ZIF-8.The nanometer material provided by the application has good stability and targeting performance, can specifically recruit bone marrow mesenchymal stem cells to participate in osteogenic differentiation, and can be used as a new type of nanometer material for promoting bone regeneration.

Description

Technical Field

[0001] The present invention belongs to the field of material science and technology, and in particular relates to a ZIF-8 nanomaterial with targeted red blood cell membrane coverage, a preparation method and an application thereof. Background Art

[0002] Metal organic framework (MOF) is a type of crystalline material constructed by metal ions and organic frameworks. It has the characteristics of diverse structures, large specific surface area, and uniform cavity. MOF materials are widely used in catalysis, sensing and drug delivery. Among them, ZIF-8 is a type of MOF with a large specific surface area and pore volume. It is an ideal drug carrier. In addition, the Zn released in ZIF-8 2+ It can promote the osteogenic differentiation of bone marrow mesenchymal stem cells. However, the use of ZIF-8 alone as a drug carrier still has some defects, such as lack of targeting ability, poor cell fusion, and easy degradation in water, which reduces its efficacy.

[0003] With the maturity of cell membrane display technology, many materials have been encapsulated within the cell membrane, thereby improving biosafety, extending blood circulation time, and enhancing cellular integration. Red blood cells (RBCs), the most abundant cells in the blood, have RBC membranes that are easily accessible, have low immunogenicity, and maintain structural stability. Combining the functionalities of RBC membranes with the properties of ZIF-8 nanomaterials can achieve effective drug delivery.

[0004] However, further improvements are needed in the delivery and targeting of nanomaterials. Summary of the Invention

[0005] The present invention aims to solve one of the technical problems in the related art to at least a certain extent. Targeted carriers can accurately deliver drugs to the target location, recruit specific cells to perform functions, and improve the utilization rate of drugs. Aptamers are short single-stranded nucleic acid sequences that can bind to target molecules. They have high affinity and specificity for specific targets and have been widely used in targeted drug delivery systems. Apt19S, as an aptamer, can recruit bone marrow mesenchymal stem cells to bone defects and promote their osteogenic differentiation. The present invention provides a ZIF-8 nanomaterial with targeted coverage of red blood cell membranes, and a preparation method and application thereof. The provided nanomaterial has the effect of promoting osteogenic differentiation of bone marrow mesenchymal stem cells and bone regeneration.

[0006] Specifically, the technical solutions provided by the present invention are as follows:

[0007] In a first aspect of the present invention, the present invention provides a nanomaterial with targeted coverage of erythrocyte membranes, comprising: a metal organic framework material, an erythrocyte membrane wrapped on the surface of the metal organic framework material, and an aptamer connected to the erythrocyte membrane;

[0008] The aptamer is Apt19S, and the metal organic framework material is ZIF-8.

[0009] The provided targeted red blood cell membrane-covered nanomaterial, when co-cultured with bone marrow mesenchymal stem cells, exhibits low cytotoxicity, high biocompatibility, and greater intracellular access, recruiting more mesenchymal stem cells to participate in osteoblastic differentiation, further promoting bone regeneration. The provided nanomaterial has excellent stability and targeting properties, specifically recruiting mesenchymal stem cells to participate in osteoblastic differentiation, and can serve as a novel nanomaterial for promoting bone regeneration.

[0010] According to an embodiment of the present invention, the sequence of Apt19S is shown as SEQ ID NO: 1.

[0011] According to an embodiment of the present invention, the aptamer is modified with cholesterol. According to an embodiment of the present invention, cholesterol may be modified at the 5' end of the aptamer.

[0012] According to an embodiment of the present invention, the average particle size of the metal-organic framework material is 200-400 nm. The average particle size of the metal-organic framework material is 200-400 nm. The average particle size of the metal-organic framework material after being wrapped by the red blood cell membrane is slightly increased. The average particle size of the targeted red blood cell membrane-covering nanomaterial is 200-400 nm.

[0013] In a second aspect of the present invention, there is provided a method for preparing the nanomaterial having targeted red blood cell membrane coverage as described in the first aspect, comprising:

[0014] extruding the metal-organic framework material and the red blood cell membrane by membrane extrusion to obtain the red blood cell membrane-coated metal-organic framework material;

[0015] The aptamer and the metal organic framework material coated with the red blood cell membrane are mixed and incubated, and the free aptamer is removed to obtain the targeted nanomaterial covering the red blood cell membrane.

[0016] The proposed method, based on metal-organic frameworks (MOFs), utilizes membrane extrusion technology to coat extracted erythrocyte membranes on the MOF surface. After modification with aptamers, the resulting nanomaterial, which targets the erythrocyte membrane, is targeted. The preparation method is simple to operate, requires simple synthesis equipment, and exhibits high biocompatibility.

[0017] According to an embodiment of the present invention, the membrane extrusion is sequentially extruded through microporous membranes with pore sizes of 400 nm and 200 nm.

[0018] According to an embodiment of the present invention, the film extrusion is a reciprocating extrusion 15 to 25 times.

[0019] According to an embodiment of the present invention, the metal organic framework material is a ZIF-8 solution, and the volume ratio of the ZIF-8 solution to the red blood cell membrane solution is 4:1.

[0020] According to an embodiment of the present invention, the volume ratio of the aptamer to the red blood cell membrane-coated metal-organic framework material is 1:200-240.

[0021] In a third aspect of the present invention, a targeted application of a nanomaterial covering erythrocyte membranes in promoting osteogenic differentiation of bone marrow mesenchymal stem cells and bone regeneration is provided.

[0022] According to a specific embodiment, the targeted nanomaterial covering red blood cell mill is used as a carrier of bone marrow mesenchymal stem cells.

[0023] The beneficial effects achieved by the present invention include at least:

[0024] (1) The ZIF-8 nanomaterial with targeted coverage of erythrocyte membranes of the present invention has a uniform nanostructure, is easy to operate, and has high biosafety. The Zn released by the ZIF-8 metal organic framework material 2+ It can promote the osteogenic differentiation of mesenchymal stem cells and bone regeneration.

[0025] (2) The nanomaterial with targeted red blood cell membrane coverage described in the present invention uses red blood cell membrane to cover the metal organic framework material, thereby enhancing compatibility with the cell membrane and promoting more material to be taken up by cells; maintaining structural integrity and reducing drug leakage.

[0026] (3) The nanomaterial with targeted coverage of red blood cell membranes described in the present invention is connected to an aptamer targeting mesenchymal stem cells, which can specifically recruit bone marrow mesenchymal stem cells to exert osteogenic differentiation function.

[0027] (4) The nanomaterial with targeted coverage of red blood cell membranes described in the present invention can be used as a carrier to improve material properties, accurately target bone defect areas, and promote bone regeneration. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a transmission electron microscopy image of ZIF-8@RM-Apt prepared according to Example 1 of the present invention.

[0029] Figure 2 Graph showing the particle size distribution of ZIF-8 and ZIF-8@RM-Apt prepared according to Example 1 of the present invention.

[0030] Figure 32 is the potential distribution diagram of ZIF-8, RM and ZIF-8@RM-Apt prepared according to Example 1 of the present invention.

[0031] Figure 4 This is a fluorescence confocal microscopy image of ZIF-8@RM-Apt prepared in Example 1 of the present invention after co-culture with bone marrow mesenchymal stem cells.

[0032] Figure 5 1 is the CCK-8 test result after co-culturing ZIF-8 and ZIF-8@RM-Apt prepared in Example 1 of the present invention with bone marrow mesenchymal stem cells.

[0033] Figure 6 The ALP staining results of bone marrow mesenchymal stem cells after osteogenic induction by ZIF-8 and ZIF-8@RM-Apt prepared in Example 1 of the present invention. DETAILED DESCRIPTION

[0034] The embodiments of the present invention are described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0035] The present invention provides a targeted nanomaterial covering red blood cell membranes, comprising: a metal organic framework material, a red blood cell membrane wrapped on the surface of the metal organic framework material, and an aptamer connected to the red blood cell membrane;

[0036] The aptamer is Apt19S, and the metal organic framework material is ZIF-8.

[0037] The aptamer Apt19S used is specifically designed to recognize and bind to mesenchymal stem cells. Its binding rate to various non-stem cells is low and it can be used to study the specific binding and directional recruitment of stem cells. ZIF-8 is a metal organic framework material with good biocompatibility and low cytotoxicity. The released Zn 2+ It can promote osteogenesis. The red blood cell membrane is non-immunogenic, which can maintain the stability of the internal material and enhance fusion with the cell membrane. The provided targeted red blood cell membrane-covered nanomaterial, when co-cultured with bone marrow mesenchymal stem cells, has low cytotoxicity, high biocompatibility, and is more easily absorbed into the cells, recruiting more bone marrow mesenchymal stem cells to participate in osteogenic differentiation, further promoting bone regeneration.

[0038] According to a specific embodiment, the sequence of Apt19S is shown as SEQ ID NO: 1.

[0039] The sequence shown in SEQ ID NO: 1 is as follows:

[0040] AGGTCAGATGAGGAGGGGGACTTAGGACTGGGTTTATGACCTATGCGTG(5'—3')

[0041] (SEQ ID NO: 1)

[0042] According to a specific embodiment, the aptamer is modified with cholesterol. Considering that the red blood cell membrane is a lipid structure, cholesterol modification of the aptamer can be more conducive to the connection between the aptamer and the red blood cell membrane, and the connection efficiency is better than other modifications.

[0043] The present invention also provides a method for preparing the ZIF-8 nanomaterial having the targeted red blood cell membrane covering property, comprising:

[0044] extruding the metal-organic framework material and the red blood cell membrane by membrane extrusion to obtain the red blood cell membrane-coated metal-organic framework material;

[0045] The aptamer and the metal organic framework material coated with the red blood cell membrane are mixed and incubated, and the free aptamer is removed to obtain the targeted nanomaterial covering the red blood cell membrane.

[0046] According to a specific embodiment, the membrane extrusion is sequentially extruded through microporous membranes with pore sizes of 400 nm and 200 nm.

[0047] According to a specific embodiment, the film extrusion is reciprocating extrusion 15 to 25 times, for example 20 times.

[0048] According to a specific embodiment, the metal-organic framework material is a ZIF-8 solution, and the volume ratio of the ZIF-8 solution to the erythrocyte membrane is 4:1. During the research process, it was found that when the amount of ZIF-8 solution is too much, there will be more ZIF-8 particles that are not coated by the erythrocyte membrane; when the amount of erythrocyte membrane is too much, there will be more erythrocyte membranes that are not coated with ZIF-8 particles scattered in the material. Through transmission electron microscopy, it was found that when there is a suitable concentration ratio, the ZIF-8 particles and erythrocyte membranes will be more fully utilized and coated, otherwise there will be more residual ZIF-8 or erythrocyte membranes, thereby affecting the quality of the prepared targeted erythrocyte membrane-covered nanomaterial. Moreover, because there is too much ZIF-8 or erythrocyte membrane, it needs to be specially removed, which makes the preparation process more complicated and more difficult.

[0049] The aptamer mentioned is provided in the form of an aptamer solution. According to a specific embodiment, the volume ratio of the aptamer to the red blood cell membrane-coated metal-organic framework material is 1:200-240. When the aptamer content is too much, the aptamer that cannot bind to the red blood cell membrane-coated metal-organic framework material will exist in the solution in a free manner and can be removed after washing. When the aptamer content is too little, some red blood cell membrane-coated metal-organic framework materials cannot fully bind to the aptamer, and the efficiency is low. In our experiments, the aptamers synthesized according to the sequence have a concentration and recommended usage amount, which can meet the requirements of fully binding to the red blood cell membrane without too much waste. Red blood cell membrane coating will increase the particle size of the metal-organic framework to a certain extent. Under this ratio condition, a nanomaterial with a suitable volume and targeted coverage of the red blood cell membrane can be obtained, and can achieve better biological effects, and has little effect on the transport and release of the nanomaterial in the cell.

[0050] According to a specific embodiment, the ZIF-8 solution is obtained by resuspending ZIF-8 particles in distilled water and ultrasonically dispersing them. The ZIF-8 particles are obtained by mixing 2-methylimidazole and zinc nitrate hexahydrate, stirring, centrifuging the resulting suspension, and collecting white precipitated particles.

[0051] According to a specific embodiment, the molar ratio of zinc nitrate hexahydrate to 2-methylimidazole is 1:(20-24). If the molar ratio of zinc nitrate hexahydrate to 2-methylimidazole is too high or too low, the properties of the resulting material may change, such as failure to nucleate to form a suspension, too small or too large particle size, and color mismatch.

[0052] According to a specific embodiment, the incubation is carried out at 4 degrees Celsius for 10 to 20 hours. After the incubation, the aptamer is removed by centrifugation at a speed of 5000 to 10000 rpm.

[0053] According to a specific embodiment, the red blood cell membrane solution is obtained by the following method:

[0054] After blood is collected from the animal, the blood is subjected to a series of centrifugation processes, and the obtained white precipitate is dissolved in a buffer solution to obtain a red blood cell membrane solution. The volume ratio of the animal blood volume to the red blood cell membrane solution is 6-7:1.

[0055] The animal mentioned is rat, and the sequence of Apt19S used is the sequence shown in SEQ ID NO: 1. The present invention also provides a use of a targeted nanomaterial covering erythrocyte membranes in preparing a material for promoting osteogenic differentiation of bone marrow mesenchymal stem cells and bone regeneration.

[0056] According to a specific embodiment, the provided targeted erythrocyte membrane-covering nanomaterial can be a ZIF-8 nanomaterial covering the erythrocyte membrane, which is connected to an Apt19S aptamer and can be used as a carrier of bone marrow mesenchymal stem cells.

[0057] The present invention co-cultures a targeted red blood cell membrane-covered nanomaterial with bone marrow mesenchymal stem cells to observe its targeting and osteogenesis effects. A random sequence aptamer (Random Apt) is used as a control. The experimental results show that Apt19S has stronger targeting.

[0058] The ZIF-8 material is coated with readily available erythrocyte membranes, which have low immunogenicity and minimal impact on the material's volume. Compared to other membrane materials, such as bone marrow mesenchymal stem cell membranes, this eliminates the challenges of difficult-to-control extraction efficiency and volume, resulting in larger membrane volumes.

[0059] ZIF-8 material, due to its strong loading capacity and high biocompatibility, can release Zn 2+ , which has various applications. However, the present invention coats erythrocyte membranes on ZIF-8 materials and, based on their properties, links them to the cholesterol-affinity Apt19S sequence, thereby overcoming the problems of easy degradation, insufficient targeting, and low efficiency. The provided targeted erythrocyte membrane-coated nanomaterial can be used as a carrier to precisely target bone defects and promote bone regeneration.

[0060] The protection scheme of the present invention is described below by specific examples. It should be noted that these examples are only used to facilitate the understanding of those skilled in the art and should not be regarded as limiting the scope of protection of the present invention. Unless otherwise specified, the reagents used in the examples can be obtained commercially. The prepared targeted erythrocyte membrane-covering nanomaterial is numbered "ZIF-8@RM-Apt".

[0061] Example 1

[0062] Example 1: The targeted red blood cell membrane-covering nanomaterial ZIF-8@RM-Apt was prepared by the following method.

[0063] (1) Preparation of ZIF-8 nanomaterials:

[0064] First, dissolve 65.6 mg of 2-methylimidazole in 0.5 mL of distilled water to prepare a 2-methylimidazole solution. Then, dissolve 11.88 mg of zinc nitrate hexahydrate in 0.5 mL of distilled water to prepare a zinc nitrate hexahydrate solution. Slowly drip the zinc nitrate hexahydrate solution into the 2-methylimidazole solution while stirring. After stirring at room temperature for 4 hours, transfer the resulting milky white suspension to a centrifuge tube. Centrifuge at 10,000 rpm for 10 minutes, discard the supernatant, add distilled water, and centrifuge three times to collect the white ZIF-8 precipitate.

[0065] (2) Extraction of red blood cell membrane:

[0066] Five rats were anesthetized with intraperitoneal injection of sodium pentobarbital. Blood was collected from the abdominal aorta under negative pressure into citrate-containing anticoagulant tubes (4 tubes, 8 mL each). After balancing, the blood was centrifuged at 4000 rpm for 20 minutes, and the supernatant and the intermediate layer of white fluffy material were discarded. The lower red precipitate was resuspended in 3 volumes of pre-chilled PBS, centrifuged at 4000 rpm for 20 minutes, and the supernatant was discarded. This was repeated three times. The lower red precipitate was then resuspended in 40 volumes of Tris-HCl (10 mM, pH 7.4) and allowed to stand at 4°C for 1.5 hours. The supernatant was discarded after ultracentrifugation at 9000 rpm for 20 minutes. The white precipitate, representing the erythrocyte membranes, was then resuspended in pre-chilled PBS, ultracentrifuged at 9000 rpm for 20 minutes, and the supernatant was discarded. This was repeated three times. The resulting white precipitate, representing the erythrocyte membranes, was collected in 5 mL of PBS into a 15 mL centrifuge tube for later use.

[0067] (3) Preparation of ZIF-8 nanomaterials covering red blood cell membranes:

[0068] The ZIF-8 particles obtained in step (1) were resuspended in 1200 μL of distilled water, ultrasonically dispersed, and then mixed with 300 μL of red blood cell membrane obtained in step (2). The particles were squeezed through microporous membranes with pore sizes of 400 nm and 200 nm in sequence using a membrane squeezer, and squeezed back and forth 20 times to obtain red blood cell membrane-coated ZIF-8 material.

[0069] (4) Preparation of aptamer-linked ZIF-8 nanomaterials covering erythrocyte membranes:

[0070] 5 μL of the cholesterol-modified aptamer solution was added dropwise to the ZIF-8 covering the red blood cell membrane obtained in step (3), incubated at 4 °C for 12 h, centrifuged at 5000 rpm for 5 min to remove the free aptamer, and washed three times by centrifugation with distilled water to collect ZIF-8@RM-Apt.

[0071] The transmission electron microscopy image of the prepared ZIF-8@RM-Apt is shown in Figure 1 As shown, the results show that ZIF-8@RM-Apt has a hexahedral structure and is wrapped by a membrane structure on the outer layer.

[0072] The particle size distribution of the prepared ZIF-8 and ZIF-8@RM-Apt is shown in Figure 2 As shown, the results show that the particle size gradually increases from ZIF-8 to ZIF-8@RM-Apt, and the particle size of ZIF-8@RM-Apt is about 270nm.

[0073] The potential distribution diagrams of the prepared ZIF-8, RM red blood cell membrane and ZIF-8@RM-Apt are shown in Figure 2. Figure 3 As shown, the results show that the potential of ZIF-8 is approximately 19mV, the potential of RM red blood cell membrane is approximately -31mV, and the potential of ZIF-8@RM-Apt is approximately -26mV.

[0074] 1×10 5 Rat bone marrow mesenchymal stem cells were seeded onto a 15 mm diameter cell slide and cultured in a 37°C incubator for 12 hours. Then, 10 μL of ZIF-8@RM-Apt, which contains a red fluorescent dye (Random-Apt or Apt19S), was added to the cells for co-culture. After 6 hours of co-culture in a 37°C incubator, the cells were rinsed three times with distilled water, fixed with 4% paraformaldehyde, and stained for nuclei with DAPI and cell membranes with DIO dye. Confocal microscopy was then performed.

[0075] Fluorescence confocal microscopy results Figure 4 As shown, ZIF-8@RM-Apt co-localizes with the cells and can enter the cytoplasm. The sequence of the aptamer Aptamer is a random sequence (Random-Apt, the random sequence is the control sequence, the length is consistent with Apt19S, and the sequence is an arbitrary sequence) or a mesenchymal stem cell-targeted sequence (Apt19S). In the figure, green represents the bone marrow mesenchymal stem cell membrane, red represents the aptamer, and blue represents the cell nucleus. Through the co-localization image, it can be concluded that the material of the Apt19S group can be taken up by bone marrow mesenchymal stem cells after 6 hours of co-culture, while the material of the Random-Apt group is still around the cells.

[0076] Example 2

[0077] Example 2 evaluated the cytotoxicity of the prepared ZIF-8@RM-Apt material, including the following:

[0078] 1×10 5Rat bone marrow mesenchymal stem cells were seeded into 12-well plates and cultured in a 37°C incubator for 12 hours. Then, 10 μL of ZIF-8 and ZIF-8@RM-Apt were added to the cells for co-culture. The cell culture medium was replaced and ZIF-8 and ZIF-8@RM-Apt materials were added every two days. The cell activity was detected using a CCK-8 kit (manufacturer: MCE, China) on the 1st, 3rd, and 5th days of co-culture, respectively.

[0079] See the results Figure 5 As shown in the results, ZIF-8 and ZIF-8@RM-Apt showed no obvious cytotoxicity and had high biosafety.

[0080] Example 3

[0081] Example 3 evaluated the effect of the prepared material on the osteogenic differentiation of bone marrow mesenchymal stem cells, including the following:

[0082] 1×10 5 Rat bone marrow mesenchymal stem cells were seeded into 12-well plates and cultured in a 37°C incubator for 12 hours. 10 μL of ZIF-8 and ZIF-8@RM-Apt were then added to the cells for co-culture. The medium and materials were changed every two days. After 7 days of culture in osteogenic induction medium, the cells were rinsed three times with distilled water, fixed with 4% paraformaldehyde, and stained with an ALP staining kit (manufacturer: Beyotime, China).

[0083] See the results Figure 6 As shown in the results, both ZIF-8 and ZIF-8@RM-Apt can promote the osteogenic differentiation of bone marrow mesenchymal stem cells, and the effect of ZIF-8@RM-Apt is stronger.

[0084] The material provided by the present invention can be used to promote osteogenic differentiation of bone marrow mesenchymal stem cells. By co-culturing ZIF-8@RM-Apt with bone marrow mesenchymal stem cells, more cells can be targeted to participate in osteogenic differentiation. The fusion between the cell membranes is conducive to the uptake of ZIF-8 particles by bone marrow mesenchymal stem cells. 2+ The release of can further promote osteogenic differentiation. Therefore, the present invention can be used as a targeted drug delivery system to enhance the osteogenic differentiation of bone marrow mesenchymal stem cells and has great potential to promote bone regeneration.

[0085] In the description of this specification, reference to the terms "one embodiment," "some embodiments," "specific implementation methods," etc., means that the specific features, structures, materials, or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0086] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A nanomaterial with targeted coverage of red blood cell membranes, characterized in that: include: A metal-organic framework material, an erythrocyte membrane wrapped on the surface of the metal-organic framework material, and an aptamer connected to the erythrocyte membrane; The aptamer is Apt19S, The metal organic framework material is ZIF-8.

2. The nanomaterial with targeted red blood cell membrane coverage according to claim 1, characterized in that: The sequence of Apt19S is shown in SEQ ID NO:

1.

3. The nanomaterial with targeted red blood cell membrane coverage according to claim 1, characterized in that: The aptamer has a cholesterol modification.

4. The nanomaterial with targeted red blood cell membrane coverage according to claim 1, characterized in that: The average particle size of the metal organic framework material is 200-400 nm; The average particle size of the targeted red blood cell membrane-covering nanomaterial is 200nm-400nm.

5. A method for preparing the nanomaterial with targeted red blood cell membrane coverage according to any one of claims 1 to 4, characterized in that: include: extruding the metal-organic framework material and the red blood cell membrane by membrane extrusion to obtain the red blood cell membrane-coated metal-organic framework material; The aptamer and the metal organic framework material coated with the red blood cell membrane are mixed and incubated, and the free aptamer is removed to obtain the nanomaterial with targeted red blood cell membrane coverage.

6. The method according to claim 5, characterized in that The membrane extrusion is sequentially extruded through microporous membranes with pore sizes of 400 nm and 200 nm; Optionally, the film extrusion is reciprocating extrusion 15 to 25 times.

7. The method according to claim 5, characterized in that The metal organic framework material is a ZIF-8 solution, and the volume ratio of the ZIF-8 solution to the red blood cell membrane solution is 4:

1.

8. The method according to claim 5, characterized in that The aptamer is prepared as an aptamer solution, and the volume ratio of the aptamer solution to the red blood cell membrane-coated metal organic framework material is 1:200-240.

Images